Structural connections between the noradrenergic and cholinergic system shape the dynamics of functional brain networks.

Complex cognitive abilities are thought to arise from the ability of the brain to adaptively reconfigure its internal network structure as a function of task demands. Recent work has suggested that this inherent flexibility may in part be conferred by the widespread projections of the ascending arousal systems. While the different components of the ascending arousal system are often studied in isolation, there are anatomical connections between neuromodulatory hubs that we hypothesise are crucial for mediating key features of adaptive network dynamics, such as the balance between integration and segregation. To test this hypothesis, we estimated the strength of structural connectivity between key hubs of the noradrenergic and cholinergic arousal systems (the locus coeruleus [LC] and nucleus basalis of Meynert [nbM], respectively). We then asked whether the strength of structural LC and nbM inter-connectivity was related to individual differences in the emergent, dynamical signatures of functional integration measured from resting state fMRI data, such as network and attractor topography. We observed a significant positive relationship between the strength of white-matter connections between the LC and nbM and the extent of network-level integration following BOLD signal peaks in LC relative to nbM activity. In addition, individuals with denser white-matter streamlines interconnecting neuromodulatory hubs also demonstrated a heightened ability to shift to novel brain states. These results suggest that individuals with stronger structural connectivity between the noradrenergic and cholinergic systems have a greater capacity to mediate the flexible network dynamics required to support complex, adaptive behaviour. Furthermore, our results highlight the underlying static features of the neuromodulatory hubs can impose some constraints on the dynamic features of the brain.

Evidencing a place for the hippocampus within the core scene processing network.

Functional neuroimaging studies have identified several "core" brain regions that are preferentially activated by scene stimuli, namely posterior parahippocampal gyrus (PHG), retrosplenial cortex (RSC), and transverse occipital sulcus (TOS). The hippocampus (HC), too, is thought to play a key role in scene processing, although no study has yet investigated scene-sensitivity in the HC relative to these other "core" regions. Here, we characterised the frequency and consistency of individual scene-preferential responses within these regions by analysing a large dataset (n = 51) in which participants performed a one-back working memory task for scenes, objects, and scrambled objects. An unbiased approach was adopted by applying independently-defined anatomical ROIs to individual-level functional data across different voxel-wise thresholds and spatial filters. It was found that the majority of subjects had preferential scene clusters in PHG (max = 100% of participants), RSC (max = 76%), and TOS (max = 94%). A comparable number of individuals also possessed significant scene-related clusters within their individually defined HC ROIs (max = 88%), evidencing a HC contribution to scene processing. While probabilistic overlap maps of individual clusters showed that overlap "peaks" were close to those identified in group-level analyses (particularly for TOS and HC), inter-individual consistency varied across regions and statistical thresholds. The inter-regional and inter-individual variability revealed by these analyses has implications for how scene-sensitive cortex is localised and interrogated in functional neuroimaging studies, particularly in medial temporal lobe regions, such as the HC. Hum Brain Mapp 37:3779-3794, 2016. © 2016 Wiley Periodicals, Inc.

G protein-coupled receptors.

The diversity of the G protein-coupled receptor superfamily is now being realised with the molecular cloning of DNA encoding many new receptors and receptor subfamilies. The existing pharmacological definitions of receptor subtypes have been extended dramatically with identification of additional subtypes at the molecular level. Functional analysis of cloned receptors by expression in heterologous cell types has demonstrated that individual receptor subtypes can couple to a variety of different effector systems.

A data resource from concurrent intracranial stimulation and functional MRI of the human brain.

Mapping the causal effects of one brain region on another is a challenging problem in neuroscience that we approached through invasive direct manipulation of brain function together with concurrent whole-brain measurement of the effects produced. Here we establish a unique resource and present data from 26 human patients who underwent electrical stimulation during functional magnetic resonance imaging (es-fMRI). The patients had medically refractory epilepsy requiring surgically implanted intracranial electrodes in cortical and subcortical locations. One or multiple contacts on these electrodes were stimulated while simultaneously recording BOLD-fMRI activity in a block design. Multiple runs exist for patients with different stimulation sites. We describe the resource, data collection process, preprocessing using the fMRIPrep analysis pipeline and management of artifacts, and provide end-user analyses to visualize distal brain activation produced by site-specific electrical stimulation. The data are organized according to the brain imaging data structure (BIDS) specification, and are available for analysis or future dataset contributions on openneuro.org including both raw and preprocessed data.

Sequence and expression of human estrogen receptor complementary DNA.

The mechanism by which the estrogen receptor and other steroid hormone receptors regulate gene expression in eukaryotic cells is not well understood. In this study, a complementary DNA clone containing the entire translated portion of the messenger RNA for the estrogen receptor from MCF-7 human breast cancer cells was sequenced and then expressed in Chinese hamster ovary (CHO-K1) cells to give a functional protein. An open reading frame of 1785 nucleotides in the complementary DNA corresponded to a polypeptide of 595 amino acids and a molecular weight of 66,200, which is in good agreement with published molecular weight values of 65,000 to 70,000 for the estrogen receptor. Homogenates of transformed Chinese hamster ovary cells containing a protein that bound [3H]estradiol and sedimented as a 4S complex in salt-containing sucrose gradients and as an 8 to 9S complex in the absence of salt. Interaction of this receptor-[3H]estradiol complex with a monoclonal antibody that is specific for primate ER confirms the identity of the expressed complementary DNA as human estrogen receptor. Amino acid sequence comparisons revealed significant regional homology among the human estrogen receptor, the human glucocorticoid receptor, and the putative v-erbA oncogene product. This suggests that steroid receptor genes and the avian erythroblastosis viral oncogene are derived from a common primordial gene. The homologous region, which is rich in cysteine, lysine, and arginine, may represent the DNA-binding domain of these proteins.

1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene.

The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Rat insulin genes: construction of plasmids containing the coding sequences.

Recombinant bacterial plasmids have been constructed that contain complementary DNA prepared from rat islets of Langerhans messenger RNA. Three plasmids contain cloned sequences representing the complete coding region of rat proinsulin I, part of the preproinsulin I prepeptide, and the untranslated 3' terminal region of the mRNA. A fourth plasmid contains sequences derived from the A chain region of rat preproinsulin II.

Evidence for allocentric boundary and goal direction information in the human entorhinal cortex and subiculum.

In rodents, cells in the medial entorhinal cortex (EC) and subiculum code for the allocentric direction to environment boundaries, which is an important prerequisite for accurate positional coding. Although in humans boundary-related signals have been reported, there is no evidence that they contain allocentric direction information. Furthermore, it has not been possible to separate boundary versus goal direction signals in the EC/subiculum. Here, to address these questions, we had participants learn a virtual environment containing four unique boundaries. Participants then underwent fMRI scanning where they made judgements about the allocentric direction of a cue object. Using multivariate decoding, we found information regarding allocentric boundary direction in posterior EC and subiculum, whereas allocentric goal direction was decodable from anterior EC and subiculum. These data provide the first evidence of allocentric boundary coding in humans, and are consistent with recent conceptualisations of a division of labour within the EC.

First Report of Puccinia kuehnii, Causal Agent of Orange Rust of Sugarcane, in the United States and Western Hemisphere.

In June 2007, approximately 8 km east of Belle Glade, FL, a rust disease was observed on a sugarcane (a complex hybrid of Saccharum L. species) cultivar (CP 80-1743) considered resistant to brown rust caused by Puccinia melanocephala Syd. & P. Syd. Approximately 10 km south of Canal Point, FL, another cultivar (CP 72-2086), also considered resistant to P. melanocephala, was found to be infected with a rust. Samples were sent to the USDA-APHIS National Mycologist and the USDA-ARS Systematic Mycology and Microbiology Laboratory in Beltsville, MD for identification. Observed morphological features were consistent with P. kuehnii E.J. Butler. Uredinial lesions were orange and variable in size, measuring 650 to 850 × 26 to 32 µm, hypophyllous, ellipsoidal to fusiform in shape, and distinctly lighter than pustules of P. melanocephala that were present in the area along with P. kuehnii. Urediniospores were mostly obovoid to pyriform or broadly ellipsoidal, variable in size, 32 to 45 × 25 to 30 µm, and moderately echinulate with mostly evenly distributed spines 2 to 4.5 µm apart. Walls were orange-to-light cinnamon brown, 1 to 2.5 µm thick with a pronounced apical wall thickening as much as 7 µm, and 4 to 5 equatorial pores. Similar orange uredinial lesions were subsequently observed on the same two cultivars and several other cultivars, including CPCL99-1777 and CPCL01-1055, at different locations in South Florida. Telia and teliospores were not observed. The nuclear large subunit rDNA region of the rust infecting cv. CP 80-1743 (BPI 878243, GenBank Accession No. EU164549) and the ITS1, 5.8S, and ITS2 rDNA regions of the rust infecting CP 80-1743 (GenBank Accession No. EU176009) and CP 72-2086 (GenBank Accession No. EU176008) were sequenced (1,4). All sequences were identical to sequences of P. kuehnii and distinct from known sequences of P. melanocephala (4). To our knowledge, this is the first confirmed record of P. kuehnii infecting sugarcane in the Western Hemisphere, and the disease appears to be distributed widely in the South Florida sugarcane-growing area. Although listed by P. Holliday (3) as occurring in Cuba, the Dominican Republic, and Mexico, CMI map no. 215 ed. 4 (2) does not include these three countries in the known distribution of P. kuehnii. P. kuehnii has also been reported in the literature as present in Hawaii (4). However, examination of the specimen label found that the specimen cited in those papers (BPI 079624) was actually collected in Tahiti. Therefore, the report from Hawaii is erroneous. References: (1) M. C. Aime. Mycoscience 47:112, 2006. (2) CMI. Distribution Maps of Plant Diseases. No. 215, ed. 4. CAB International, Wallingford, UK, 1981. (3) P. Holliday. Fungus Diseases of Tropical Crops. Cambridge University Press, Cambridge, 1980. (4) E. V. Virtudazo et al. Mycoscience 42:447, 2001.

French translation and cross-cultural adaptation of the Michigan Hand Outcomes Questionnaire and the Brief Michigan Hand Outcomes Questionnaire.

Patient-Reported Outcome Measures (PROMs) are important clinical devices for evaluating injuries and surgeries of the hand. However, some of the most widely used questionnaires, such as the MHQ and bMHQ, are currently unavailable in French, which prevents them from being used in the French Canadian province of Quebec as well as in other French-speaking nations. We therefore intend to develop valid and culturally adapted French translations of the afore-mentioned questionnaires. Two independent bilingual translators converted all English questionnaires to French. Two distinct translators then translated the French versions back to English in reverse-blinded fashion. Discrepancies between the original and second English versions were examined by a committee of four bilingual healthcare professionals before final French translations of all documents were produced. Thirty patients bilingual in French and English were then asked to complete the original and French versions of the MHQ and bMHQ. Their answers were compared in order to assess the accuracy of our translation. In light of these findings, revised French versions were produced. French versions of the MHQ and bMHQ questionnaires produced metrological qualities of validity and fidelity with an inter-class correlation superior to 0.90 and a kappa coefficient of 0.81 to 1. Clinical applicability revealed the distribution of scores according to disease process was reproducible between the English and French versions. PROM translation requires a rigorous process in order to achieve strong metrological qualities in both the original and translated versions. We produced French translations of the MHQ and bMHQ by abiding to the Beaton method of cross-cultural adaptation of self-reported measures.

Genetic instability and the development of steroid hormone insensitivity in cultured T 47D human breast cancer cells.

The estrogen receptor (ER)-positive human breast cancer cell line T 47D exhibited genetic instability under cell culture conditions which maintained almost continuous exponential growth. This resulted in the spontaneous generation of three ER-positive sublines with a range of DNA ploidies and distinctive phenotypes. One of these sublines, T 47D-5, exhibited resistance to the growth-inhibitory effects of the synthetic nonsteroidal antiestrogen tamoxifen and the synthetic progestin ORG 2058, in marked contrast to "wild type" T 47D cells (designated T 47D-7 in this study). T 47D-5 cells were cloned by limiting dilution and 11 clonal cell lines were tested for sensitivity to tamoxifen. Although all clones of T 47D-5 were significantly less sensitive than T 47D-7 cells, a spectrum of sensitivities was observed. Three clones, T 47D-5-13, T 47D-5-21, and T 47D-5-23, were further characterized by measuring the concentrations of receptors for estrogen, progesterone, growth hormone, and epidermal growth factor and responses to estradiol, tamoxifen, and progestin, in terms of both induction of specific proteins and effects on cellular proliferation. Although the T 47D-5 subline and clone T 47D-5-23 were insensitive to both the growth-stimulatory effects of estradiol and the inhibitory effects of tamoxifen, this was not related to the concentration of ER or its ability to induce progesterone receptor. Estrogen receptor levels were similar in resistant and sensitive clones of T 47D-5 [70,000-81,000 sites/cell] and were 2.5-fold greater than in the sensitive T 47D-7 line [32,600 +/- 5,000 (SEM) sites/cell]. Northern blots showed no difference in the size of ER mRNA transcripts between sensitive and resistant clones. Estradiol treatment increased progesterone receptor (PR) levels in all cell lines but the magnitude and sensitivity of this response were unrelated to growth responses indicating a divergence in estrogenic control of cellular proliferation and specific protein synthesis within these clones. T 47D-5, T 47D-5-13, T 47D-5-21, and T 47D-5-23 were all insensitive to the growth-inhibitory effects of ORG 2058. The progestin was also unable to increase lactogenic and epidermal growth factor receptor concentrations in these four lines in contrast to the response in T 47D-7 cells. The insensitivity to progestin in the T 47D-5 subline and its three clonal cell lines could be accounted for, in part, by a 75-80% reduction in PR levels when compared with T 47D-7 cells.(ABSTRACT TRUNCATED AT 400 WORDS)

Amplification, expression, and steroid regulation of the preprogalanin gene in human breast cancer.

The GALN gene encodes the preprogalanin protein that is cleaved to liberate the galanin peptide, a neuropeptide and tumor cell mitogen, and the galanin message-associated peptide, which is of unknown function. GALN is located at chromosome 11q13, a frequently amplified locus in diverse tumor types including breast cancer. To determine whether GALN may contribute to the tumor phenotype resulting from 11q13 amplification, we examined GALN amplification and preprogalanin mRNA levels in breast tumors and cell lines. GALN was amplified in a subset of breast tumors and cell lines that carried 11q13 amplifications. Preprogalanin mRNA was expressed in the majority of breast cancer cell lines, but Northern analysis failed to demonstrate a relationship between GALN amplification and preprogalanin mRNA levels. Eight of eight estrogen receptor-positive cell lines expressed detectable preprogalanin mRNA, and further investigation showed that preprogalanin mRNA was increased by treatment with estradiol and progestin and decreased by the removal of serum or treatment with antiestrogens. Thus, GALN amplification is unlikely to contribute to the phenotype conferred by 11q13 amplification in breast cancer, but preprogalanin mRNA is expressed by breast cancer cells and is under steroid hormone control in estrogen receptor-positive cells, opening the wider question of the role of this steroid-regulated neuropeptide in the normal and cancerous breast.

Effects of exercise training and dietary manipulation on insulin-regulatable glucose-transporter mRNA in rat muscle.

Both exercise training and dietary manipulation (increasing omega-3/omega-6 fat ratio) can ameliorate insulin resistance caused by a high-fat diet in rats. We determined whether alterations in the expression of the insulin-regulatable (IR) and/or HepG2 glucose-transporter (GT) mRNAs were similarly affected. There was a significantly higher level of IRGT mRNA in skeletal muscle from exercise-trained versus sedentary high-fat-fed rats (27% increase, P less than 0.01). This difference is consistent with previously reported increases in muscle insulin-mediated glucose uptake. Skeletal muscle HepG2GT mRNA was too low to detect any training effect, but there was a tendency toward higher levels with training in cardiac muscle. In contrast, dietary manipulation, previously shown to lead to a much greater increase (100-300%) in muscle insulin-mediated glucose uptake, did not change IRGT or HepG2GT mRNA in skeletal muscle or heart. Thus, both dietary manipulation and exercise training increase insulin-stimulated glucose uptake in skeletal muscle, but only exercise training increases IRGT mRNA. Therefore, exercise training apparently increases GT production, whereas dietary manipulation improves glucose transport in skeletal muscle by other mechanisms.

Progestin regulation of estrogen receptor messenger RNA in human breast cancer cells.

Progestin antagonism of estrogen action is thought to be due, at least in part, to progestin down-regulation of the estrogen receptor (ER). The molecular mechanisms subserving this effect, and the functional consequences in terms of target cell sensitivity to estrogens, are poorly understood. The present study was undertaken to address these issues with particular emphasis on progestin regulation of ER gene expression at the mRNA level. The T-47D human breast cancer cell line was treated with the synthetic progestin, ORG 2058, and the resultant changes in ER mRNA and ER levels determined by Northern analysis and radioligand binding, respectively. Treatment of T-47D cells with ORG 2058 resulted in rapid down-regulation of ER mRNA levels to a nadir of 35-40% of control by 6 h. This fall in ER mRNA levels was accompanied by a slower but more sustained fall in ER binding to a nadir of 20% of control at 24 h. Between 12 and 24 h ER mRNA levels recovered partially while ER ligand binding continued to fall. At 48 h both ER mRNA and ER concentrations remained depressed, although the latter to a greater extent. ER mRNA half-life was determined by [3H]uridine incorporation to be approximately 60 min and was unaffected by progestin treatment during the early rapid phase of ER mRNA down-regulation. These data demonstrate that progestins cause rapid down-regulation of the ER mRNA and suggest that during the early rapid phase of this effect, reduced transcription of the ER gene rather than altered ER mRNA half-life mediate this effect.(ABSTRACT TRUNCATED AT 250 WORDS)

Structural subtypes of the dopamine D2 receptor are functionally distinct: expression of the cloned D2A and D2B subtypes in a heterologous cell line.

Dopamine, a major neurotransmitter in the mammalian nervous system, exerts its physiological effects through receptors of the G-protein-coupled receptor superfamily. Two major classes of dopamine receptor, D1 and D2, are distinguishable by both biochemical and pharmacological criteria. D1 receptors activate adenylyl cyclase, whereas the D2 class of receptors inhibits this second messenger system. Two subtypes of the human dopamine D2 receptor are generated by alternate splicing of the RNA transcript of a single gene. These two forms, termed D2A (long) and D2B (short), differ by the insertion of 29 amino acids within the putative third cytoplasmic loop, an intracellular domain thought to have a role in coupling this class of receptors to particular second messenger systems. We report here that the D2A and D2B structural subtypes are also functionally distinct. Expression of the two subtypes in a fibroblast cell line revealed that while occupation of both receptors leads to an increase in cytosolic free calcium concentration, they differ in their capacity to inhibit cAMP production. At physiological dopamine concentrations, the D2B-mediated inhibition of calcitonin gene-related peptide-stimulated cAMP accumulation is almost double the response mediated by the D2A subtype. Furthermore, the D2B subtype can maximally attenuate cAMP accumulation by up to 85%, whereas the D2A subtype is less effective, maximally inhibiting cAMP accumulation by only 64%. The D2A and D2B subtypes, thus, constitute functionally distinct forms of the dopamine receptor that can couple to multiple intracellular signalling pathways.

Progestin inhibition of progesterone receptor gene expression in human breast cancer cells.

The present study was designed to investigate whether inhibition of progesterone receptor (PR) gene transcription and/or regulation of PR mRNA half-life were involved in the progestin-mediated decrease of PR in T-47D human breast cancer cells. Cells were treated with the progestin ORG 2058 and PR mRNA measured by Northern blot analysis of total RNA. A major PR mRNA around 13.5 kilobases and minor species around the 28S ribosomal RNA subunit were decreased upon ORG 2058 treatment. The decrease was not detectable until 2-3 h after treatment and was the same at all ORG 2058 concentrations (1-100 nM) tested. The decrease in PR mRNA was unaffected by actinomycin D in the first 3 h but was inhibited thereafter. There was a partial recovery of PR mRNA levels 24 h after ORG 2058 exposure. Immunoblot analysis showed that immunoreactive PR decreased in parallel with PR mRNA. The rate of protein loss in the first 12 h after progestin treatment was related to the ORG 2058 concentration used. Nuclear run-on experiments showed that ORG 2058 caused a decrease of up to 70% in the transcription rate of the PR gene. The half-life of PR mRNA was shown to be 2-2.5 h by [3H]uridine incorporation, which was much shorter than estimates obtained using actinomycin D, and was unaffected by ORG 2058. In summary, these data have shown that the mechanism by which progestins decrease the concentration of PR includes inhibition of transcription of the PR gene.

Construction of cell lines that express high levels of the human estrogen receptor and are killed by estrogens.

To prepare large amounts of the human estrogen receptor (ER) for biochemical and biophysical studies we have employed the cloned ER sequences to construct Chinese hamster ovary (CHO) cell line derivatives that overexpress the receptor. We have employed an efficient expression vector (SV40 enhancer, human metallothionein IIA promoter) and a new system of gene amplification based on the human metallothionein IIA gene and stepwise selection in cadmium. Cells from the initial transfected pools, before gene amplification, had as much or more ER than human MCF7 cells and responded to the subsequent stepwise cadmium selection and amplification with increases in ER levels to about 2 million receptors/cell. Cell lines isolated from these pools are stable for human ER expression and display up to 6 million receptors/cell, or about 0.4% of the total cell protein. The CHO receptor activates a transfected reporter gene in responses to estrogen, is down-regulated in response to estrogens, displays the same electrophoretic mobility as the MCF7 receptor, and is free of degradation as initially extracted. CHO cells displaying 3 million or more human ER/cell (but not cells with lower levels) flatten and stop growing within the first 24 h after exposure to physiological estrogen concentrations. After several days in estrogen the majority of the cells lyse. The antiestrogen 4-hydroxytamoxifen also causes cell death, but another antiestrogen, ICI 164,384, is without toxic effect. The basis for these phenomena are unknown, but mutants isolated for survival of estrogen treatment have lost receptor expression, thereby confirming the role of receptor in cell death.

APOE-ε4 selectively modulates posteromedial cortex activity during scene perception and short-term memory in young healthy adults.

Apolipoprotein E (APOE) ε4 is a major genetic risk factor for Alzheimer's disease (AD), yet the mechanisms by which APOE-ε4 influences early-life brain function, and hence, in turn, risk for later-life AD, are poorly understood. Here, we report a novel, and selective, pattern of functional brain activity alteration in healthy young adult human APOE-ε4 carriers. Our findings suggest that APOE-ε4 may influence vulnerability to poorer later life cognitive health via its effect on posteromedial cortex (PMC), a hub region within a brain network involved in spatial processing, and necessary for episodic memory. In two neuroimaging tasks, APOE-ε4 carriers showed an inability to effectively modulate PMC during scene, but not face and object, working memory and perception. This striking pattern overlaps both functionally and topographically, with the earliest cognitive deficits seen in clinical AD, as well as reported alterations in the default network in amyloid-positive individuals at increased risk of AD.

Human galanin: molecular cloning reveals a unique structure.

Galanin, a novel neuropeptide/hypothalamic hormone originally identified and isolated by virtue of its carboxy-terminal amide group, has recently been shown to have a diverse range of biological activities, including potent effects on the secretion of insulin and growth hormone. The physiological role of galanin remains unclear, with different effects being observed when porcine and rat galanin have been used in various animal model systems and in human studies. Molecular cloning of cDNA encoding human galanin and galanin mRNA associated peptide (GMAP) from both pituitary and neuroblastoma sources has revealed a unique and unexpected structure. In contrast to porcine, bovine and rodent galanin, human galanin lacks a carboxy-terminal amide. By analogy to other neurohormones, the absence of carboxy-terminal amidation would be expected to have significant effects on functional properties such as affinity for different receptor subtypes and physiological half life, and may be responsible for the species specificity observed in the action of galanin.

Hybridization histochemistry: use of recombinant DNA as a "homing probe" for tissue localization of specific mRNA populations.

A procedure, termed hybridization histochemistry, has been developed to locate in specially prepared whole sections of tissue those areas which contain specific mRNA populations. Three 32P-labelled recombinant DNA probes were used; one complementary to endorphin mRNA, one complementary to growth hormone mRNA and one a fragment of bacterial DNA. The specific cell populations or tissue regions binding the probe were identified by autoradiography. Hybridization histochemistry is thus similar in principle to immunohistochemical procedures. The endorphin probe consistently labelled the rat pituitary pars intermedia which is known to be particularly rich in the corresponding mRNA. Likewise the growth hormone probe specifically labelled the anterior pituitary. Control tissues were not labelled by either probe, nor did the bacterial DNA probe significantly label any tissue, providing further evidence of the specificity of the procedure. These results, which are highly reproducible, indicate that the mRNA species for endorphin and growth hormone are present in whole sections of pituitary in a physical state which leaves them accessible to cDNA probes. This initial success provides encouragement that hybridization histochemistry, with further refinement, should have wide applicability in the localization and semi-quantitative analysis of intracellular mRNA in whole frozen sections of tissue.