[Analysis of allergen-specific IgE in children with atopic dermatitis from 2021 to 2023 in a hospital of pediatric in Tianjin City].

Objective: To explore the distribution of allergen-specific IgE (sIgE) for children with atopic dermatitis in Tianjin City and provide the evidences of clinical diagnosis and treatment. Methods: A retrospective cross-sectional study was conducted to analyze the children who were suspected of atopic dermatitis and tested for serum sIgE in the Tianjin Children's Hospital from March 2021 to February 2023. Using first detection results only, a total of 1 841 serum samples were tested for twenty common allergens. The method was the enzyme-linked immune capture assay. The allergen epidemiological characteristics were statistically analyzed by Chi square test based on the children's characteristics and factors such as different sexes, ages and seasons by the mass data. Results: Among the 1 841 cases, the results showed that 1 247 (67.73%) were sensitized to at least 1 allergen-sIgE, comprising to 49.86% (918/1 841) to food allergen-sIgE and 47.96% (883/1 841) to aeroallergen-sIgE. The top three food allergens-sIgE were egg 32.10% (591/1 841), milk 25.91% (477/1 841) and wheat flour 14.61% (269/1 841); the top three positive rates of aeroallergens-sIgE were house dust 24.33% (448/1 841), alternaria 20.59% (379/1 841) and dermatophagoides farinae 14.83% (273/1 841). The positive rates of food allergens-sIgE were the highest in the 1-3 years old group (64.11%, 434/677) (χ2=122.854, P<0.001), while the positive rates of aeroallergens-sIgE were higher in the 11-14 years old group (71.26%, 62/87) (χ2=134.968, P<0.001). No seasonal difference was revealed in the overall positive rate of food allergen-sIgE and aeroallergen-sIgE (χ2=4.047, P=0.256; χ2=7.549, P=0.056). The positive rates of soybean-sIgE and milk-sIgE were the highest in summer (χ2=11.329, P=0.010; χ2=28.720, P<0.001), whereas alternaria-sIgE and mugwort-sIgE were the highest in summer and autumn, respectively (χ2=8.462, P=0.037; χ2=10.641, P=0.014). Among the 1 841 cases, 32.21% were sensitized to three or more allergens-sIgE. The sIgE concentration levels of egg, milk and house dust were mainly level 1 to 2, and the proportions of level 3 and above were all under 15%; although the positive rates of crab, shrimp, and peanut were low, the proportions of grade 3 and above were all beyond 30%. Children sensitized to alternaria, dermatophagoides farinae, mugwort, and cat dander had higher sIgE concentration levels, which were 68.07%, 49.45%, 56.57% and 47.83% respectively. Conclusions: This study can reflect the epidemic characteristics of allergen-sIgE in children with atopic dermatitis in Tianjin region to a certain extent. Allergen-sIgE positivity in patients differed by age, and there were seasonal differences and grade distribution differences in the positive rates of some allergens-sIgE. It is necessary to reasonably avoid the high-risk allergens according to the epidemiological characteristics and clinical symptoms, which provide valuable information for the prevention, diagnosis and treatment of atopic dermatitis.

[Analysis of distribution characteristics of specific immunoglobulin E in 8 092 children with eczema and urticaria in a hospital of pediatric in Tianjin City].

To investigate the common specific immunoglobulin E(sIgE) in children with eczema and urticaria, compare the allergies in children with different diseases, genders and ages, and provide the scientific basis for the prevention, diagnosis and treatment. A retrospective study was conducted to analyze the children who were suspected of eczema and urticaria and tested for serum sIgE in the Tianjin Children's Hospital from December 2019 to August 2021. A total of 8 092 serum samples were tested for ten food allergens and ten inhaled allergens. The method was the enzyme-linked immune capture assay. The allergen epidemiological characteristics were statistically analyzed by Chi square test based on the children's characteristics and factors such as different sexes and ages and by the mass data. The results showed that the positive rate of eczema was 64.42%(5 213/8 092), and the urticaria was 35.58%(2 879/8 092). The positive rate of specific IgE was 66.65%(5 393/8 092), the food allergens was 61.74%(4 996/8 092), and the inhaled allergens was 34.85%(2 820/8 092). The top three positive rates of food allergens were egg 46.65%(3 775/8 092), milk 32.64%(2 641/8 092) and wheat flour 15.08%(1 220/8 092). The top three positive rates of inhaled allergens were house dust 21.40%(1 732/8 092), Alternaria 11.78%(953/8 092) and Dermatophagoides farinae 7.33%(593/8 092). The positivity of food allergens and inhaled allergens was significantly different in different age groups. The positive rates of food allergens in different age groups were 48.92%(947/1 936) in<1 year old, 72.28%(2 680/3 708) in 1-3 years old, 64.58%(919/1 423) in 4-6 years old and 43.90%(450/1 025) in>6 years old. The positive rates of inhaled allergens in different age groups were 17.67%(342/1 936) in<1 year old, 36.35%(1 348/3 708) in 1-3 years old, 46.38%(660/1 423) in 4-6 years old and 45.85%(470/1 025) in>6 years old. The top six positive rates of allergens of eczema were the same with urticaria, which were egg, milk, house dust, wheat flour, Alternaria and Dermatophagoides farinae. The allergens (greater than or equal to grade 4) differed in children with eczema and urticaria. Moreover, there were significant differences in the positive rates of Alternaria, egg, wheat flour, crab and shrimp. In conclusion, this study can reflect the epidemic characteristics of allergens in children with eczema and urticaria to a certain extent. There were significant differences in the positive rates of allergens between different age groups. It is necessary to reasonably avoid the high-risk allergens according to the epidemiological characteristics and clinical symptoms, which provide valuable information for the prevention, diagnosis and treatment of allergic diseases.

[Repeated stellate ganglion blockade for the treatment of ventricular tachycardia storm in patients with nonischemic cardiomyopathy: a new therapeutic option for patients with malignant arrhythmias].

Objectives: This study sought to describe our institutional experience of repeated percutaneous stellate ganglion blockade (R-SGB) as a treatment option for drug-refractory electrical storm in patients with nonischemic cardiomyopathy (NICM). Methods: This prospective observational study included 8 consecutive NICM patients who had drug-refractory electrical storm and underwent R-SGB between June 1, 2021 and January 31, 2022. Lidocaine (5 ml, 1%) was injected in the vicinity of the left stellate ganglion under the guidance of ultrasound, once per day for 7 days. Data including clinical characteristics, immediate and long-term outcomes, and procedure related complications were collected. Results: The mean age was (51.5±13.6) years. All patients were male. 5 patients were diagnosed as dilated cardiomyopathy, 2 patients as arrhythmogenic right ventricular cardiomyopathy and 1 patient as hypertrophic cardiomyopathy. The left ventricular ejection fraction was 37.8%±6.6%. After the treatment of R-SGB, 6 (75%) patients were free of electrical storm. 24 hours Holter monitoring showed significant reduction in ventricular tachycardia (VT) episodes from 43.0 (13.3, 276.3) to 1.0 (0.3, 34.0) on the first day following R-SGB (P<0.05) and 0.5 (0.0, 19.3) after whole R-SGB process (P<0.05). There were no procedure-related major complications. The mean follow-up was (4.8±1.1) months, and the median time of recurrent VT was 2 months. Conclusion: Minimally invasive R-SGB is a safe and effective method to treat electrical storm in patients with NICM.

[Factors affecting long-term survival of advanced high-grade serous ovarian cancer].

Objective: To identify the factors associated with long-term survival and guide the decision for primary surgery in patients with advanced high-grade serous ovarian cancer(HGSOC). Methods: In this case-control study, clinical parameters, including surgical and non-surgical associated factors, were collected and compared between the patients with short-term (<2 years) and long-term (>5 years) survival who all underwent primary debulking surgery (PDS) followed by carboplatin and paclitaxel chemotherapy from January 2004 to December 2016. Univariate analysis was examined by chi-square test and multivariate analysis was performed by logistic regression analysis. Results: There were 95 cases long-term survival (LTS group) and 77 cases short-term survival (STS group) in 698 newly diagnosed HGSOC patients with International Federation of Gynecology and Obstetrics (FIGO) stage Ⅲc and Ⅳ who met include and exclude criteria. (1) Univariate analysis showed that the proportion of complete cytoreduction with no visible residual disease (R0) at PDS and platinum sensitivity in LTS group were significantly higher than those in STS group (P<0.01). The surgical complexity score (SCS), the preoperative serum CA125 level and the ascites volume in the LTS group were significantly lower than those of the STS group (all P<0.05). In the LTS group, the preoperative incidence of lesions in retrograde peritoneum of the bladder, serosal and mesangial membrane of the small intestine, upper abdominal peritoneum and liver parenchyma were significantly lower than those in the STS group (all P<0.05). Multivariate logistic regression analysis showed that platinum sensitivity (OR=0.016, 95%CI: 0.004-0.063, P<0.01), ascites volume >500 ml (OR=3.193, 95%CI: 1.285-7.930, P=0.012), and SCS ≥8 (OR=17.433, 95%CI: 2.281-133.25, P=0.003) were independent factors affecting long-term survival (P>0.05). (2) Totally 37 of 95 in long-term survival and 16 of 77 in short-term survival achieved R0 cytoreduction at PDS. Univariate analysis showed that preoperative serum CA125 level, preoperative lesion score, preoperative lesion (DS) score, ascites volume, platinum sensitivity,and SCS were significantly correlated with the R0 PDS (all P<0.05). Multivariate analysis showed that ascites volume >500 ml (OR=5.199, 95%CI: 2.015-13.409, P=0.001), DS >2 (OR=15.264, 95%CI: 5.843-39.874, P<0.01) and SCS ≥4 (OR=4.176, 95%CI: 1.618-10.777, P=0.003) were independent factors associated with R0 cytoreduction. In patients with DS ≤2 or SCS <4, but not those with DS >2 or SCS ≥4, R0 cytoreduction was significantly associated with long-term survival. Conclusion: The intrinsic biology of tumor is the factor influencing long-term survival of advanced HGSOC patients, and those who present with wide intraperitoneal metastases and need to remove multiple organs may not benefit from R0 cytoreduction.

[Comparison between hybrid surgery and transabdominal preperitoneal surgery in treatment of irreducible inguinal hernia: A case-control study].

Objective: To compare the effects between hybrid surgery and transabdominal preperitoneal surgery in treatment of irreducible inguinal hernia. Methods: A total of 60 patients who underwent laparoscopic inguinal hernia repair between June 2011 and December 2017 were included in the study. Patients were divided into two group: hybrid surgery group (observation group, n=30) and transabdominal preperitoneal group (control group, n=30). The operation time, intraoperative bleeding, hospital stay, hospital cost and complications were analyzed. Results: The operative time of observation group and control group was 45 (35-65) minutes and 50(35-70) minutes, respectively. Intraoperative blood loss of two groups was 10(5-15) ml and 5(2-10) ml. The length of postoperative hospital stay was 2(1-4) days and 2(1-3) days in the two groups, respectively. And the hospitalization cost of two groups was 9 646 (9 066-11 560) yuan and 9 494(8 989-10 660) yuan, respectively. The intraoperative complications occurred in 4 cases in control group, including 1 case of vas deferens injury, 2 cases of spermatic vessel injury and 1 case of inferior epigastric artery injury. No intraoperative complications occurred in observation group. Perioperative complications in observation group and control group included dysuria (6.7% vs 10.0%), scrotum hematoma (3.4% vs 0%), wound pain (46.7% vs 6.7%) and fever (16.7% vs 20.0%). Twelve months of follow-up was completed in all the patients, and no recurrence or infections occurred in the two groups. The incidence of seroma in observation group and control group was 26.7%, 33.3%, respectively. One case of foreign body sensation and one case of chronic pain occurred in control group. The incidence of perioperative wound pain in patients undergoing hybrid surgery was higher than those undergoing transabdominal preperitoneal surgery (P<0.05), but no statistical differences were observed for other variables between the two groups (all P>0.05). Conclusion: Hybrid surgery is safe and feasible for the treatment of irreducible inguinal hernia. Though with a higher incidence of postoperative acute pain, it may have advantages of avoiding injuries of the vas deferens and spermatic vessels.

[DeSUMOylation of protein kinase B1 inhibits cell proliferation and metastasis of hepatocellular carcinoma].

Objective: To investigate the effect of AKT1 deSUMOylation induced by Ubc9 silencing on the proliferation and metastasis of hepatocellular carcinoma (HCC) cells. Methods: The Ubc9 gene was silenced using RNA interference, and the expression levels of Ubc9, SUMO1 and AKT1 protein were detected by Western blot. Cell proliferation and cell cycle was analyzed by MTT and flow cytometry. Wound healing and transwell assays were used to detect the cell migration ability. Furthermore, the xenograft model was established, and tumor growth curves were drawn. The in situ apoptotic rates was measured using TUNEL Apoptosis Assay. The expression of proliferating cell nuclear antigen (PCNA), matrix metalloproteinase (MMP)-2 and MMP-9 were evaluated by immunohistochemical staining. Results: Knockdown of Ubc9 gene significantly decreased the protein expression levels of Ubc9, conjugated SUMO1, free SUMO1 and AKT1 in HCC cells (P<0.05 for all). In control, siR-neg and siR-Ubc9 groups, the cell proliferation indexes were 53.19%, 54.25% and 39.17%, respectively. Moreover, cell migration distance and migrating cells per low power field for all these three groups were (59.47±4.66) µm and 89.44±8.36, (56.56±5.37) µm and 93.84±8.79, as well as (34.57±6.61) µm and 41.67±5.39, respectively. In the xenograft model, the weights of subcutaneous tumors for these three groups were (3.78±0.69) g, (3.72±0.72) g and (2.09±0.61) g, respectively. The corresponding apoptotic cell rates were (7.79±2.21)%, (6.45±2.48)% and (33.59±5.44)%, respectively. The expression levels of PCNA, MMP-2 and MMP-9 protein were significantly decreased in siR-Ubc9 group (P<0.05). Conclusions: Ubc9 silencing in HCC cells induces AKT1 deSUMOylation, and then inhibits the proliferation and metastasis. These results provide a new therapeutic strategy for liver cancer in the future.

[Discussion of laparoscopic transabdominal preperitoneal repair for recurrent inguinal hernia].

OBJECTIVE: To explore the surgical techniques and the clinical efficacy of laparoscopic transabdominal preperitoneal repair (TAPP) for recurrent inguinal hernia. METHODS: Clinical data of 367 patients with recurrent inguinal hernia who underwent TAPP repair from Mar. 2009 to Mar. 2015 in Beijing Chao-Yang Hospital of Capital Medical University were analyzed retrospectively. RESULTS: Laparoscopic operations were completed successfully in 365 cases, however, 2 cases were converted to open surgery.The operation time was (55.7±19.3) min (30-100 min) and the hospital stay was (4.9±2.7) d (2-12 d). The incidences of postoperative pain, hydrocele, and urinary retention were 4.1%(15/367), 13.1%(48/367), and 1.3%(5/367) respectively.Other complications such as foreign body sensation, wound infection, and intestinal obstruction.All cases were followed up from 3 to 72 months ((36.5±14.7) months), 2 recurrent cases was observed and no mesh infection and long-term chronic pain were observed. CONCLUSIONS: Laparoscopic TAPP repair has advantages of minimal invasion and few complications, which is safe and effective for recurrent inguinal hernia.

Copper(II) bromide-catalyzed intramolecular decarboxylative functionalization to form a C(sp(3))-O bond for the synthesis of furo[3,2-c]coumarins.

An efficient and eco-friendly copper(II) bromide-catalyzed intramolecular decarboxylative functionalization to form a C(sp(3))-O bond for the synthesis of furo[3,2-c]coumarins has been developed. In this reaction, a copper(II) bromide-catalyzed intramolecular decarboxylative functionalization of α-carbonyl is successfully realized to generate an α-bromo carbonyl compound as a key intermediate.

Asian Foxtail (Uraria crinita), a New Host for Sclerotium rolfsii from Taiwan.

Asian foxtail (Uraria crinita (L.) Desv. ex DC.) is an herb cultivated for the use of roots and stems in Taiwanese cuisine. In September 2013, symptoms of leaf blight and basal rot were observed on U. crinita in a commercial field in Longjing District, Taichung, Taiwan, at an incidence of approximately 20%. White mycelia and brown sclerotia formed on the surfaces of the basal stems. The infected plant gradually wilted and eventually died. Diseased lower stem tissues were surface sterilized in 0.6% NaOCl, rinsed with sterile distilled water, and transferred to potato dextrose agar plates. The cultures were incubated at 25°C in the dark. The radial mycelial growth was 9.0 mm/day during the first 4 days, and the diameter of mature sclerotia was 1.76 mm following 3 weeks of incubation. The internal transcribed spacer (ITS) sequence of the isolate was amplified by PCR using the primers ITS5 and ITS4 (2). The amplicon was cloned, sequenced, and deposited in GenBank (Accession No. KJ677121). The sequence similarity was 99% compared with that of Sclerotium rolfsii Sacc. from Spain (GU080230) (1). Based on the characteristics, the fungus was identified as S. rolfsii. The fungal isolate (BCRC FU30230) was deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on six 2-month-old potted U. crinita plants in a greenhouse. Prior to infesting the plant, fungal inoculum of S. rolfsii BCRC FU30230 was prepared by inoculating the isolate on autoclaved rice (rice/water/dextrose = 50:50:1) in a flask. After 20 days incubation at room temperature, rice colonized by S. rolfsii was placed near the base of the plants (approximately 30 g/plant) in the greenhouse. Sterile rice applied to an equal number of plants served as negative controls. All inoculated plants developed blight symptoms with mycelia and sclerotia produced near the bases of each seedling 1 week after inoculation at an average temperature of 26°C. The control plants remained healthy. The pathogen re-isolated from the inoculated plants was morphologically identical to the original isolate. The pathogenicity test was repeated by inoculated healthy plants with reduced inoculum (five granules/plant). A delay of symptom development was observed and similar results were obtained. To our knowledge, this is the first report of Sclerotium rot on U. crinita in Taiwan, and the first report on U. crinita as a host for S. rolfsii. References: (1) E. Remesal et al. Plant Dis. 94:280, 2010. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

PCR screening reveals considerable unexploited biosynthetic potential of ansamycins and a mysterious family of AHBA-containing natural products in actinomycetes.

AIMS: Ansamycins are a family of macrolactams that are synthesized by type I polyketide synthase (PKS) using 3-amino-5-hydroxybenzoic acid (AHBA) as the starter unit. Most members of the family have strong antimicrobial, antifungal, anticancer and/or antiviral activities. We aimed to discover new ansamycins and/or other AHBA-containing natural products from actinobacteria. METHODS AND RESULTS: Through PCR screening of AHBA synthase gene, we identified 26 AHBA synthase gene-positive strains from 206 plant-associated actinomycetes (five positives) and 688 marine-derived actinomycetes (21 positives), representing a positive ratio of 2·4-3·1%. Twenty-five ansamycins, including eight new compounds, were isolated from six AHBA synthase gene-positive strains through TLC-guided fractionations followed by repeated column chromatography. To gain information about those potential ansamycin gene clusters whose products were unknown, seven strains with phylogenetically divergent AHBA synthase genes were subjected to fosmid library construction. Of the seven gene clusters we obtained, three show characteristics for typical ansamycin gene clusters, and other four, from Micromonospora spp., appear to lack the amide synthase gene, which is unusual for ansamycin biosynthesis. The gene composition of these four gene clusters suggests that they are involved in the biosynthesis of a new family of hybrid PK-NRP compounds containing AHBA substructure. CONCLUSIONS: PCR screening of AHBA synthase is an efficient approach to discover novel ansamycins and other AHBA-containing natural products. SIGNIFICANCE AND IMPACT OF THE STUDY: This work demonstrates that the AHBA-based screening method is a useful approach for discovering novel ansamycins and other AHBA-containing natural products from new microbial resources.

First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in Taiwan.

In February 2013, single and double flowered impatiens (Impatiens walleriana Hook. f.) affected by downy mildew were observed in nurseries (cv. Accent) and in the wild in central Taiwan. More than 90% of the plants were infected in areas where the disease broke out. Symptomatic leaves showed yellowing, with white, fungal-like structure covering the lower leaf surfaces, causing the plants to become wilted and defoliated. Under microscopic observation, hyaline, thin-walled sporangiophores branched monopodially and had slightly swollen bases. Three apical branchlets were at right angles to the main axis, measuring 4.3-15.0 µm (average 8.5 µm). Sporangia were hyaline, ovoid, with an average length and width of 14.2 (10.0 to 18.0) × 12.1 (9.3 to 15.0) µm. For molecular categorization, PCR amplification of the 5' end of the large ribosomal subunit gene was performed with primers NL1 and NL4 (2). The amplicons were cloned, sequenced, and deposited in GenBank (Accession Nos. KC905620 and KC905621). The sequence similarities were 99% compared with that of Plasmopara obducens (J. Schröt.) J. Schröt from Florida (JX217746) (3). Based on morphological and molecular characters, the pathogen was identified as P. obducens. Three voucher specimens (TNM Nos. F0026644, F0026645, and F0026646) were deposited in the herbarium of the National Museum of Natural Science, Taichung, Taiwan. Pathogenicity was confirmed by inoculation of five young, potted impatiens plants with a suspension containing 1 × 105 sporangia/ml in 0.05% Tween 20 (approximately 8 ml/plant). An additional five plants sprayed with 0.05% Tween 20 served as negative controls. The plants were maintained in an outdoor ambient environment. After 2 weeks incubation at an average temperature of 20°C and approximately 80% relative humidity, the inoculated plants exhibited typical downy mildew symptoms, while the control plants remained healthy. The pathogenicity test was repeated in a dew chamber under 20°C with similar results. In the Asia-Pacific region, impatiens downy mildew was recently confirmed in Korea and Japan (1,4). To our knowledge, this is the first report of downy mildew on impatiens in Taiwan. Our further surveys indicated the disease has spread to other parts of the island and will become a potential problem requiring prevention. References: (1) Y. J. Choi et. al. Plant Pathol. J. 25:433, 2009. (2) K. O'Donnell. Curr. Genet. 22:213, 1992. (3) A. J. Palmateer et. al. Plant Dis. 97:687, 2013. (4) M. Satou et. al. J. Gen. Plant Pathol. 79:205, 2013.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan.

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

[Exploration of functional reconstruction and rehabilitation strategies for patients with destructive electric burns].

Electric burn is a kind of three-dimensional destructive damage. It is necessary to attach great importance to the functional reconstruction and rehabilitation of patients with destructive electric burns. Wound repair and limb salvage are not the end of the treatment of destructive electric burns, but functional rehabilitation and reintegration into society of patients are the goals of treatment. This paper systematically discusses the early wound repair, late functional reconstruction and rehabilitation, limb salvage and amputation, minimized damage of donor area, psychological rehabilitation, and multi-disciplinary cooperation of destructive electric burns. Only by attaching great importance to the functional reconstruction and rehabilitation, and embedding these concepts in people's brains, perfect repair and rehabilitation of destructive electric burns can be realized.

[Clinical effect of the giant deep inferior epigastric artery paraumbilical perforator flap in repairing the circular high-voltage electric burn wounds on the wrist].

Objective: To investigate the clinical effect of the giant deep inferior epigastric artery paraumbilical perforator flap in repairing the circular high-voltage electric burn wounds on the wrist. Methods: A retrospective observational study method was used. From September 2016 to October 2021, thirteen male patients (aged 20-43 years) with annular high voltage (10-100 kV) electrical burns on the wrist were admitted to the Beijing Jishuitan Hospital. At the early stage after injury, the patient's wrist was subjected to incision, tension reduction and debridement, with the wound area after debridement being 27 cm×16 cm-32 cm×19 cm; in 12 patients with vascular injury, the radial or ulnar artery was reconstructed by great saphenous vein transplantation, with the length of 15-25 cm; the wrist wound was repaired by free transplantation of the deep inferior epigastric artery paraumbilical perforator flap (if the wound was giant, the lower abdominal flap carrying other perforators was used), with the area of 30 cm×19 cm-35 cm×20 cm. The donor site was repaired by direct suture+skin grafting or relay flap transplantation. After surgery, the survival of flap in recipient area, as well as survival of the skin or flap in donor site were observed. During follow-up, the appearances of the flap in recipient area and the recovery of hand function, as well as the healing of donor site, occurrence of abdominal wall hernia, and scar in skin graft area were observed. Results: After surgery, all the 13 patients' paraumbilical perforator flaps survived. Among them, 3 patients had subcutaneous fat necrosis at the distal end of the wrist flap, and the wound had mild infection, which healed after re-expansion and dressing change. All the skin grafts in the donor site of 10 patients survived, and the flaps in the donor site of 3 patients survived well. The patients were followed up for 6 months to 3 years. The flaps in recipient area were in good shape, 8 cases had partial recovery of hand function, and 5 cases had loss of finger flexion function; the donor site of abdominal flap healed well with no abdominal hernia occurred, and the skin graft site had no obvious scar hyperplasia and was soft in texture. Conclusions: Early vascular reconstruction after injury, together with free transplantation of the giant deep inferior epigastric artery paraumbilical perforator flap are effective in repairing circular high-voltage electrical burn wounds on the wrist.

First Report of Stem and Leaf Blight Caused by Sclerotinia sclerotiorum on Eustoma in Taiwan.

Eustoma (Eustoma russellianum) is an economically important cut flower in Taiwan. Each year more than 1.7 million dozen flowers, mainly exported to Japan in the winter, are produced in greenhouses. In January 2011, eustoma plants with stem and leaf blight symptoms were observed in some greenhouses in Changhua County, Taiwan, at an incidence of 2%. Brown and rotten lesions were presented on the stem and nearby leaves, with white mycelia growing on the surface and black sclerotia (up to 7 mm long) produced inside the stem. Infected plants were completely blighted and eventually died. Diseased stem tissues collected from the field were surface sterilized for 3 min in 0.6% NaOCl, rinsed with sterilized distilled water, and plated on potato dextrose agar. White fungal colonies were consistently isolated. The cultures produced large sclerotia at the peripheries of the plates. Internal transcribed spacer (ITS) sequences of two voucher isolates were determined and deposited in GenBank (Accession Nos. JQ653934 and JQ653935). The sequences were 100% identical to that of Sclerotinia sclerotiorum strain ATCC MYA-4521 (Accession No. FJ810516). In addition, PCR amplified DNA fragments (approximately 630 bp) were obtained by the S. sclerotiorum specific primer pair MP_SsF and MP_UniR (1). On the basis of morphology, ITS sequence homology, and the specific PCR detection, the fungus was identified as S. sclerotiorum. The two fungal isolates (BCRC34830 and BCRC34831) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on 1-month-old, second flush eustoma cultivars Ex Rosa Pink Flash and Rosina Blue Ver. 2 after primary flowers had been harvested in the greenhouse. Fungal inoculum consisting of Tref horticultural substrate and wet sterilized rice colonized by S. sclerotiorum BCRC34830 (substrate-rice-water ratio of 2:1:1) was placed near the base of the plants. Ten plants of each cultivar were inoculated with about 800 g of the mixture. Sterile mixture applied to an equal number of plants served as negative controls. Eight plants of each cultivar showed blight symptoms after 1 month of incubation at an average temperature of 26°C. All control plants remained healthy. The pathogen reisolated from the inoculated stems produced sclerotia identical to those isolated in the field, fulfilling Koch's postulates. The pathogenicity test was repeated with similar results. S. sclerotiorum has been reported on eustoma in Argentina (2). To our knowledge, this is the first report of Sclerotinia blight on eustoma in Taiwan. Although the disease was not prevalent on eustoma, the inoculum could be dormant in the greenhouse soil. Awareness of the potential perennial problem could increase the quality of the flowers exported and benefit the flower industry. References: (1) S. Hirschhäuser and J. Fröhlich. Int. J. Food Microbiol. 118:151, 2007. (2) S. Wolcan et al. Plant Dis. 80:223, 1996.

Epidemiology and mortality of systemic sclerosis: a nationwide population study in Taiwan.

OBJECTIVES: There have been few nationwide population studies of systemic sclerosis (SSc). We describe the epidemiological features of SSc in Taiwan. METHODS: The catastrophic illness registry of the Taiwan National Health Insurance Research Dataset (NHIRD) and the National Death Registry of Taiwan were used to calculate estimates of the incidence, prevalence, and mortality of SSc. RESULTS: A total of 1479 persons (325 males, 1154 females) with incident SSc were enrolled in the study. The annual incidence of SSc in Taiwan was found to be 10.9 cases (4.7 males, 17.4 females) per million population. During 2002-2007, the mean prevalence was 56.3 cases per million population. There were 204 deaths (70 males, 134 females) during the study period; 1-, 2-, and 5-year survival rates were 94.9, 92.0, and 83.2%, respectively. SSc patients had a standardized mortality ratio (SMR) of 3.24 [95% confidence interval (CI) 2.82-3.71] for all-cause mortality, as compared with the national population in 2002. There was excess mortality from neoplasms (SMR 1.50, 95% CI 1.03-2.11), cardiovascular diseases (2.23, 1.52-3.16), kidney disease (4.67, 2.66-7.64), gastrointestinal diseases (2.50, 1.27-4.46), and pulmonary diseases (3.20, 1.89-5.09). In addition to male sex and older age, cancer and end-stage renal disease (ESRD) diagnosis were risk factors for death, with hazard ratios (HRs) of 2.71 (95% CI 1.27-5.76) and 2.59 (1.14-5.90), respectively. CONCLUSION: SSc patients had a threefold greater risk of all-cause mortality than the general population of Taiwan. Male sex, older age, diagnosis of cancer, and ESRD were risk factors for death.

First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan.

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) µm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

[Strategies on the prevention and treatment of surgical site infection and the resulting wound].

With the increase in various trauma patients and the number of surgeries and the worsening of population aging, more and more surgical site infection (SSI) and the resulting wounds were seen, bringing great pressure and burden to medical staff and patients. This article focuses on the risk factors, prevention, and treatment strategies related to SSI and the resulting wounds, especially their common treatments, hoping to raise the significant attention of everyone.