ETS1 regulates NDRG1 to promote the proliferation, migration, and invasion of OSCC.

OBJECTIVE: The aim of this study was to investigate the molecular mechanism by which the transcription factor ETS1 regulates N-myc downstream regulatory gene 1 (NDRG1) to provide a new theoretical basis for the study of oral squamous cell carcinoma (OSCC). METHODS: In this study, eight human OSCC and paraneoplastic samples were collected. The expressions of NDRG1, ETS1, and Ki67 were detected by immunohistochemistry; apoptosis was detected by tdt-mediated dUTP notched end labeling; cell migration and invasion were detected by Transwell; quantitative real-time PCR was performed to detect the expression of NDRG1; RNA-binding protein immunoprecipitation (RIP) assays detected NDRG1 expression; immunofluorescence assays detected ETS1 expression. RESULTS: NDRG1 and ETS1 expression was significantly upregulated in cancer tissues and CAL-27 and SCC-6 cells. Knockdown of NDRG1 and ETS1 inhibited cell proliferation, migration, invasion, cloning, and EMT while promoting apoptosis and inhibited tumor development; ETS1 positively regulated NDRG1 expression; Finally, overexpression of NDRG1 in vivo and in vitro reversed the effect of ETS1 knockdown on CAL-27 and SCC-6 cells. CONCLUSIONS: ETS1 positively regulates the expression of NDRG1 and promotes OSCC. Therefore, ETS1 may serve as a new target for the clinical diagnosis and treatment of OSCC.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Screening of CXC chemokines in the microenvironment of ovarian cancer and the biological function of CXCL10.

BACKGROUND: This study aims to screen and identify the biological functions and prognostic value of CXC chemokines in ovarian cancer (OC) through bioinformatics and molecular biology methods, and to provide data support for the selection of biomarkers and prognostic analysis of OC. METHODS: In this study, GEO, ONCOMINE, GEPIA, cBioPortal, GeneMANIA, Metascape, STRING, TRRUST, and TIMER databases were used to study CXC chemokines. Angiogenesis and T cell killing assay were used to detect the effect of CXCL10 on tumor cell immunity and angiogenesis. Real-time quantitative PCR (qRT-PCR), immunoblotting, and ectopic tumor formation experiments were used to verify the effect of CXCL10 on ovarian cancer tumors. RESULTS: We found that CXCL1, CXCL10, CXCL11, CXCL13, and CXCL14 were significantly upregulated in OC samples compared with normal tissues. Our data showed that there was a relationship between the expression of CXC chemokines and the infiltration of six types of immune cells significant correlation. In vitro assay confirmed that overexpression of CXCL10 could enhance the killing effect of T cells and inhibit angiogenesis. Further in vivo assay had shown that CXCL10 could affect the progression of ovarian cancer by increasing the expression of cytotoxic T cells and inhibiting angiogenesis. CONCLUSION: In conclusion, we hope that our data will provide new insights into the development of immunotherapy and the selection of prognostic markers for patients with OC.

Paeoniflorin treatment regulates TLR4/NF-κB signaling, reduces cerebral oxidative stress and improves white matter integrity in neonatal hypoxic brain injury.

Neonatal hypoxia/ischemia (H/I), injures white matter, results in neuronal loss, disturbs myelin formation, and neural network development. Neuroinflammation and oxidative stress have been reported in neonatal hypoxic brain injuries. We investigated whether Paeoniflorin treatment reduced H/I-induced inflammation and oxidative stress and improved white matter integrity in a neonatal rodent model. Seven-day old Sprague-Dawley pups were exposed to H/I. Paeoniflorin (6.25, 12.5, or 25 mg/kg body weight) was administered every day via oral gavage from postpartum day 3 (P3) to P14, and an hour before induction of H/I. Pups were sacrificed 24 h (P8) and 72 h (P10) following H/I. Paeoniflorin reduced the apoptosis of neurons and attenuated cerebral infarct volume. Elevated expression of cleaved caspase-3 and Bad were regulated. Paeoniflorin decreased oxidative stress by lowering levels of malondialdehyde and reactive oxygen species generation and while, and it enhanced glutathione content. Microglial activation and the TLR4/NF-κB signaling were significantly down-regulated. The degree of inflammatory mediators (interleukin 1ß and tumor necrosis factor-α) were reduced. Paeoniflorin markedly prevented white matter injury via improving expression of myelin binding protein and increasing O1-positive olidgodendrocyte and O4-positive oligodendrocyte counts. The present investigation demonstrates the potent protective efficiency of paeoniflorin supplementation against H/I-induced brain injury by effectually preventing neuronal loss, microglial activation, and white matter injury via reducing oxidative stress and inflammatory pathways.

Naringenin loaded multifunctional nanoparticles to enhance the chemotherapeutic efficacy in hepatic fibrosis.

Naringenin is highly potent dietary phenolic compound (Flavonoids) found as a major bioactive in citrus fruits. The low solubility of Naringenin, decreases its availability at the site of action by hindering solubility and transportation across the biological membrane. Naringenin loaded nanoparticles enhance the solubility and drug availability at site of action. Naringenin solid lipid nanoparticles were prepared by emulsification and homogenization method using GMO (glycerylmonooleate) and TPGS (Tocopheryl polyethylene glycol succinate) as co-stabilizer. Physico-chemical characterization confirmed the particles were of nanometer size, smooth and spherical morphology. The FTIR and DSC studies conforms that drug and polymers are compatible. The in-vitro study shows prolong and sustained release of Naringenin upto 90 Hrs. In-vivo studies conforms the prolonged and efficient treatment of Hepatic fibrosis. The liver enzymes and pro inflammatory cytokines in blood got significantly reversed with the rats exposed to Naringenin nanoparticle indicating reduced liver damage and fibrosis. Nanoformulation enhances the bioavailability of Naringenin and liver specific delivery of the same, which up-regulates MMP-2 hepatic proteins resulting in reduced liver fibrosis.

Adsorption and reactions of propenoic acid and 2-fluoropropanoic acid on Cu(100) and O/Cu(100).

X-ray photoelectron spectroscopy, reflection-absorption infrared spectroscopy, and temperature-programmed reaction/desorption have been employed to investigate the adsorption and reaction pathways of CH2=CHCOOH and CH3CHFCOOH on Cu(100) and oxygen-precovered Cu(100) [O/Cu(100)]. In the case of CH2=CHCOOH on O/Cu(100), CH2=CHCOO is the surface intermediate detected between 110 K and 400 K. CH2=CHCOO is adsorbed vertically and can change adsorption sites at a higher temperature. The propenoate (acrylate) decomposes at higher temperatures (>500 K), with formation of >C=C=O (ketenylidene) surface species and gaseous products. On Cu(100), CH2=CHCOOH is adsorbed in dimer form and can dissociate to generate CH2=CHCOO and CH3CHCOO intermediates on the surface. The CH3CHCOO continuously recombines with the H from deprotonation of CH2=CHCOOH, resulting in the formation CH3CH2COO. The co-existing CH2=CHCOO and CH3CH2COO further decompose at ∼550 K to evolve reaction products, but without >C=C=O being detected. On O/Cu(100), CH3CHFCOOH readily deprotonates to form CH3CHFCOO at 120 K. This intermediate reacts on the surface at ∼460 K to evolve gaseous products, also producing CH2=CHCOO. In the case of Cu(100), deprotonation of CH3CHFCOOH occurs at ∼250 K, forming CH3CHFCOO. Without oxygen on the surface, this intermediate decomposes into HF and CH2=CHCOO at ∼455 K.

Expression and characterization of a fibrinogenolytic enzyme from horsefly salivary gland.

Enzymes from various natural resources are valuable in management of thrombosis. Blood-sucking arthropods are one of these resources because they have a wide array of anti-hemostasis molecules in their salivary gland. However, it is difficult to purify enough protein samples from the salivary glands for pharmacological studies. In this work, a fibrinogenolytic enzyme (tablysin 2) identified from salivary glands of the horsefly Tabanus yao was expressed in Escherichia coli to further study its biological activities. The primary structure of tablysin 2 showed significant domain similarity to arthropod proteins from the antigen 5 family containing SCP domain, whose biological functions are poorly understood. Tablysin 2 cleaved the Aα and part of Bß chains of fibrinogen and did not affect γ chain and fibrin. It inhibited platelet aggregation induced by ADP. It did not directly induce hemorrhage or activate plasminogen. The fibrinogenolytic activity of tablysin 2 provides a clue for the functions of antigen 5-related proteins in other haematophagous arthropods. This work demonstrate a method of expression of arthropod salivary proteins which are difficult to obtain from natural resources for further functional studies.

Prevalence, awareness, medication, control, and risk factors associated with hypertension in Yi ethnic group aged 50 years and over in rural China: the Yunnan minority eye study.

BACKGROUND: Hypertension is an important public health issue in China, but there are few studies examining hypertension in ethnic groups in Yunnan, China. This study, Yunnan Minority Eye Study (YMES), was initially designed to determine the prevalence and impact of eye diseases, including hypertension and diabetes mellitus. As a part of YMES, the prevalence, awareness, treatment, and control of hypertension and the associated risk factors among the Yi ethnic population in rural China are reported. METHODS: A population-based survey was conducted in 2012 with adult participants over 50 from rural communities in Shilin Yi Autonomous County, Yunnan Province, located in southwest China. A random cluster sampling method was used to select a representative sample. The participants' blood pressure, height, weight, and waist circumference were measured. Hypertension was defined as mean systolic blood pressure ≥140 mmHg and/or diastolic blood pressure ≥90 mmHg, and/or current use of antihypertensive medications. RESULTS: A total of 2208 adults were assessed. The prevalence of hypertension was 38.5%, and the age- and gender-adjusted prevalence was 37.0%. The proportion of patients who were aware of their hypertension among those diagnosed with hypertension was 24.8%. Of those aware of having hypertension, 23.6% took antihypertensive drugs. Among all hypertensive patients, only 7.2% had controlled their hypertension (<140/90 mmHg). Risk factors for hypertension were older age, smoking, alcohol consumption, family history of high blood pressure, overweight, and obesity. Protective factors included being slim and higher education. CONCLUSIONS: Hypertension was highly prevalent among this population of the Yi ethnic group in China. The ratio of awareness, treatment, and control of hypertension were considerately low. Hypertension education and screening programs in rural China are recommended to improve the health status of this population.

Expression of metallothionein and Nrf2 pathway genes in lung cancer and cancer-surrounding tissues.

BACKGROUND: Nuclear factor (erythroid-derived 2)-like (Nrf)2 and metallothionein have been implicated in carcinogenesis. This study investigated the expression of Nrf2 and of Nrf2-targeted genes (NQO1 and GCLC) and the genes for the metallothionein (MT) isoforms (MT-1A and MT-2A) in human lung cancer and cancer-surrounding tissues. METHODS: Surgically removed lung cancer samples (n = 80) and cancer-surrounding tissues (n = 38) were collected from Zunyi Medical College Hospital, China. Total RNA was extracted, purified, and used for real-time reverse transcription-PCR analysis of interested genes. RESULTS: Expression of the Nrf2-targed genes NQO1 and GCLC tended to be higher (30 to 60%) in lung cancers, but was not significantly different from that in peri-cancer tissues. By contrast, expression of the genes for M)-1A, MT-2A, and the metal transcription factor MTF-1 were three-fold to four-fold lower in lung cancers. CONCLUSION: In surgical samples of lung cancer, MT expression was generally downregulated, whereas Nrf2 expression tended to be upregulated. These changes could play an integral role in lung carcinogenesis.

De novel heterozygous copy number deletion on 7q31.31-7q31.32 involving TSPAN12 gene with familial exudative vitreoretinopathy in a Chinese family.

AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.

[Analysis of clinical phenotype and mode of inheritance in retinitis pigmentosa patients with consanguineous marriage].

OBJECTIVE: To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. METHODS: RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). RESULTS: A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. CONCLUSIONS: The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal recessive. The common marriage pattern of consanguinity is between first cousins. The age of onset is early and the ocular fundus changes of some patients are atypical, this should be paid attention clinically.

Identification of genetic variants in five chinese families with keratoconus: Pathogenicity analysis and characteristics of parental corneal topography.

Purpose: The study aims to identify genetic variants in five Chinese families with Keratoconus (KC) and describe the characteristics of parental corneal topography. Methods: Fifteen participants, including five probands and ten parents from five Chinese families with KC, were recruited for genetic and clinical analyses. Targeted next-generation sequencing using a custom-designed panel for KC was applied on the probands for variant identification. Sanger sequencing and cosegregation analysis of the suspected pathogenic variants were performed on the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Pentacam 3D anterior segment analysis system was applied for keratectasia detection and the Corvis ST for corneal biomechanics measurement. Fifteen parameters were recorded, including nine keratectasia indicators (BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, ARTH), six corneal biomechanical indicators (CBI, DA ratio, SP-A1, IR, bIOP, TBI). Results: A total of six novel variants, including five missense variants and one frameshift variant, were detected in the HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 genes in five probands, all of which showed co-segregation of genotype and clinical phenotype and were determined to be pathogenic. The genetic model was autosomal dominant (AD) in four families and autosomal recessive (AR) in 1 family. The analysis of keratectasia and corneal biomechanical indicators of the proband's parents (first-generation relatives) in AD families revealed that there were several abnormal indexes in BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, CBI, DA ratio, SP-A1, IR, bIOP and TBI test indexes, showing clinical characteristics of incipient KC. Conclusion: Our study shows that variants in HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 were associated with KC. Our study extends the gene spectrum associated with KC, provides novel insights into KC phenotypic assessments, and contributes to early diagnosis for these patients.

[Early, middle and long-term clinical outcomes of coronary artery bypass grafting for left main coronary stenosis].

OBJECTIVE: To evaluate the early, middle and long-term clinical outcomes of coronary artery bypass grafting (CABG) for a special subset of left main coronary stenosis (LMS). METHODS: A total of 626 LMS patients, recruited at our hospital between January 1998 and March 2008, were classified them into the statin therapy group (Group A, n = 322) or the non-statin therapy group (Group B, n = 304) according to whether or not taking statins pre-operatively. Then their clinical data were retrospectively analyzed. RESULTS: The inhospital mortality was 4.31% (n = 27). And the mortality was 1.90% (n = 6) for Group A and 6.91% for Group B (n = 21) (χ² test, χ² = 9.642, P = 0.002). Preoperative statin therapy could lower the all-cause mortality rate (1.90% vs 6.91%, P = 0.002), the prevalence of new atrial fibrillation or flutter (14.69% vs 19.61%, P = 0.016, χ ²= 5.780) and disabling stroke (2.50% vs 4.58%, P = 0.047, χ(2) = 3.94). Among 599 CABG survivors, 565 cases (94.3%) were actually followed up with a mean duration of 55.5 ± 26.1 months (range: 2 - 98). During the follow-up period, there were 29 (4.63%) cardiac events, including 12 deaths and 17 myocardial infarctions. There were 43 (7.18%) cases with relapsing angina pectoris. The univariate analysis showed that emergency procedure, abnormal C-reactive protein (CRP), abnormal troponin I(TnI), complicated LMS pathology, preoperative IABP (intra-aortic balloon pump) support, preoperative cardiac arrest, preoperative history of myocardium infarction and no preoperative statin therapy were the risk factors for perioperative death while complicated LMS pathology, preoperative IABP support, preoperative cardiac arrest, preoperative myocardium infarction and no preoperative statin therapy were the risk factor for late cardiac events. The multivariate binary logistic regression showed that emergency procedure, preoperative IABP support, no preoperative statin therapy and preoperative IABP support were independent predictors for peri-operative death. And preoperative IABP support, preoperative cardiac arrest, no preoperative statin therapy and complicated LMS pathology were independent predictors for late cardiac events. There was no statistical significance in inhospital mortality between on pump CABG and OPCAB (off pump coronary artery bypass). CONCLUSION: The CABG procedure for LMS carries a relative high mortality. However preoperative statin therapy may offer such protective effects as lowering the all-cause mortality rate and reducing the prevalence of new atrial fibrillation or flutter and disabling stroke.

[Novel RPGR gene mutation in a Chinese family with X-linked recessive retinitis pigmentosa].

OBJECTIVE: To screen the mutation in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa (RP) and to describe the phenotype in affected males and female carriers. METHODS: Ophthalmic examinations were performed in 77 family members of a RP pedigree to identify affected individuals. Polymerase chain reaction (PCR) and direct sequencing were used for screening of mutations in RPGR gene exon ORF15. RESULTS: Mutation screening demonstrated a novel mutation, g.ORF15 + 577_578delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. This mutation was detected in 8 affected male individuals and 14 obligate female carriers in this family and was found to segregate with the phenotype in this family. This mutation led to a severe RP phenotype in male affected individuals with some variability in the age of onset of night blindness and loss of visual acuity, but was recessive in female carriers without a RP phenotype. However the most striking phenotypic feature in female carriers in this pedigree was moderate to high myopia with refractive error ranging from -5.00 D to -22.00 D in 14 female carriers. CONCLUSIONS: This novel mutation in RPGR ORF15 causes serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing RP and phenotypic spectrum of the disease in Chinese family, which is useful for further genetic consultation and genetic diagnosis.

Identification of Four Novel Variants and Determination of Genotype-Phenotype Correlations for ABCA4 Variants Associated With Inherited Retinal Degenerations.

PURPOSE: The purpose of the study is to describe the genetic and clinical features of 17 patients with ABCA4-related inherited retinal degenerations (IRDs) and define the phenotype-genotype correlations. METHODS: In this multicenter retrospective study, 17 patients from 16 families were enrolled, and ABCA4 gene variants were detected using targeted next-generation sequencing using a custom designed panel for IRDs. Sanger sequencing and co-segregation analysis of the suspected pathogenic variants were performed with the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Protein structure modifications mediated by the variants were studied using bioinformatic analyses. RESULTS: The probands were diagnosed with Stargardt disease 1 (7), cone-rod dystrophy type 3 (8), cone dystrophy (1), and retinitis pigmentosa 19 (1). Onset of symptoms occurred between 5 and 27 years of age (median age = 12.4 years). A total of 30 unique ABCA4 suspicious pathogenic variations were observed, including 18 missense mutations, seven frameshift mutations, two nonsense mutations, one canonical splice site mutation, one small in-frame deletion, and one insertion. Four novel ABCA4 variants were identified. Two novel frameshift variants, c.1290dupC (p.W431fs), and c.2967dupT (G990fs), were determined to be pathogenic. A novel missense variant c.G5761T (p.V1921L) was likely pathogenic, and another novel missense c.C170G (p.P57R) variant was of undetermined significance. All ABCA4 variants tested in this study inordinately changed the physico-chemical parameters and structure of protein based on in silico analysis. CONCLUSION: ABCA4-related IRD is genetically and clinically highly heterogeneous. Four novel ABCA4 variants were identified. This study will expand the spectrum of disease-causing variants in ABCA4, which will further facilitate genetic counseling.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

The actuarial survival analysis of the surgical and non-surgical therapy regimen for chronic thromboembolic pulmonary hypertension.

AIM: To characterize the in-hospital mortality and the actuarial survival of surgical and non-surgical therapy regimen in the treatment of chronic thromboembolic pulmonary hypertension (CTEPH). METHODS: A retrospective cohort study was conducted in 504 patients with CTEPH, who were treated surgically (n = 360), or non-surgically (n = 144) in Anzhen Hospital from February 1989 to August 2007. The patients in surgical group received a standard pulmonary thromboendarterectomy (PTE), while those in non-surgical group were given thrombolytic therapy. The actuarial survival of the two groups was determined with the Kaplan-Meier survival curves. Univariate analysis and multivariate binary logistic regression and Cox proportional hazard analysis were used to identify the risk factors for the in-hospital and late deaths. RESULTS: The in-hospital mortality for the surgical group and non-surgical group were 4.44% and 3.50%, respectively. For the proximal type of CTEPH, the actuarial survival at 10 and 15 years of the surgical group and non-surgical group were 94.60 +/- 2.38%, 90.96 +/- 4.24% and 81.4 +/- 7.14%, 56.43 +/- 14.7%, respectively (chi(2) = 12.33, P = 0.0004). For the distal type of CTEPH, the actuarial survival at 10 and 15 years of the surgical group and non-surgical group were 71.78 +/- 4.66%, 29.57 +/- 15.1% and 69.84 +/- 7.78%, 32.59 +/- 13.7%, respectively (chi(2) = 0.03, P = 0.874). CONCLUSION: The PTE procedure has statistically superiority over thrombolytic therapy for the proximal type of CTEPH in terms of actuarial survival; however, for the distal type of CTEPH, the PTE procedure provides no benefits with regard to actuarial survival.

[Evaluation of toxicity of manganese ions to rabbit retina].

OBJECTIVE: To research the Mn(2+) toxicity in vivo rabbit retina. Mn(2+) is used as a tracer in MRI. METHODS: It was an experimental study. Sixty pigmented rabbits (120 eyes) were divided into 5 groups randomly. Manganese chloride solution 25 µl of 10, 15, 20, 30, 40 mmol/L were injected intravitreally in one eye of each rabbit respectively as 5 experimental groups (n = 12). The saline (0.9%) 25 µl was injected intravitreally in other eye of each rabbit as control group (60 eyes). After intravitreal injections, all eyes were examined by color fundus camera, fluorescein angiography, flash electroretinography, light microscopy, and transmission electron microscopy on the 0(th), 7(th), and 28(th) day. RESULTS: On the 7(th) day after intravitreal injection, the average of the F-ERG b-wave amplitude was reduced significantly from 337 µV to 189 µV in the group of 15 mmol/L (F = 20.43, P < 0.05), but the amplitude was returned to normal on the 28(th) day. On the 7(th) day after intravitreal injections, the F-ERG b-wave amplitude was reduced significantly in the group of ≥ 20 mmol/L, and the amplitude was not returned to normal on the 28(th) day. There were abnormal changes in the structure of the retina in ≥ 20 mmol/L group at difference time after intravitreal injections. CONCLUSION: MnCl(2) as a tracer in vivo optic nerve, the concentration of ≤ 15 mmol/L caused only reversible changes in retinal function; The concentration of ≥ 20 mmol/L appears, damages in retinal function and morphology appeared.

Myopia with X-linked retinitis pigmentosa results from a novel gross deletion of RPGR gene.

AIM: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.

High levels of MESP1 expression in non-small cell lung cancer can facilitate cell proliferation, metastasis and suppresses cell apoptosis.

BACKGROUND: There are growing number of researches have shown that mesoderm posterior basic helix-loop helix (BHLH) transcription factor 1 (MESP1) plays a crucial role in the development of tumors. However, its expression pattern and function in non-small cell lung cancer (NSCLC) are still unknown. METHODS: MESP1 expression and biological process were investigated in NSCLC based on bioinformatics analysis. The mRNA or protein expression levels of MESP1 were measured by quantitative real-time PCR (qRT-PCR) and western blot (WB) assay in NSCLC cells and clinical tissue samples. Then, we used small interfering RNA (siRNA) interference to knocking down expression of gene in NSCLC cells. Cell proliferation was performed using cell counting kit-8 (CCK-8), colony forming assay and real-time cell analyzer (RTCA); transwell chambers and RTCA were used to analysis cell migration and invasion. Besides, analyses of the cell cycle progression and apoptosis were measured via BD JAZZ flow cytometric analysis. All the experiments were repeated ≥3 times. And analyses were performed using SPSS software version 21.0 and GraphPad Prism 6.0. P<0.05 was considered statistically significant. RESULTS: Detection of MESP1 showed that mRNA was up-regulated in NSCLC cells and patients compared with the normal controls (P<0.05). And high expression of MESP1 were correlated with increasingly cell proliferation, metastasis, cycle and apoptosis. Besides, through WB experiments, it was found that knocking down MESP1 mainly activated the caspase-3/PARP1 signal pathway. Furthermore, it was also verified from clinical samples that MESP1 was highly expressed on both mRNA and protein aspect. CONCLUSIONS: Our study suggested that MESP1 is indeed highly expressed in NSCLC, and MESP1 high expression obviously promote cell proliferation, migration, invasion. What's more, it has good sensitivity to the occurrence and development of NSCLC patients. This can be used as a novel potential therapeutic target for NSCLC.