RESUMO
Bacterial panicle blight (BPB) is among the three most limiting rice diseases in Louisiana and the southern United States. The identity and characterization of pathogens associated with this disease was unclear. This research details studies carried out on the pathogens causing BPB on rice in Louisiana and other rice producing southern states. Bacterial strains were isolated from BPB-infected sheath, panicle, or grain samples collected from rice fields in Louisiana, Arkansas, Texas, and Mississippi. In greenhouse inoculation tests, 292 of 364 strains were pathogenic on rice seedlings or panicles. Identification of strains in the pathogen complex by growth on S-PG medium, carbon source utilization profile (Biolog), cellular fatty acid analysis, and polymerase chain reaction (PCR) methods revealed that 76 and 5% of the strains were Burkholderia glumae and B. gladioli, respectively. The other strains have not been conclusively identified. Although strains of both species produced similar symptoms on rice, B. glumae strains were generally more aggressive and caused more severe symptoms on rice than B. gladioli. Virulent strains of both species produced toxoflavin in culture. The two species had similar growth responses to temperature, and optima ranged from 38 to 40°C for B. glumae and 35 to 37°C for B. gladioli. PCR was the most sensitive and accurate method tested for identifying the bacterial pathogens to the species level. The 16S rDNA gene and 16S-23S rDNA internal transcribed spacer (ITS) region sequences of the B. glumae and B. gladioli strains from rice showed more than 99% sequence homology with published sequences. A real-time PCR system was developed to detect and quantify this pathogen from infected seed lots. Our results clearly indicate that B. glumae and B. gladioli were the major pathogens causing BPB in the southern United States.
RESUMO
Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.
RESUMO
Rice cultivars high in partial resistance (Jasmine, LSBR-5), moderately susceptible (Drew and Kaybonnet), and susceptible (Lemont and Labelle) to sheath blight were grown in a silicon-deficient Histosol with and without calcium silicate slag. The treatment with silicon increased the concentration of this element in plant tissue by 80%over all experiments. Fertilization with silicon significantly reduced the severity of sheath blight, and the total area under the vertical lesion extension progress curve on moderately susceptible and susceptible cultivars compared to those cultivars high in partial resistance without silicon. The percentage of infected tillers was significantly reduced by 82, 42, 28, 41, 26, and 17%respectively for Jasmine, LSBR-5, Drew, Kaybonnet, Lemont, and Labelle, when silicon was applied, over all experiments. Dry matter accumulation was significantly greater with added silicon. In the absence of disease, silicon enhanced dry matter accumulation by 15%over the control, whereas silicon more than doubled the mean dry matter accumulation in infected plants. The application of silicon to complement host resistance to sheath blight appears to be an effective strategy for disease management in rice, especially when the soil is low or limiting in plant-available silicon.
RESUMO
False smut, caused by Ustilaginoidea virens (Cooke) Takah., has been occurring in Louisiana rice since at least 1906 (4). A color plate (no. 69) of the disease was published in the Compendium of Rice Diseases published by the American Phytopathological Society (3). The slide for this plate was taken by M. C. Rush in 1976 of rice grown at the Rice Research Station at Crowley, LA. Since that time, the disease has been sporadic and light in Louisiana. In 1997, however, incidence was high. False smut was present on many germ plasms at the Rice Research Station in Crowley and was observed on commercial cultivars in several growers' fields in southwestern Louisiana. Incidence ranged from 1 to 15% of tillers infected with at least two to three spore balls per infected panicle. The disease occurred on both long- and medium-grain cultivars. False smut of rice occurs in the field at the hard dough to mature stages of the crop. A few spikelets in a panicle transform into globose, yellowish green, velvety spore balls that are 2 to 5 cm in diameter and covered by a thin orange membrane. The membrane bursts open and releases powdery dark green spores. The chlamydospores formed in the spore balls are spherical to elliptical, warty, olivaceous, and 3 to 5 × 4 to 6 µm in dimension. Some of the spore balls develop one or more sclerotia, which are the overwintering structure, in the center. False smut has been considered a minor disease of rice that occurs sporadically in Louisiana. The recent discovery of ustilotoxin, a phytotoxin and mycotoxin, produced by this pathogen on diseased tissues suggests that the fungus may be of concern as a contaminant on rice products consumed by livestock and humans (1,2). This increases the need to monitor the incidence of this disease. References: (1) Koiso et al. Ustiloxin: A phytotoxin and a mycotoxin from false smut balls on rice panicles. Tetrahedron Lett. 33:4157, 1992. (2) Koiso et al. Ustiloxins, antimitotic cyclic peptides from false smut balls on rice panicles caused by Ustilaginoidea virens. J. Antibiot. 47:765, 1994. (3) F. N. Lee and P. S. Gunnel. 1992. Compendium of Rice Diseases. The American Phytopathological Society, St. Paul, MN. p. 28. (4) W. A. Orton. 1907. Plant diseases of 1906. Yearbook U.S. Department of Agriculture. U.S. Government Printing Office, Washington, DC, pp. 499-508.
RESUMO
White leaf streak, caused by Mycovellosiella oryzae (Deighton and Shaw) Deighton (syn. Ramularia oryzae), was found in Louisiana rice. The symptoms closely resemble those of narrow brown leaf spot caused by Cercospora janseana (Racib.) O. Const. (syn. C. oryzae (Miyake)), and it is difficult to distinguish between these two diseases. Initially both produce similar elongated light brown lesions, but later the lesions of white leaf streak become wider with a whitish center and are surrounded by a narrow light brown margin (2,3). The disease was first observed at the Rice Research Station, Crowley, LA, in 1996 on older leaves of the cultivar Lemont at maturity. Leaves containing the unusual lesion types were placed in a moist chamber and incubated at 28°C for 5 days. Abundant conidia were produced and the fungus was isolated on acidified potato dextrose agar (APDA) by single spore isolation and by plating infected tissues after surface sterilization in 40% Clorox for 10 to 15 min. The colonies grew slowly on APDA and were dark gray in color. The conidia formed in branched chains or singly. They were hyaline, cylindrical with tapering ends and a thick hilum; 0 to 3 septate, and 15 to 35 m long (1,3). Pathogenicity tests were conducted in the greenhouse on the Lemont and Cypress rice cultivars by spraying a conidial suspension (103-4 conidia per ml) onto leaf blades at boot stage. Conidia were produced by growing the fungus on PDA for 10 to 14 days. Inoculated plants were placed inside a humid chamber in a greenhouse and maintained for 4 to 5 weeks. Many elongated lesions similar to those observed in the field were produced 3 to 4 weeks after inoculation. Reisolation from these lesions yielded M. oryzae. With the same methods, 45 cultivars and lines were inoculated to determine their reactions to this disease. Most of the cultivars grown in the southern United States were moderately susceptible or susceptible to white leaf streak. Foreign cultivars tested, including BR-7, BR-11, Cica-4, Cica-6, Cica-7. Cica-8, Cica-9, Oryzica llanos, Rax clear, Teqing, and Tetep, were resistant. In 1997, the disease was found prevalent on many cultivars grown at the Rice Research Station, Crowley, LA. As symptoms of both white leaf streak and narrow brown leaf spot were sometimes observed on the same leaf; it is possible that the disease has been present, but not identified as a separate disease because of the similarity of the symptoms of the two diseases. A thorough survey is necessary to determine the extent of its occurrence and further studies are necessary to determine its yield loss potential. At present it appears to be a minor problem for Louisiana rice. White leaf streak has previously been recorded from Papua New Guinea on cultivated Oryza sativa, and from the Solomon Islands, Sabah, Nizeria, and Sierra Leone on cultivated O. glabberima Steudel and on wild perennial rice O. berthii A. Chev. (2). This is the first report of white leaf streak on cultivated rice in the United States. References: (1) F. C. Deighton. Mycol. Pap., CMI 144:1,1979. (2) F. C. Deighton and D. Shaw. Trans. Br. Mycol. Soc. 43: 515, 1960. (3) B. C. Sutton and A. K. M. Shahjahan. Nova Hedwigia 25:197, 1981.
RESUMO
The process linking organizational citizenship behavior (OCB) with performance judgments was investigated in a field and a laboratory study. In the field study, managers rated the task performance and OCB of 148 subordinates. In the laboratory research, 136 students viewed and rated videotaped segments of teaching performance that demonstrated either high or low task performance and high or low OCB. In both studies, liking and perceived affective commitment mediated the relationship between OCB and overall evaluation. Liking also mediated the relationship between OCB and reward recommendations. Further, the field study indicated that the causal motive attributed by the manager for the employee's OCB mediated the relationship between OCB and overall evaluation.
Assuntos
Avaliação de Desempenho Profissional , Conformidade Social , Adulto , Afeto , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Motivação , Teoria Psicológica , Análise de Regressão , Desejabilidade Social , Sudeste dos Estados UnidosRESUMO
Five serological strains of tobacco ringspot virus isolated from naturally infected tobacco in North Carolina, and a strain isolated from watermelon in the Rio Grande Valley of Texas were transmitted from cucumber to cucumber by mass-screened and handpicked Xiphinerna americanum from North Carolina. The Eucharis mottle strain from Peru was not transmitted, indicating that a specific strain-vector relationship may exist between the geographically isolated strains from North and South America.
RESUMO
Aphelenchoides besseyi, the nematode causal agent of white-tip disease of rice, was recovered from 5.5% of 474 seed samples obtained from rice seed warehouses in Louisiana. Laboratory tests in which A. besseyi-infested rice seed was treated with Phostoxin(R), a compound used for control of insects in stored grain, indicate that it also has nematicidal properties. In 18-week-duration greenhouse tests, populations of A. besseyi increased 4-5-fold on the cultivars Saturn and Melrose and 3-fold on Nova '76. Green weights of Nova '76 plants inoculated with A. besseyi and Sclerotium oryzae, the causal agent of rice stem rot, were significantly reduced below those of plants inoculated with either organism alone or with distilled water. Weights of Melrose plants were reduced significantly by treatments with A. besseyi alone and A. besseyi plus S. oryzae, but not by S. oryzae alone. Saturn plant weights were not reduced significantly by either organism alone or by the two in combination.
RESUMO
Cautiousness has been implicated in the literature as a possible factor responsible for observed performance decrements among older adults in a number of research paradigms. This study sought to assess whether the speed and accuracy of performance on a perceptual-cognitive task (the Stroop Color-Word Interference Test) differed significantly for more and less cautious older adults. The participants (N = 41), ranging from 55 to 81 years of age, were classified as either more cautious (n = 20) or less cautious (n = 21) on the basis of their responses on a personality test. Results indicated that cautiousness among older adults was manifested more in terms of the accuracy of response (fewer errors of commission) than in terms of the speed of response, and that level of cautiousness increased with increasing age.
Assuntos
Envelhecimento/psicologia , Atenção , Percepção de Cores , Testes Psicológicos , Semântica , Idoso , Idoso de 80 Anos ou mais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Tempo de ReaçãoRESUMO
The authors proposed employee age as moderating the structural stability of altruistic organizational citizenship behavior (OCB) with regard to the influence of context-relevant attitudes and dispositional variables. Analyses of peer ratings of altruistic OCB in a sample of 96 U.S. nurses showed that the contextual variables of job satisfaction, organizational commitment, and trust in management were germane for the younger participants. The dispositional variable of moral judgment was a unique predictor of altruistic OCB among the older participants.
Assuntos
Altruísmo , Satisfação no Emprego , Cultura Organizacional , Política Organizacional , Adulto , Fatores Etários , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Enfermeiras e Enfermeiros , Gestão de Recursos Humanos , Revelação da VerdadeRESUMO
Extended the literature on age differences on the Hand Test using a multivariate model to examine absolute and relative differences in response. Participants were 47 adults (M age = 22.47 yrs.), 24 males and 23 females; and 45 older adults (M age = 64.87 yrs.), 21 males and 24 females. Data were analyzed in terms of percentage of response and absolute frequency of specific responses, between the age groups. Results indicated similar findings to those previously reported for the Hand Test, though magnitude of personality deterioration or withdrawal was lessened, for the percentage analysis. Results indicated the importance of using both absolute frequency of response and percentage of response in the interpretation of projective test data, especially for older adults.
Assuntos
Envelhecimento , Técnicas Projetivas , Adulto , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Psicometria , Fatores SexuaisRESUMO
The present investigation simultaneously examined age-related differences in the ability to maintain and reorient auditory selective attention. The maintenance and reorientation components of attention were assessed by means of an auditory listening task involving 24 dichotic trails. The trails were counter-balanced for right-ear and left-ear relevance, with each trail involving two parts. The first part required maintenance of attention and second part required a reorientation of attention. The participants for the study were 90 community-living women recruited to represent an age continuum of young adult, adult, and older adult. It was hypothesized that there would be a significant decrement in both maintenance and reorientation of attention with increasing age, and that reorientation of attention would be more difficult than maintenance of attention, particularly for older adults. The results of multivariate and univariate analyses confirmed the hypotheses and suggested that an inability to reorient attention, coupled with a tendency for right-ear set, was primarily responsible for the manifest differences in selective attention ability of older adults. The results are discussed in terms of theoretical implications and the relationship of the findings with previous research.
Assuntos
Envelhecimento , Atenção , Percepção Auditiva , Adulto , Idoso , Sinais (Psicologia) , Feminino , Lateralidade Funcional , Humanos , Pessoa de Meia-Idade , Assunção de RiscosRESUMO
The purpose of the present study was to investigate simultaneously differences between normal institutionalized older adults and community-living older adults with respect to intelligence/cognitive test performance and personality. Participants were 25 community-living females (M age = 72.9 yrs, SD = 6.34) and 25 institutionalized females (M age = 80.0 yrs, SD = 6.46). Intellectual/cognitive ability was assessed by the WAIS, Stanford-Binet Intelligence Scale (Form L-M), Ravens Coloured Progressive Matrices; personality was assessed by the Hand Test, a projective technique. Several multivariate analyses (discriminant analysis) were conducted. Results suggested that even when controlling for age and level of education, institutionalization appears to be associated with intellectual/cognitive as well as personality deficits. The findings were discussed in terms of the potential implications for the professional working with institutionalized older adults.
Assuntos
Inteligência , Casas de Saúde , Personalidade , Meio Social , Idoso , Feminino , Humanos , Ajustamento SocialRESUMO
The present study examines systematic variation in the pattern of response to the Stroop test among a sample of older adults (N = 41), as well as the extent to which various configural patterns of response are related to other individual difference factors. Pattern analysis identified four reasonably prototypic patterns of performance. Three significant discriminant functions, capable of differentiating the four response patterns, were significantly and uniquely related to age, level of cautiousness, and verbal intelligence, respectively. The analyses suggest that performance on the Stroop test is multidimensional with significant variation among older adults, and that different components of performance are differentially related to unique individual difference variables. The findings reinforce the importance of recognizing and understanding the nature of individual variation among elderly individuals in aging research.
Assuntos
Idoso/psicologia , Individualidade , Testes Psicológicos , Fatores Etários , Idoso de 80 Anos ou mais , Escolaridade , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Técnicas Projetivas , Psicometria , Tempo de ReaçãoRESUMO
AIM: To identify antimicrobial peptides with high lytic activity against Rhizoctonia solani strain LR172, causal agent of rice sheath blight and aerial blight of soyabeans in the US. METHODS AND RESULTS: Among 12 natural and synthetic antimicrobial peptides tested in vitro, the wheat-seed peptide, purothionin, showed the strongest inhibitory activity that was similar to the antifungal antibiotics, nystatin and nikkomycin Z. Cecropin B, a natural peptide from cecropia moth, and synthetic peptide D4E1 produced the highest inhibitory activity against R. solani among linear peptides. Membrane permeabilization levels strongly correlated with antifungal activity of the peptides. Noticeable changes in membrane integrity were observed at concentrations of >/=0.5 micromol l(-1) for purothionin, 2 micromol l(-1) for cecropin B, D4E1, D2A21, melittin, and phor21, and 8 micromol l(-1) for magainin II and phor14. An increase of nuclear membrane permeabilization was observed in fungal cells treated with cecropin B, but not with purothionin. Diffusion of nuclear content was observed by fluorescent microscopy 10 min after adding a lethal concentration of cecropin B. Evaluation by electron microscopy confirmed severe cytoplasmic degradation and plasma membrane vesiculation. Purothionin and cecropin B were the most stable against proteolytic degradation when added to liquid cultures of R. solani. CONCLUSIONS: Purothionin, cecropin B, D4E1 and phor21 were shown to exhibit high in vitro lytic activity against R. solani strain LR172 for rice and soyabean. These peptides are greater than 16 amino acids long and rapidly increase fungal membrane permeabilization. Resistance to proteolysis is important for sufficient antifungal activity of antimicrobial peptides. SIGNIFICANCE AND IMPACT OF THE STUDY: Selected antimicrobial peptides offer an attractive alternative to traditional chemicals that could be utilized in molecular breeding to develop crops resistant to rice sheath blight and aerial blight of soyabean.