Ageing hallmarks exhibit organ-specific temporal signatures.

Ageing is the single greatest cause of disease and death worldwide, and understanding the associated processes could vastly improve quality of life. Although major categories of ageing damage have been identified-such as altered intercellular communication, loss of proteostasis and eroded mitochondrial function1-these deleterious processes interact with extraordinary complexity within and between organs, and a comprehensive, whole-organism analysis of ageing dynamics has been lacking. Here we performed bulk RNA sequencing of 17 organs and plasma proteomics at 10 ages across the lifespan of Mus musculus, and integrated these findings with data from the accompanying Tabula Muris Senis2-or 'Mouse Ageing Cell Atlas'-which follows on from the original Tabula Muris3. We reveal linear and nonlinear shifts in gene expression during ageing, with the associated genes clustered in consistent trajectory groups with coherent biological functions-including extracellular matrix regulation, unfolded protein binding, mitochondrial function, and inflammatory and immune response. Notably, these gene sets show similar expression across tissues, differing only in the amplitude and the age of onset of expression. Widespread activation of immune cells is especially pronounced, and is first detectable in white adipose depots during middle age. Single-cell RNA sequencing confirms the accumulation of T cells and B cells in adipose tissue-including plasma cells that express immunoglobulin J-which also accrue concurrently across diverse organs. Finally, we show how gene expression shifts in distinct tissues are highly correlated with corresponding protein levels in plasma, thus potentially contributing to the ageing of the systemic circulation. Together, these data demonstrate a similar yet asynchronous inter- and intra-organ progression of ageing, providing a foundation from which to track systemic sources of declining health at old age.

Sleep quality according to chronotype in nurses working 8-hour shifts.

BACKGROUND: To date, studies have been focused on sleep disturbances of nurses working during night shifts. There is a lack of understanding regarding the sleep quality of nurses working in the rapid rotation system for each type of shift work. AIMS: To determine the relationship between chronotype and sleep quality according to shift type (i.e. day, evening and night shifts) in nurses working 8-hour rotating shifts. METHODS: A cross-sectional, descriptive study was conducted from two tertiary hospitals in South Korea from December 2021 to September 2022, including nurses working 8-hour rotating shifts (N = 74). They completed questionnaires to measure general, occupational and sleep-related characteristics, chronotype, insomnia severity and daytime sleepiness. Additionally, sleep parameters were collected from actigraphy and sleep diaries for 7 days. RESULTS: A total of 64% of nurses had an evening chronotype and 37% of nurses had an intermediate chronotype. Nurses had significantly less total sleep time and worsened sleep latency and efficiency during the day shift compared to other shift types. Compared to nurses with an intermediate chronotype, those with an evening chronotype had poorer sleep quality during day shift work. CONCLUSIONS: Strategies to enhance nurses' sleep quality during day shifts should consider a two-level approach: individual approaches, such as improving sleep hygiene, and administrative approaches, such as establishing a chronotype-based shift system for scheduling.

[Focusing on the major national demands and developing novel research models--the research progress and prospective of islet organoid].

Diabetes is a major metabolic disease and health issue worldwide that imposes a heavy burden. Research on its pathogenesis and development of effective treatments are currently our major national demands. With the advent of organoid technology, islet organoids have emerged and are attracting increasing attention as a promising model for diabetes research. The establishment of islet organoids is based on the current understanding of islet development. With addition of extra induction factors in vitro to programmatically activate or inhibit specific signaling pathways during islet development, stem cells can be induced to differentiate into three-dimensional cell cultures that possess structures and functions similar to those of natural islets. Because of their capability to mimic the development of islets in vitro, faithfully replicate islet structure, and perform islet physiological functions, islet organoids have been widely used as a valuable tool for the investigation of diabetes pathogenesis, drug screening and evaluation, and clinical transplantation, showing a great potential application. This paper reviews the current research progress, application, and challenges of islet organoids, and discusses the future directions for research on islet organoids.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Protective effects of KLF4 on blood-brain barrier and oxidative stress after cerebral ischemia-reperfusion in rats through the Nrf2/Trx1 pathway.

PURPOSE: To investigate the role of KLF4 in CI/R injury and whether Nrf2/Trx1 axis acted as a downstream pathway of KLF4 to exert the protective role in blood-brain barrier destruction after CI/R. METHODS: The tMCAO rat model in vivo was constructed and received the intracerebroventricular injection of 5 µg/kg and 10 µg/kg rhKLF4 before operation. TTC, brain water content, neurological function, ELISA, behavioral tests, HE, TUNEL, and qRT-PCR were performed to detect the protective role of KLF4 on CIR. Double-fluorescence staining and western blot were performed to determine the localization and spatiotemporal expression in brain tissues. Furthermore, we also analyzed the effect of KLF4 on the blood-brain barrier (BBB) and related mechanisms in vivo and in vitro. Nrf2 inhibitor tretinoin was applied, which was intraperitoneally injected into CIR rat. Evans blue staining was conducted. In vitro OGD/R models of bEnd.3 cells were also established, and received KLF4 overexpressed transfection and 12.5 µM tretinoin incubation. The permeability of bEnd.3 cells was evaluated by TEER and FITC-dextran leakage. BBB-related factors and oxidative stress were also analyzed, respectively. The tubular ability of KLF4 on OGD/R bEnd3 cells was also evaluated. RESULTS: In vivo study confirmed that KLF4 was expressed in astrocyte, and its content increased with time. KLF4 protected against brain injury caused by cerebral ischemia-reperfusion, reduced cerebral infarction area and oxidative stress levels, and promoted the recovery of behavioral ability in rats. Simultaneously, mechanism experiments confirmed that the repair effect of KLF4 on cerebral ischemia-reperfusion injury was closely related to the Nrf2/Trx1 pathway. KLF4 exerted the neuroprotective effect through upregulating Nrf2/Trx1 pathway. Consistent with in vivo animal study, in vitro study also confirmed the effect of KLF4 on the permeability of bEnd.3 cells after OGD/R injury through Nrf2/Trx1 pathway. CONCLUSION: Collectively, KLF4 played neuroprotective role in CIR induced MCAO and OGD/R, and the beneficial effects of KLF4 was partly linked to Nrf2/Trx1 pathway.

Internal structural analysis of the nasomaxillary complex in patients with skeletal class III asymmetry: A study on asymmetry patterns.

OBJECTIVES: To investigate the internal structure of the nasomaxillary complex, including the maxillary sinus, nasal cavity and nasal septum according to the facial asymmetry pattern and to evaluate its correlation with external maxillomandibular asymmetry in Class III patients based on cone-beam computerized tomography (CBCT) images. MATERIALS AND METHODS: Facial asymmetry was analysed in a total of 100 Class III patients aged 16 years or older using CBCT scans. Patients were categorized into subgroups based on asymmetry pattern. Measurements of the nasomaxillary complex were obtained from the CBCT scans, including the volume and width of the maxillary sinuses and nasal cavities on deviated and non-deviated sides, as well as the displacement of the nasal septum. Statistical analysis was performed to compare the internal nasomaxillary variables within and between groups, and regression analysis was conducted to evaluate the correlation between facial asymmetry and the internal nasomaxillary variables. RESULTS: Group comparisons showed that there were no significant differences in the volume of the maxillary sinus and nasal cavity. However, the direction and extent of nasal septum deviation, as well as the width of the nasal cavity, varied depending on the maxillary asymmetry pattern. Regression analysis indicated a correlation between nasal septum deviation and the difference in maxillary height, while the difference in nasal cavity width was correlated with the difference in maxillary width. CONCLUSION: A comprehensive evaluation of the internal nasal anatomy is vital for understanding the intricate relationship between nasal structure and maxillary growth.

[Experimental study on the therapeutic effect and mechanism of erlotinib on non-proliferative diabetic retinopathy].

Objective: To investigate the therapeutic effect and mechanism of erlotinib, an epidermal growth factor receptor (EGFR) inhibitor, on non-proliferative diabetic retinopathy (NPDR). Methods: An experimental research was conducted. Human retinal Müller cells (RMC) were MIO-M1 cells from Moorfields Ophthalmology Hospital and the Institute of Ophthalmology at London University College. MIO-M1 cells were divided into normal, hypertonic, high glucose, high glucose+dimethyl sulfoxide (DMSO), high glucose+erlotinib 0.5 mmol/L, high glucose+erlotinib 1 mmol/L, and high glucose+erlotinib 2 mmol/L groups using a random number table method. Detection of the effect of erlotinib on the proliferation of MIO-M1 cells under high glucose conditions was performed by 5-ethynyl-2'-deoxyuridine (EdU) method. Western blotting (WB) was used to detect the effect of erlotinib on the activation markers of glial fibrillary acidic protein (GFAP) and glutamine synthetase (GS) protein levels in MIO-M1 cells under high glucose conditions. WB was used to detect the effect of erlotinib on the protein levels of nerve growth factor receptor (p75NTR), vimentin, and cell retinol binding protein (CRALBP) in RMC under high glucose conditions. MIO-M1 cells were divided into normal group, high glucose group, high glucose+DMSO group, and high glucose+erlotinib (1 mmol/L) group using random number table method. The effect of erlotinib on EGFR nuclear translocation under high glucose conditions was detected by cell immunofluorescence staining. Immunoprecipitation was used to detect the effect of erlotinib on the interaction between EGFR and transcription intermediate factor 2 (TIF2) in MIO-M1 cells under high glucose conditions. MIO-M1 cells were randomly divided into normal group, high glucose group, high glucose+DMSO group, high glucose+Myc-DDK empty body group, high glucose+erlotinib group, high glucose+erlotinib+human doublet protein group, high glucose+erlotinib+TIF2 plasmid group, and high glucose+erlotinib+human doublet protein+TIF2 plasmid group. Cell immunofluorescence staining was used to detect the effect of erlotinib on the binding of EGFR and TIF2 in MIO-M1 cells under high glucose conditions through the EGFR/TIF2 axis. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to detect the regulatory effect of EGFR and TIF2 binding on cyclin D1 transcription in MIO-M1 cells under high glucose conditions. The mouse model of diabetes retinopathy (DR) was constructed and divided into normal group, DR group, DR+DMSO group, DR+erlotinib 0.25 mg·kg-1·d-1 group, DR+erlotinib 0.5 mg·kg-1·d-1 group and DR+erlotinib 1 mg·kg-1·d-1 group. 25 mice in total, 5 in each group. Tissue immunofluorescence staining was used to detect the expression of RMC activation marker GFAP. The FITC-dextran injection experiment was used to detect the effect of erlotinib on retinal vascular leakage in a murine DR model. Results: Compared with the normal group (32.4%±3.0%), the proportion of EdU positive cells in RMC in the high glucose group (59.2%±3.8%) increased (P<0.001). Compared with the high glucose group (59.2%±3.8%), the proportion of EdU positive cells in the high glucose+1 mmol/L erlotinib group (37.6%±4.4%) decreased (P<0.001). Compared with the normal group, the expression of GFAP in RMC in the high glucose group increased (1 in the normal group, 2.27±0.11 in the high glucose group, P<0.001), while the expression of GS decreased (1 in the normal group, 0.32±0.03 in the high glucose group, P<0.001). 1 mmol/L erlotinib treatment reduced the expression of GFAP in RMC under high glucose conditions (1.32±0.13 and 2.27±0.11, respectively; P<0.001), and increased the expression of GS (0.71±0.06 and 0.32±0.03, respectively; P<0.001). The colocalization of EGFR and DAPI in RMC of the high glucose+1 mmol/L erlotinib group was lower than that of the high glucose group (52.2%±4.1% and 76.4%±5.7%, respectively; P<0.001). The expression of TIF2 or EGFR both increased while using EGF or TIF2 antibodies to precipitate TIF2 or EGFR under high glucose conditions compared to the normal group (1 in the normal group, 2.27±0.20 in the high glucose group, 2.17±0.21 in the EGFR, all P<0.05). And the expression of TIF2 (1.38±0.10) or EGFR (1.32±0.13) in the high glucose+erlotinib group was lower than that in the high glucose group (2.27±0.20) and the high glucose group (2.17±0.21) (all P<0.05). The colocalization of EGFR and TIF2 (17.2%±3.9%) and the mRNA level of Cyclin D1 (1.32±0.16) in the RMC of the high glucose+erlotinib group were lower than those in the high glucose group (54.6%±3.7% of EGFR and TIF2 colocalization ratio, 2.58±0.19 of Cyclin D1 mRNA level,all P<0.05). The high glucose+erlotinib+AREG (EGFR agonist) group, high glucose+erlotinib+Myc DDK-TIF2 plasmid group and high sugar+erlotinib+AREG+Myc-DDK-TIF2 plasmid group EGFR colocalization with TIF2 (colocalization ratios 24.1%±1.9%, 26.0%±2.3%, 35.3%±2.5%) and TIF2 mRNA levels (1.71±0.16, 1.72±0.18, 2.20±0.18). Compared with the high glucose+erlotinib group, The increases were statistically significant (all P<0.05). Compared to the normal group, the expression of GFAP in mouse retina tissue was increased in the DR group (1 in the normal group, 3.07±0.19 in the DR group, P<0.001), and 0.5 mg·kg-1·d-1 erlotinib (1.73±0.30) significantly reduced the expression of GFAP in the retina of DR group mice (P<0.05). Compared to the normal group (3.97±0.47), the DR group (23.13±2.15) showed an increase in fluorescein leakage, while the DR+erlotinib group (11.66±1.45) showed a significant decrease in leakage compared to the DR group (all P<0.05). Conclusions: Erlotinib inhibits the proliferation and activation of RMC induced by high glucose, inhibits the entry of EGFR into the nucleus, inhibits the binding of EGFR to TIF2 in RMC, and reduces the transcription of Cyclin D1 in RMC by inhibiting the interaction between EGFR and TIF2. At the same time, erlotinib inhibits the proliferation and activation of RMC in the mouse DR model, ameliorating retinal vascular leakage in mice. These results suggest that erlotinib inhibits the activation and proliferation of RMC by downregulating the EGFR/TIF2/Cyclin D1 pathway under high glucose conditions, thereby alleviating the progression of NPDR.

Validation of the vault prediction model based on the sulcus-to-sulcus diameter and lens thickness: a 925-eye prospective study.

BACKGROUND: To verify the accuracy and stability of the prediction formula based on the ciliary sulcus diameter and lens thickness and to analyse factors influencing the prediction results. METHODS: In total, 925 eyes from 506 subjects were enrolled in this prospective study between July 1, 2020, and June 30, 2021. Subjects were divided into four seasons, each spanning three months. The target vault was set to be between 300 µm and 700 µm according the prediction formula. The actual vault was measured one month postoperatively. The Bland-Altman test, 95% confidence intervals (95% CI) and 95% limits of agreement (95% LoA) were used to evaluate the agreement between the predicted vault and the actual vault. Eyes with absolute prediction errors greater than 300 µm were further analysed. RESULTS: The mean predicted vaults for the four seasons were 503 ± 99, 494 ± 96, 481 ± 92 and 502 ± 93 µm, while the mean actual vaults were 531 ± 189, 491 ± 179, 464 ± 179 and 529 ± 162 µm, respectively. The predicted and actual vaults of the overall subjects were 493 ± 95 and 500 ± 180 µm, respectively. Of the 925 eyes, 861 eyes (93.08%), 42 eyes (4.54%), and 22 eyes (2.38%) showed a normal vault, high vault, and low vault, respectively. Bland-Altman plots showed that the mean difference between the actual vault and predicted vault overall (± 95% LoA) was 6.43 ± 176.2 µm (-339 to 352 µm). Three UBM features may lead to large prediction errors (more than 300 µm): wide iris-ciliary angle (ICA), iris concavity and anteriorly positioned ciliary body. CONCLUSIONS: This study demonstrated the accuracy and stability of the prediction formula through the validation of a large sample size and a long time span. Wide ICA, iris concavity and anteriorly positioned ciliary body may have an effect on vault.

[Questions and reflections in the diagnosis and treatment of younger breast cancer in China].

Compared with the median age of breast cancer onset in western countries at 62-64 years, the median age in China is around 16 years earlier. There are nearly fifty thousand new breast cancer patients younger than 40 years in China every year. The tumor characteristics, diagnosis and treatment methods, and psychosocial needs of these young patients are often different from elder breast cancer patients. Currently, the international clinical guidelines for young breast cancer are mainly formulated by western countries, which often do not address the unique clinical needs from young breast cancer patients in China. There are many questions and problems in the diagnosis and treatment of young breast cancer in China that do not have standard answer and are urgently in need of expert consensus to guide clinical decision-making.

PPP1CA/YAP/GS/Gln/mTORC1 pathway activates retinal Müller cells during diabetic retinopathy.

Diabetic retinopathy (DR) is a vision-loss complication caused by diabetes with high prevalence. During DR, the retinal microvascular injury and neurodegeneration derived from chronic hyperglycemia have attracted global attention to retinal Müller cells (RMCs), the major macroglia in the retina contributes to neuroprotection. Protein Phosphatase 1 Catalytic Subunit Alpha (PPP1CA) dephosphorylates the transcriptional coactivator Yes-associated protein (YAP) to promote the transcription of glutamine synthetase (GS). GS catalyzes the transformation of neurotoxic glutamate (Glu) into nontoxic glutamine (Gln) to activate the mammalian target of rapamycin complex 1 (mTORC1), which promotes the activation of RMCs. In this study, in vitro MIO-M1 cell and in vivo mouse high-fat diet and streptozotocin (STZ)-induced diabetic model to explore the role of the PPP1CA/YAP/GS/Gln/mTORC1 pathway on the activation of MRCs during DR. Results showed that PPP1CA promoted the dephosphorylation and nuclear translocation of YAP in high glucose (HG)-exposed MIO-M1 cells. YAP transcribed GS in HG-exposed MIO-M1 cells in a TEAD1-dependent and PPP1CA-dependent way. GS promoted the biosynthesis of Gln in HG-exposed MIO-M1 cells. Gln activated mTORC1 instead of mTORC2 in HG-exposed MIO-M1 cells. The proliferation and activation of HG-exposed MIO-M1 cells were PPP1CA/YAP/GS/Gln/mTORC1-dependent. Finally, RMC proliferation and activation during DR were inhibited by the PPP1CA/YAP/GS/Gln/mTORC1 blockade. The findings supplied a potential idea to protect RMCs and alleviate the development of DR.

Shikonin alleviates choroidal neovascularization by inhibiting proangiogenic factor production from infiltrating macrophages.

Choroidal neovascularization (CNV), a feature of neovasular age-related macular degeneration (AMD), acts as a leading cause of vision loss in the elderly. Shikonin (SHI), a natural bioactive compound extracted from Chinese herb radix arnebiae, exerts anti-inflammatory and anti-angiogenic roles and also acts as a potential pyruvate kinase M2 (PKM2) inhibitor in macrophages. The major immune cells macrophages infiltrate the CNV lesions, where the production of pro-angiognic cytokines from macrophage facilitates the development of CNV. PKM2 contributes to the neovascular diseases. In this study, we found that SHI oral gavage alleviated the leakage, area and volume of mouse laser-induced CNV lesion and inhibited macrophage infiltration without ocular cytotoxicity. Moreover, SHI inhibited the secretion of pro-angiogenic cytokine, including basic fibroblast growth factor (FGF2), insulin-like growth factor-1 (IGF1), chemokine (C-C motif) ligand 2 (CCL2), placental growth factor and vascular endothelial growth factor (VEGF), from primary human macrophages by down-regulating PKM2/STAT3/CD163 pathway, indicating a novel potential therapy strategy for CNV.

Short-term changes in and preoperative factors affecting vaulting after posterior chamber phakic Implantable Collamer Lens implantation.

BACKGROUND: To describe the very early vault changes in the first month after Implantable Collamer Lens (ICL) implantation and to evaluate the effect of preoperative biometric factors on vault. METHODS: Eighty-three eyes from eighty-three subjects with complete data who met follow-up requirements were recruited in this retrospective study between May 2019 and March 2020. We quantitatively assessed the postoperative vault at 2 h, 1 day, 1 week, and 1 month following implantation. Associations between the postoperative vault and age, ICL size, spherical equivalent (SE), axial length (AL), central corneal thickness (CCT), flat keratometry (K), steep K, mean K, anterior chamber depth (ACD), crystalline lens thickness (LT), white-to-white (WTW) diameter obtained by three devices, horizontal and vertical sulcus-to-sulcus (STS) diameter, bright and dark pupil sizes (BPS and DPS) and DPS-BPS were investigated using Spearman's correlation analysis and stepwise multiple regression analysis. RESULTS: The mean vault values at 2 h, 1 day, 1 week, and 1 month after ICL implantation were 672.05 ± 30.72, 389.15 ± 28.33, 517.23 ± 30.76 and 530.12 ± 30.22 µm, respectively. Significant differences were found in the vault values at 2 h, 1 day and 1 week after the operation. The ICL size (ß = 0.942; p < 0.001), followed by horizontal STS (ß = -0.517; p < 0.001), crystalline LT (ß = -0.376; p < 0.001) and vertical STS (ß = -0.257; p = 0.017), significantly influenced the vault at 1 month after the operation. The multiple regression equation was expressed as follows: central vault (µm) = -1369.05 + 657.121 × ICL size- 287.408 × horizontal STS - 432.497 × crystalline LT - 137.33 × vertical STS (adjusted R2 = 0.643). CONCLUSIONS: After ICL implantation, the vault decreased and then increased, but it did not return to the vault value 2 h after surgery. The ICL size, horizontal and vertical STS and crystalline LT are key factors for predicting postoperative vaulting.

Melatonin inhibits Müller cell activation and pro-inflammatory cytokine production via upregulating the MEG3/miR-204/Sirt1 axis in experimental diabetic retinopathy.

Diabetic retinopathy (DR) is the most common ocular complication caused by diabetes mellitus and is the main cause of visual impairment in working-age people. Reactive gliosis and pro-inflammatory cytokine production by Müller cells contribute to the progression of DR. Melatonin is a strong anti-inflammatory hormone, mediating the cytoprotective effect of a variety of retinal cells against hyperglycemia. In this study, melatonin inhibited the gliosis activation and inflammatory cytokine production of Müller cells in both in vitro and in vivo models of DR. The melatonin membrane blocker, Luzindole, invalidated the melatonin-mediated protective effect on Müller cells. Furthermore, melatonin inhibited Müller cell activation and pro-inflammatory cytokine production by upregulating the long noncoding RNA maternally expressed gene 3/miR-204/sirtuin 1 axis. In conclusion, our study suggested that melatonin treatment could be a novel therapeutic strategy for DR.

A prodrug of epigallocatechin-3-gallate alleviates high glucose-induced pro-angiogenic factor production by inhibiting the ROS/TXNIP/NLRP3 inflammasome axis in retinal Müller cells.

Diabetic retinopathy (DR) is a neurovascular complication of diabetes mellitus that leads to blindness in the working-age population. Retinal Müller cells proliferate and produce pro-angiogenic factors, including vascular endothelial growth factor (VEGF) and hepatocyte growth factor (HGF), via the reactive oxygen species (ROS)/thioredoxin interacting protein (TXNIP)/NACHT, LRR and PYD domain-containing protein 3 (NLRP3) inflammasome axis to promote proliferative DR. Epigallocatechin-3-gallate (EGCG) plays anti-oxidant, anti-inflammatory, anti-proliferative and anti-angiogenic roles in Müller cells. A prodrug of EGCG (pro-EGCG) enhances the bioavailability of EGCG. In an in vitro model of high glucose-stimulated Müller cells, pro-EGCG inhibited proliferation and pro-angiogenic factor production by down-regulating the activity of the ROS/TXNIP/NLRP3 inflammasome axis. In a mouse DR model, pro-EGCG reduced ROS accumulation, NLRP3 inflammasome activation, Müller cell proliferation, and production of the pro-angiogenic factors VEGF and HGF. In summary, pro-EGCG mitigated hyperglycaemia-challenged Müller cell proliferation and pro-angiogenic factor production by inhibiting ROS/TXNIP/NLRP3 inflammasome signalling, implying a potential therapeutic strategy for DR.

Epigallocatechin-3-gallate stimulates autophagy and reduces apoptosis levels in retinal Müller cells under high-glucose conditions.

Retinal neurodegeneration is an early feature in the pathogenesis of diabetic retinopathy (DR). Autophagy is an intracellular catabolic process involved in protein and organelle degradation that has been linked in DR. Epigallocatechin gallate (EGCG) is a major polyphenol in green tea that has beneficial effects in diabetic. however, it is not currently known whether EGCG can regulate Müller cell autophagy. Here, we showed that EGCG increased autophagy by promoting the formation of autophagosomes, increasing lysosomal acidification, and stimulating autophagic flux in Müller cells, while high glucose (HG) induced a decrease in autophagy and an increase in apoptosis. However, retinal Müller cells in HG treated with EGCG showed autophagy machinery activation and reestablishment of cargo degradation, protecting the cells from apoptosis. EGCG could increase the ability of cells to proliferate by increasing autophagy. In an experimental model of diabetic retinopathy, EGCG reduced the reactive gliosis of Müller cells and decreased retinal damage. These results highlight that HG downregulates autophagy and accumulates P62 cargo due to lysosomal dysfunction and then increases apoptosis, which was reversed by treatment with EGCG. This finding might be valuable for developing a novel therapeutic strategy to treat DR.

Substance P induces sympathetic immune response in the contralateral eye after the first eye cataract surgery in type 2 diabetic patients.

BACKGROUND: Substance P (SP) is a nociceptive tachykinin which regulates the immune inflammatory reactions including monocyte chemoattractant protein 1 (MCP-1) production. Sequential second-eye cataract surgery patients often suffer more pain than the first one partly because of the MCP-1 increase in aqueous humor (AH). This study aims to illustrate whether SP is involved in sympathetic inflammatory responses in the contralateral eye in patients with or without type 2 diabetes. METHODS: This prospective randomized clinical study included 51 cataract patients (22 with diabetes and 29 without). Bilateral sequential cataract surgeries were conducted with 1-day or 1-week interval randomly. More than 100 µl of AH were obtained before surgery and stored for later analysis using magnetic Luminex assays to detect interleukin (IL)-1ß, IL-1ra,IL-6, IL-8, IL-10, MCP-1, vascular endothelial growth factor, spinal macrophage inflammatory protein (MIP-1a), interferon-inducible protein 10 (IP-10), regulated on activation, normal T expressed and secreted (RANTES), as well as the enzyme-linked immunosorbent assay for SP. RESULTS: Among the 4 groups, no significant differences were found in age, sex distribution, the R/L ration of the first surgery eye, or the lens nucleus hardness (P ≥ 0.802). Over 100 µl of AH samples were collected safely in all cases without intraoperative complications. SP and MCP-1 levels were both increased significantly in the second eye of the diabetic patients with 1-day and 1-week interval (P ≤ 0.040). The SP increase in the second eye of the diabetic patients were significantly higher than that of the patients without diabetes (P ≤ 0.030) both in the groups with 1-day and 1-week interval. Similarly, the MCP-1 increase was significantly higher in the diabetic patients in the group with 1-week interval (P = 0.042). CONCLUSIONS: Substance P and MCP-1 productions elevated in the AH of the contralateral eye after the first-eye cataract surgery in diabetic patients, indicating that SP and MCP-1 were involved in the sympathetic inflammatory responses. Diabetic patients are susceptible to noninfectious inflammation after cataract surgery, and perceive more pain in the second-eye phacoemulsification. TRIAL REGISTRATION: Chinese Clinical Trial Registry, ChiCTR1900028374 , retrospectively registered on 20th December, 2019.

Intravitreal Ets1 siRNA alleviates choroidal neovascularization in a mouse model of age-related macular degeneration.

Choroidal neovascularization (CNV) is the basic feature of neovascular age-related macular degeneration (AMD), the leading cause of blindness in elders. Macrophages and microglia promote CNV via producing pro-angiogenic factors and inflammatory cytokines. Transcription factor E26 transformation specific-1 (Ets1) plays a pro-angiogenic role via its pro-inflammatory function. In this study, Ets1 increased and localized in the macrophages and microglia of a mouse laser-induced CNV region. Ets1 siRNA intravitreal injection ameliorated the leakage and area of CNV, as well as inhibiting the dysfunction of retinal pigment epithelium (RPE) cells and the activation of macrophages/microglia. Taken together, we provide a new insight into the molecular mechanism of CNV progression, in which Ets1 can be a new therapeutic target.

YAP via interacting with STAT3 regulates VEGF-induced angiogenesis in human retinal microvascular endothelial cells.

Endothelial dysfunction is a main feature of retinal neovascular diseases which are the leading cause of blindness in developed countries. Yes-associated protein (YAP) and signal transducer and activator of transcription factor 3 (STAT3) participate in angiogenesis via vascular endothelial growth factor (VEGF) signaling. Additionally, YAP can bind STAT3 in endothelial cells. In the study, dimethyloxalylglycine (DMOG) stimulated human retinal microvascular endothelial cells (HRMECs) was used as retinal endothelial hypoxia model. The proliferation of HRMECs, as well as t-YAP, p-STAT3 (Tyr705) increased, while p-YAP (Ser127), p-YAP (Ser397) decreased following hypoxia. Meanwhile, YAP and STAT3 translocated to the nucleus. YAP knockdown inhibited the proliferation, migration and tube formation of HRMECs. YAP overexpression up-regulated phosphorylation of STAT3. The YAP overexpression-induced HRMECs proliferation, migration and tube formation were reversed by S3I-201, a selective STAT3 inhibitor. YAP interacted with STAT3 to promote STAT3 nuclear translocation. Additionally, YAP and STAT3 promoted the transcription of VEGF synergistically. Finally, inhibition of YAP alleviated retinal pathological neovascularization in mouse oxygen-induced retinopathy (OIR) model. In summary, activated YAP interacted with STAT3 to promote the activation and nuclear translocation of STAT3, hence boosted the proliferation, migration and tube formation of HRMECs via VEGF signaling following hypoxia. The data will further elucidate the mechanisms of retinal neovascular diseases.

Statistical analysis of the reproducibility and predictive capacity of MCTT HCE™ eye irritation test, a me-too test method for OECD TG 492.

We aimed to conduct additional statistical analysis of the reproducibility and predictive capacity of MCTT HCE™ eye irritation test (EIT), a me-too test method for OECD TG 492 with the data generated during the validation study in which 30 reference chemicals were tested in three repeated runs by three independent laboratories. We evaluated the within-laboratory reproducibility (WLR) and the between-laboratory reproducibility (BLR) through tabulation and graphs and presented the concordance of eye irritancy prediction with 95% Wilson's confidence intervals (CIs). Also, the analyses of the Intra-Class Correlation Coefficient (ICC) and Bland-Altman plot were applied to confirm the reproducibility and the comparability, referring to the validated methods of OECD TG 492. Kappa analysis was also performed to check the degree of agreement of the within- and between-laboratory reproducibility and agreement between MCTT HCE™ EIT and the reference methods. We calculated the predictive capacity via misprediction over total prediction method. The predictive capacity (sensitivity, specificity, and accuracy) was presented with 95% of Wilson's CIs. Also, bootstrap resampling was performed to express the 95% CI by the simple percentile methods for 30 chemicals and 141 reference chemicals additionally tested. Collectively, WLR (92.2%) and BLR (93.3%) met the criteria of the performance standards (WLR ≥ 90% and BLR ≥ 85%), and the results of ICC analysis and the Bland-Altman plot suggested an acceptable WLR and BLR and comparability to other validated methods of OECD TG 492. Also, the predictive capacity results for the 30 reference chemicals confirmed the good performance of the MCTT HCE™ EIT by satisfying the criteria of sensitivity, specificity, and the accuracy stated in the PS. The bootstrap resampling method showed a predictive capacity, sufficiently satisfying the criteria stated in the Performance Standards.

Magnetically Coated Bioabsorbable Stents for Renormalization of Arterial Vessel Walls after Stent Implantation.

The insertion of a stent in diseased arteries is a common endovascular procedure that can be compromised by the development of short- and long-term inflammatory responses leading to restenosis and thrombosis, respectively. While treatment with drugs, either systemic or localized, has decreased the incidence of restenosis and thrombosis these complications persist and are associated with a high mortality in those that present with stent thrombosis. We reasoned that if stents could be made to undergo accelerated endothelialization in the deployed region, then such an approach would further decrease the occurrence of stent thrombosis and restenosis thereby improving clinical outcomes. Toward that objective, the first step necessitated efficient capture of progenitor stem cells, which eventually would become the new endothelium. To achieve this objective, we engineered intrinsic ferromagnetism within nonmagnetizable, biodegradable magnesium (Mg) bare metal stents. Mg stents were coated with biodegradable polylactide (PLA) polymer embedding magnetizable iron-platinum (FePt) alloy nanoparticles, nanomagnetic particles, nMags, which increased the surface area and hence magnetization of the stent. nMags uniformly distributed on stents enabled capture, under flow, up to 50 mL/min, of systemically injected iron-oxide-labeled (IO-labeled) progenitor stem cells. Critical parameters enhancing capture efficiency were optimized, and we demonstrated the generality of the approach by showing that nMag-coated stents can capture different cell types. Our work is a potential paradigm shift in engineering stents because implants are rendered as tissue in the body, and this "natural stealthiness" reduces or eliminates issues associated with pro-inflammatory immune responses postimplantation.