Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 19 de 19
Filtrar
1.
BMC Plant Biol ; 23(1): 215, 2023 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-37098482

RESUMO

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.


Assuntos
Melatonina , Tobamovirus , Reguladores de Crescimento de Plantas , Cisteína , Melatonina/farmacologia , Tobamovirus/genética , Nicotiana/genética , Doenças das Plantas/genética
2.
Plant Dis ; 2022 Apr 20.
Artigo em Inglês | MEDLINE | ID: mdl-35442054

RESUMO

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

4.
Arch Environ Contam Toxicol ; 69(1): 1-7, 2015 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-25600924

RESUMO

The toxic effects of the ubiquitous pollutant 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) on the earthworm Eisenia fetida were assessed by determining growth-inhibition and gene transcript levels of superoxide dismutase (SOD), catalase (CAT), glutathione transferase (GST), and transcriptional changes of the stress-response gene (heat-shock protein 70 [Hsp70]). Somatic growth and growth-inhibition rates in all BDE-47-treated groups were significantly different from those of the controls. The SOD gene transcripts were upregulated at all exposure doses and reached the maximum at the concentration of 400 mg/kg dry weight (dw) (3.84-fold, P < 0.01), which protected earthworms from oxidative stresses. However, downregulation of CAT and Hsp70 was present in all exposure doses and reached to the minimum at concentrations of 400 mg/kg dw (0.07-fold, P < 0.01 and 0.06-fold, P < 0.01, respectively). Upregulation of GST gene transcript level presented significant changes at concentrations of 10 (2.69-fold, P < 0.05) and 100 mg/kg dw (2.55-fold, P < 0.05). SOD maintained a dynamic balance to upregulate SOD expression to eliminate superoxide radicals in all dosage treatments, but downregulation of CAT decreased the ability to eliminate hydrogen peroxide. These changes could result in biochemical and physiological disturbances in earthworms.


Assuntos
Expressão Gênica/efeitos dos fármacos , Inibidores do Crescimento/toxicidade , Éteres Difenil Halogenados/toxicidade , Oligoquetos/crescimento & desenvolvimento , Poluentes do Solo/toxicidade , Animais , Catalase/metabolismo , Glutationa Transferase/metabolismo , Proteínas de Choque Térmico HSP70/metabolismo , Estresse Oxidativo , Superóxido Dismutase/metabolismo
5.
Mol Plant Pathol ; 24(3): 208-220, 2023 03.
Artigo em Inglês | MEDLINE | ID: mdl-36528386

RESUMO

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.


Assuntos
Tobamovirus , Proteínas do Capsídeo/genética , Nicotiana , Doenças das Plantas
6.
Huan Jing Ke Xue ; 43(8): 4074-4086, 2022 Aug 08.
Artigo em Chinês | MEDLINE | ID: mdl-35971705

RESUMO

Emerging pollutants are frequently detected in surface water, threatening the regional aquatic ecosystem and human health. Due to their complex types and large differences in risk and toxicity, research based on the comprehensive assessment of the pollution characteristics to determine the new priority pollutants remains incomplete. This study established a multi-criterion scoring method targeting 41 emerging pollutants with the goal of protecting aquatic organisms and human health, using five key indicators including environmental exposure level, persistence, bioaccumulation, ecological risk, and health risk of pollutants. The emerging pollutants were screened and identified in the surface water of Tianjin. The priority levels of different congeners were divided, and the ecological and health risks of pollutants in the priority control list were evaluated. The results showed that 41 emerging pollutants were generally detected in the study area. The average concentration of sulfonamide antibiotics (SAs) and other drugs (Others) were the largest, with 200.04 ng·L-1 and 176.30 ng·L-1, respectively, followed by perfluorinated compounds (PFASs, 57.98 ng·L-1). In terms of pollutant categories, high-priority emerging pollutants were dominated by PFASs, accounting for 50%. Medium-priority emerging pollutants were still dominated by PFASs (26.32%), but the proportion was lower. Low-priority emerging pollutants were dominated by SAs, accounting for 31.25%. Perfluorooctane sulfonic acid (PFOS), perfluorooctanoic acid (PFOA), carbamazepine (CBZ), caffeine (CAF), perfluorohexyl sulfonic acid (PFHxA), and clarithromycin (CLA) were defined as a priority control list. Compared with other pollutants, PFOS and PFOA had higher scores in persistence, bioaccumulation, and health risk, whereas CBZ and CAF had higher scores in ecological risk. The average risk quotient (RQ) of CAF was 4.8, which indicated a relatively high ecological risk. Health risk indicated that the potential risk caused by PFOA (average hazard quotient was 0.018) cannot be ignored. For the priority control list, because of the high removal rate of CAF in sewage treatment plants, the construction of a pipe network and riverside belt with high vegetation coverage should be strengthened to reduce the impact of untreated sewage discharge and rainfall runoff. Pollutants with low removal rates in sewage treatment plants should be treated with combined technologies to improve the removal efficiency. In addition, industry substitution work should be accelerated to reduce emissions of PFOS, PFOA, and PFHxA.


Assuntos
Ácidos Alcanossulfônicos , Poluentes Ambientais , Fluorocarbonos , Poluentes Químicos da Água , Ácidos Alcanossulfônicos/análise , Ecossistema , Monitoramento Ambiental , Fluorocarbonos/análise , Humanos , Esgotos , Água , Poluentes Químicos da Água/análise
7.
BMJ ; 378: e070894, 2022 09 15.
Artigo em Inglês | MEDLINE | ID: mdl-36109047
8.
Int J Oncol ; 48(6): 2567-79, 2016 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-27035745

RESUMO

Recent evidence indicates that exosomes can mediate certain microRNAs (miRNAs) involved in a series of biological functions in tumor occurrence and development. Our previous studies showed that microRNA-21 (miR-21) was abundant in both esophageal cancer cells and their corresponding exosomes. The present study explored the function of exosome-shuttling miR-21 involved in esophageal cancer progression. We found that exosomes could be internalized from the extracellular space to the cytoplasm. The exosome-derived Cy3-labeled miR-21 mimics could be transported into recipient cells in a neutral sphingomyelinase 2 (nSMase2)-dependent manner. miR-21 overexpression from donor cells significantly promoted the migration and invasion of recipient cells by targeting programmed cell death 4 (PDCD4) and activating its downstream c-Jun N-terminal kinase (JNK) signaling pathway after co-cultivation. Our population plasma sample analysis indicated that miR-21 was upregulated significantly in plasma from esophageal cancer patients and showed a significant risk association for esophageal cancer. Our data demonstrated that a close correlation existed between exosome-shuttling miR-21 and esophageal cancer recurrence and distant metastasis. Thus, exosome-shuttling miR-21 may become a potential biomarker for prognosis among esophageal cancer patients.


Assuntos
Proteínas Reguladoras de Apoptose/genética , Neoplasias Esofágicas/genética , Neoplasias Esofágicas/patologia , Exossomos/genética , MicroRNAs/genética , Proteínas de Ligação a RNA/genética , Idoso , Idoso de 80 Anos ou mais , Linhagem Celular Tumoral , Movimento Celular , Progressão da Doença , Exossomos/patologia , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Masculino , Pessoa de Meia-Idade , Invasividade Neoplásica , Prognóstico , Transdução de Sinais
9.
J Environ Sci (China) ; 17(2): 309-14, 2005.
Artigo em Inglês | MEDLINE | ID: mdl-16295912

RESUMO

The development of Persistent Organic Pollutants (POPs) control policy in China in the context of international concerns on POPs was reviewed. The aspects of the Chinese POPs control strategies were analyzed, and compared with those of developed counterparts (e.g. U.S., E.U., Japan). Currently, while the legal framework on POPs management, which complies with international guidelines has been established, it should be improved in the areas of special POPs management, risk assessment, the precautionary principle, life-cycle management and technical support capacity. The analysis of Chinese POPs policy and suggestions for strengthening the science-based decision making capacity are not only useful for Chinese decision-makers, but also a case study for developing world and make a great contribution for the global elimination of POPs to make a toxic-free future.


Assuntos
Poluição Ambiental/análise , Poluição Ambiental/legislação & jurisprudência , Poluição Ambiental/prevenção & controle , Cooperação Internacional , Compostos Orgânicos/análise , Política Pública , China , Medição de Risco/métodos
10.
J Environ Sci (China) ; 17(2): 327-31, 2005.
Artigo em Inglês | MEDLINE | ID: mdl-16295915

RESUMO

For improving the environmental quality and ensuring supply of wood and non-timber forest products, many forests have been planted in plain areas of China. Scientists have studied their benefits, almost all of the approaches were based on fixed-point data, and few was considered on the non-efficient factors and temporal scale effects. This paper studies the positive and negative benefits at a large temporal scale, and the effects of plain afforestation on stockbreeding and rural economy. The benefits of plain afforestation, correlation coefficiency of agroforestry and production factors are analyzed via stochastic frontier modeling in Huanghuaihai Plain Area of China; elastic coefficient of agroforestry, husbandry, farming, and total output of agricultural sector are calculated through adopting partial differential equation. Some conclusions can be drawn that, plain forests have an important effect on the development of plain agriculture. But shelterbelts and small-scale forests have different effect on the development of agricultural economy. Shelterbelts have negative effect on the industries, but small-scale forest has positive effect. On the whole, contribution of forest resource to value of animal husbandry and gross production value of agriculture is positive, and to the value of farming is negative.


Assuntos
Agricultura/economia , Criação de Animais Domésticos/economia , Conservação dos Recursos Naturais , Agricultura Florestal/economia , Modelos Teóricos , Agricultura/métodos , Criação de Animais Domésticos/métodos , China , Agricultura Florestal/métodos
11.
Artigo em Inglês | MEDLINE | ID: mdl-26117064

RESUMO

Tetrabromobisphenol A (TBBPA), hexabromocyclododecane (HBCD) and decabromodiphenyl ether (BDE 209), suspected ubiquitous contaminants, account for the largest volume of brominated flame retardants (BFRs) since penta-BDE and octa-BDE have been phased out globally. In this paper, the growth inhibition and gene transcript levels of antioxidant enzymes (superoxide dismutase (SOD), catalase (CAT)) and the stress-response gene involved in the prevention of oxidative stress (Hsp70) of earthworms (Eisenia fetida) exposed to TBBPA, HBCD and BDE 209 were measured to identify the toxicity effects of selected BFRs on earthworms. The growth of earthworms treated by TBBPA at 200 and 400 mg/kg dw were inhibited at rate of 13.7% and 22.0% respectively, while there was no significant growth inhibition by HBCD and BDE 209. A significant (P<0.01) up-regulation of SOD expression level was observed in earthworms exposed to TBBPA at 50 mg/kg dw (1.77-fold) and to HBCD at 400 mg/kg dw (2.06-fold). The transcript level of Hsp70 gene was significantly up-regulated (P<0.01) when earthworms exposed to TBBPA at concentration of 50-200 mg/kg (2.16-2.19-fold) and HBCD at 400 mg/kg (2.61-fold). No significant variation of CAT gene expression in all the BFRs treatments was observed, neither does all the target gene expression level exposed to BDE 209. Assessed by growth inhibition and the changes at mRNA levels of encoding genes in earthworms, TBBPA showed the greatest toxicity, followed by HBCD and BDE 209, consistent with trends in molecular properties. The results help to understand the molecular mechanism of antioxidant defense.


Assuntos
Antioxidantes/metabolismo , Exposição Ambiental/efeitos adversos , Expressão Gênica/efeitos dos fármacos , Éteres Difenil Halogenados/efeitos adversos , Hidrocarbonetos Bromados/efeitos adversos , Oligoquetos/efeitos dos fármacos , Bifenil Polibromatos/efeitos adversos , Animais , Catalase/genética , Catalase/metabolismo , Retardadores de Chama/efeitos adversos , Expressão Gênica/genética , Proteínas de Choque Térmico HSP70/genética , Proteínas de Choque Térmico HSP70/metabolismo , Oligoquetos/genética , Oligoquetos/metabolismo , Estresse Oxidativo/efeitos dos fármacos , Estresse Oxidativo/genética , RNA Mensageiro/genética , Superóxido Dismutase/genética , Superóxido Dismutase/metabolismo , Regulação para Cima/efeitos dos fármacos , Regulação para Cima/genética
12.
Huan Jing Ke Xue ; 30(4): 1166-72, 2009 Apr 15.
Artigo em Chinês | MEDLINE | ID: mdl-19545024

RESUMO

Concentrations and composition of 16 polycyclic aromatic hydrocarbons (PAHs) listed for prior control by US EPA were detected by analyzing 28 surface soil samples from the chemical industrial areas of Tianjin Binhai New Area with a gas chromatography equipped with mass spectrometry (GC/MS). Relative concentrations of PAH compounds with different benzene rings and principal component analysis were used to identify the possible sources of soil PAHs. The maximum PAH concentration in all the samples was 5,991.7 ng x g(-1), with a mean values of 1,185.0 ng x g(-1). The concentrations of four and five rings PAH components were higher than that of the other PAH components in Tanggu and Hangu chemical industrial areas, and three rings PAH components were major PAHs in Dagang petroleum industrial area. There is significant positive correlation (n = 28, R2 = 0.847, p < 0.01) between PAH concentrations and total organic carbon (TOC) contents in the soil samples. Coal combustion was the dominant source of PAHs in chemical industrial areas, while petroleum volatilization and leakage were main contributors of PAHs in Dagang petroleum industrial area.


Assuntos
Indústria Química , Hidrocarbonetos Policíclicos Aromáticos/análise , Poluentes do Solo/análise , China , Cromatografia Gasosa-Espectrometria de Massas , Resíduos Industriais/análise
13.
Huan Jing Ke Xue ; 29(9): 2684-8, 2008 Sep.
Artigo em Chinês | MEDLINE | ID: mdl-19068665

RESUMO

Based on environmental statistics data from 1993 to 2005, spatial distribution and temporal tendency of the environmental pollution and destruction accidents and their external causes were analyzed by using GIS and non-parametric correlation methods. It was concluded that (1) during the study period, annual environmental pollution accidents was maximally 3001 times in 1994 and minimally 1406 in 2005, while the frequency decreased in general. In addition, water and air accidents occupied the most; (2) environmental pollution and destruction accidents centralized in southeast and middle parts of China, mainly in Hunan, Sichuan, and Guangxi; (3) factors including population, GDP, company number and industrial waste water discharge had positive impacts on frequency of environmental pollution and destruction accidents, while in developed provinces the frequency was only correlated with company number.


Assuntos
Monitoramento Ambiental/métodos , Poluição Ambiental/estatística & dados numéricos , Sistemas de Informação Geográfica , China , Ecologia/métodos , Ecologia/tendências , Poluição Ambiental/análise , Previsões
14.
Huan Jing Ke Xue ; 29(2): 446-53, 2008 Feb.
Artigo em Chinês | MEDLINE | ID: mdl-18613519

RESUMO

Evaluating the contribution of maize growth to soil organic carbon is important for the understanding of the relationship of farmland carbon balance and agriculture production. 4 times of 13C pulse-labelling were used to estimate the photosynthesized carbon distribution at different development stages (seedling, elongation, heading and grain-filling) in maize-soil system, and quantify the carbon inputs into each part of belowground in whole growth season. The result indicated that the 13C retained aboveground reached its maximum: 80.01% among net assimilated 13C at grain-filling stage labelling. For the 4 labelling stages, the 13C transferred into belowground is 43.24%, 46.46%, 30.30% and 19.99% respectively, and of the 13C input into belowground, 34.68%-77.56% was respired by rhizosphere, 16.63%-57.02% was remain in roots and 5.05%-8.30% was incorporated into soil organic carbon by rhizodeposition. During the whole growth season of maize, the photosynthesized carbon allocated to aboveground, roots, rhizosphere respiration and soil organic carbon was 62.39%, 17.88%, 17.07% and 2.67% of the net assimilated carbon. At elongation, heading and grain-filling stages, maize's rhizosphere respiration accounted for 67.07%, 63.31% and 28.82% of the total CO2 efflux from the soil respectively, during the same period rhizosphere priming effect led to 31.11%, 79.09% and 120.83% increase of decomposition of original soil organic carbon respectively. Based on the calculation of 18 t x hm(-2) dry matter of maize for farmland production and its C content is 42%, the total carbon transferred into belowground is 4.6 t x hm(-2), among which 2.1 t x hm(-2) was respired by rhizoshphere, 2.2 t x hm(-2) was retained in roots and 0.33 t x hm(-2) was incorporated into soil organic carbon.


Assuntos
Carbono/metabolismo , Fotossíntese/fisiologia , Raízes de Plantas/metabolismo , Solo/análise , Zea mays/metabolismo , Isótopos de Carbono , Compostos Orgânicos/metabolismo
15.
Huan Jing Ke Xue ; 28(2): 225-31, 2007 Feb.
Artigo em Chinês | MEDLINE | ID: mdl-17489174

RESUMO

Topsoil samples around the Guanting Reservoir ranging from 2 - 10km were measured for heavy metals concentrations. GIS and geostatistical techniques were applied to analyze the special variation and eco-environmental risk of heavy metals. The results show that Cd is the major contamination in this area, 3.4 fold higher than the national background level, with a mean of 0.68 mg/kg and a standard deviation of 0.17. The area in which Cd concentration is higher than the second level of national standard accounts for about 40% of the whole study area. Spacial variation of heavy metals (except Ni) mainly is induced by the stochastic factors-mostly anthropogenic activities, e.g. fertilizer application, cultivation and planting modes, etc. The spatial pattern of heavy metals approximately declines in the W-N and N-S direction, with the highest value in the region between Yanghe River and Huailai County. The complex contamination index of heavy metals has the same distribution as their concentrations. However, the complex eco-risk index with higher value mainly occurs in vicinities of Huailai County, Yanqing County and Beixinpu town. It suggests that the town with higher population density and industrialization will induce both environmental pollution and ecological risk.


Assuntos
Cádmio/análise , Metais Pesados/análise , Poluentes do Solo/análise , Abastecimento de Água , China , Monitoramento Ambiental , Resíduos Industriais/análise , Níquel/análise
16.
Huan Jing Ke Xue ; 28(3): 673-8, 2007 Mar.
Artigo em Chinês | MEDLINE | ID: mdl-17633654

RESUMO

Analytic hierarchy process and a specialist investigation were applied to value the three PCBs treatment technologies qualitatively and quantitatively, in which the environmental, technological, social and economic factors were considered. The most important factor is thought to be environmental impact. Incineration is proved to be the most suitable technology in this period according to the research. For the high concentration of PCBs pollutants, or the low concentration of PCBs pollutants with good economic performance and large quantity of waste, incineration is considered the best. For the low concentration of PCBs pollutants in the area with bad economic performance and with little quantity of waste, cement kiln and landfill are thought to be suitable. It is also suggested that pollutants be treated at the nearest place. What's more, the measures to improve the three technologies are discussed and the policy comments on PCBs treatment are presented.


Assuntos
Poluentes Ambientais/análise , Recuperação e Remediação Ambiental/métodos , Bifenilos Policlorados/análise , Monitoramento Ambiental , Resíduos Industriais
17.
Huan Jing Ke Xue ; 27(2): 228-34, 2006 Feb.
Artigo em Chinês | MEDLINE | ID: mdl-16686180

RESUMO

An assessment of the current state of pollution from polychlorinated biphenyls (PCBs) and PCBs spatial character in sediments are represented. The sources of PCBs and relative factors are also analyzed. Songhua River and Dalian Bay in Northeast, Baoding in Hebei Province, Ya-er Lake in Wuhan City, Pearl River and Taiwan Province in Southeast of China have relatively high level of PCBs, while most other regions have lower average concentrations of PCBs. Serious pollution of PCBs is found in some locations, most of which are harbors, industrial areas, the places where improper disposal of and leakage from PCB containers taken place Point source pollution is the common pattern of contamination, influenced primarily by local geographic, economic, management and historical factors, with Pearl River/Estuary as an example.


Assuntos
Água Doce/análise , Sedimentos Geológicos/análise , Bifenilos Policlorados/análise , Poluentes Químicos da Água/análise , China , Medição de Risco/estatística & dados numéricos , Rios
18.
J Environ Sci Health B ; 41(3): 309-21, 2006.
Artigo em Inglês | MEDLINE | ID: mdl-16484090

RESUMO

Topsoil samples from 56 sites around the Guanting Reservoir, China, were measured for HCH and DDT concentrations. The total soil HCH content (including alpha-, beta-, gamma-, and delta-isomers) in these soil samples ranged from 0 to 7.33 ng x g(-1), with a mean of 0.69 ng x g(-1). These levels were considerably lower than those of the total DDT soil contents (including pp'-DDE, pp'-DDD, op'-DDT, and pp'-DDT), which ranged from 0 to 76.01 ng x g(-1), with a mean of 9.46 ng x g(-1). DDT was also found to be the major pollutant in the soil samples, accounting for approximately 93% of the total organochlorine pesticide (OCP) contents. Several environmental factors including land use, soil texture, soil taxonomy, and microbial biomass were considered to be responsible for the OCP levels observed. The data provide some insight into the effects of environmental conditions such as soil formation, agricultural cultivation, nutrient enrichment, and other anthropogenic activities on the degradation of OCPs in soils. Although the OCP residues currently are below the maximum limits set for use on agricultural land in China, and only rarely would such levels pose significant ecological concern, OCPs are highly persistent in soil and bioaccumulative. The data provided in this study are considered crucial for reservoir remediation, especially since the Guanting Reservoir will serve as one of the main drinking water sources for Beijing in the foreseeable future.


Assuntos
DDT/análise , Hexaclorocicloexano/análise , Resíduos de Praguicidas/análise , Poluentes do Solo/análise , China , Monitoramento Ambiental/métodos , Inseticidas/análise
19.
Artigo em Inglês | MEDLINE | ID: mdl-12046669

RESUMO

Experiments were conducted in pot culture and field plots to study the effects of Anaerobic Digested Residues (ADR) on nitrate accumulation in leaf vegetables, which is critical for the safety of food. The results showed that compared to chemical fertilizer, ADR could decrease the nitrate accumulation in rape and spinach. Furthermore, nitrate content in plant tissue was increased with the increase of percentage of chemical nitrogen in the mixture of chemical fertilizer and ADR. A comparison of spraying digested slurry with irrigation showed that spraying method could reduce the nitrate content of rape, however, a reverse result was found in spinach. The nitrate accumulation in rape affected by ADR was more apparent in high fertility soil than that in low fertility one. To regulate the nitrate accumulation in plant, it was more apparent in rape under greenhouse cultivation, while more apparent in spinach under open-air cultivation. The results demonstrated that the ADR was effective in the safe food production and it may convert the technology to be more profitable.


Assuntos
Fertilizantes , Contaminação de Alimentos , Nitratos/farmacocinética , Poluentes do Solo/farmacocinética , Verduras/química , Bactérias Anaeróbias/fisiologia , Gases , Nitrogênio/farmacocinética , Folhas de Planta/química , Segurança
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA