Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 87
Filtrar
1.
Nucleic Acids Res ; 52(D1): D72-D80, 2024 Jan 05.
Artigo em Inglês | MEDLINE | ID: mdl-37904589

RESUMO

G-quadruplexes (G4s) are non-canonical four-stranded structures and are emerging as novel genetic regulatory elements. However, a comprehensive genomic annotation of endogenous G4s (eG4s) and systematic characterization of their regulatory network are still lacking, posing major challenges for eG4 research. Here, we present EndoQuad (https://EndoQuad.chenzxlab.cn/) to address these pressing issues by integrating high-throughput experimental data. First, based on high-quality genome-wide eG4s mapping datasets (human: 1181; mouse: 24; chicken: 2) generated by G4 ChIP-seq/CUT&Tag, we generate a reference set of genome-wide eG4s. Our multi-omics analyses show that most eG4s are identified in one or a few cell types. The eG4s with higher occurrences across samples are more structurally stable, evolutionarily conserved, enriched in promoter regions, mark highly expressed genes and associate with complex regulatory programs, demonstrating higher confidence level for further experiments. Finally, we integrate millions of functional genomic variants and prioritize eG4s with regulatory functions in disease and cancer contexts. These efforts have culminated in the comprehensive and interactive database of experimentally validated DNA eG4s. As such, EndoQuad enables users to easily access, download and repurpose these data for their own research. EndoQuad will become a one-stop resource for eG4 research and lay the foundation for future functional studies.


Assuntos
Bases de Dados Genéticas , Quadruplex G , Sequências Reguladoras de Ácido Nucleico , Animais , Humanos , Camundongos , Genoma , Genômica
2.
Int J Cancer ; 154(8): 1443-1454, 2024 Apr 15.
Artigo em Inglês | MEDLINE | ID: mdl-38126210

RESUMO

The cancer burden in China is increasing. We aimed to assess the time trends in the prevalence of 16 modifiable risk factors involved in lifestyle, diet, infection, and air pollution between 1997 and 2025 based on the China Health and Nutrition Survey, the Global Burden of Disease website, and publically available studies. The population attributable fraction (PAF) and its 95% uncertainty interval (UI) from 2007 to 2035 were calculated to quantify the attributable cancer burden in major 12 anatomic sites using the comparative risk assessment method, considering a 10-year lag effect. As a result, 1,559,476 cancer cases (PAF = 54.1%, 95% UI: 36.8%-65.8%) from the 12 anatomic sites were attributable to these modifiable risk factors in 2007, with lung, liver, and gastric cancer raging the top three. It was predicted that by 2035, the attributable cancer cases would reach 1,680,098 (PAF = 44.2%, 95% UI: 29.1%-55.5%), with the top three of lung, liver, and colorectal cancer. Smoking, physical inactivity, insufficient fruit consumption, HBV infection, and Helicobacter pylori infection were the most attributable risk factors in 2007, contributing to 480,352, 233,684, 215,009, 214,455, and 187,305 associated cancer cases, respectively. In 2035, the leading factors for cancer would be smoking, physical inactivity, insufficient fruit intake, HPV infection, and HBV infection, resulting in 427,445, 424,327, 185,144, 156,535, and 154,368 cancer cases, respectively. Intervention strategies should be swiftly established and dynamically altered in response to risk factors like smoking, physical inactivity, poor fruit intake, and infectious factors that may cause a high cancer burden in the Chinese population.


Assuntos
Infecções por Helicobacter , Helicobacter pylori , Neoplasias , Humanos , Fatores de Risco , Fumar/efeitos adversos , Fumar/epidemiologia , Neoplasias/epidemiologia , Neoplasias/etiologia
3.
Prev Med ; 185: 108021, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-38821420

RESUMO

OBJECTIVE: Lifestyle factors after cancer diagnosis could influence cancer survival. This study aimed to investigate the joint effects of smoking, physical activity, alcohol consumption, diet and sleep duration on all-cause, cancer and non-cancer mortality of cancer survivors in UK biobank. METHODS: The follow-up period concluded in December 2021, with post-diagnostic lifestyle factors assessed at baseline. A lifestyle score ranging from 0 to 5 was assigned based on adherence to the selected lifestyle factors. The study employed Cox regression models for hazard ratios (HRs) and Kaplan-Meier for survival rates, with stratified and sensitivity analyses to assess the robustness of our findings under various assumptions. RESULTS: During a median follow-up of 12.7 years, 5652 deaths were documented from 34,184 cancer survivors. Compared to scoring 0-1, the HRs (95% CIs) for all-cause mortality with lifestyle scores of 2, 3, 4, and 5 were 0.70 (95% CI: 0.64, 0.76), 0.57 (0.52, 0.62), 0.50 (0.45, 0.54) and 0.43 (0.38, 0.48), respectively. Specific cancer types, particularly digestive, breast, female reproductive, non-solid, and skin cancers, showed notable benefits from adherence to healthy lifestyle, with the HRs of 0.55 (0.39, 0.79), 0.54 (0.42, 0.70), 0.32 (0.19, 0.53), 0.58 (0.39, 0.86), and 0.36 (0.28, 0.46) for lifestyle score of 5, respectively. Stratified analyses indicated the association was particularly significant among those with normal/lower BMI and higher Townsend Deprivation Index (Pinteraction = 0.001 and < 0.001, respectively). CONCLUSIONS: Healthier lifestyles were significantly linked with reduced mortality among cancer survivors. These findings highlight the need for adherence to healthy lifestyle habits to improve survival.


Assuntos
Consumo de Bebidas Alcoólicas , Sobreviventes de Câncer , Exercício Físico , Estilo de Vida , Neoplasias , Humanos , Feminino , Masculino , Estudos Prospectivos , Pessoa de Meia-Idade , Sobreviventes de Câncer/estatística & dados numéricos , Neoplasias/mortalidade , Reino Unido/epidemiologia , Consumo de Bebidas Alcoólicas/epidemiologia , Idoso , Fumar/epidemiologia , Dieta , Adulto , Modelos de Riscos Proporcionais
4.
Clin Rehabil ; : 2692155241290258, 2024 Oct 14.
Artigo em Inglês | MEDLINE | ID: mdl-39397433

RESUMO

OBJECTIVE: To investigate the association between prestroke frailty and nonhome discharge, prolonged length of stay as well as functional outcomes. DESIGN: Prospective observational study. SETTING: Single urban teaching hospital in Guangzhou, China. PARTICIPANTS: Consecutive sample of 271 older patients admitted with acute stroke. INTERVENTION: N/A. MAIN MEASURES: A five-item FRAIL scale (0∼5 points) and the stroke severity at onset were measured. The primary outcome of interest was nonhome discharge, with secondary outcomes including prolonged length of stay and worse short-term prognosis. Multivariable logistic regression adjusting for confounding factors was used to determine the association between patient-reported frailty and nonhome discharge, prolonged length of stay, worse short-term prognosis. RESULTS: The population had a median age of 68 [interquartile range (IQR), 64∼74)]years, with 50 individuals (18.5%) identified as frail. After adjusting for age, sex, Barthel index, National Institutes of Health Stroke Scale, and Mini-Mental Status Exam score at admission, patients with self-reported frailty were significantly likely to experience nonhome discharge (Odds Ratio [OR] = 4.788; 95% confidence interval [CI] = 1.272∼18.017; p = .021), prolonged length of stay (OR = 4.76; 95% CI = 1.80∼12.56; p = .002), mRS scores at 30 days (OR = 6.72;95% CI = 1.79∼25.20; p = .005) and three months postdischarge and three-month (OR = 8.94; 95% CI = 2.10∼38.08; p = .003). CONCLUSIONS: In older adults with stroke, frailty is associated with nonhome discharge, prolonged length of stay, and worse short-term prognosis, regardless of the stroke severity, cognition, and Barthel index score at admission. FRAIL scale can be used as a practical screening tool in acute care setting by multidisciplinary team in supporting discharge process.

5.
Plant Dis ; 2024 Sep 05.
Artigo em Inglês | MEDLINE | ID: mdl-39235411

RESUMO

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

6.
Plant Dis ; 2024 Aug 08.
Artigo em Inglês | MEDLINE | ID: mdl-39115952

RESUMO

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

7.
Int J Mol Sci ; 25(8)2024 Apr 11.
Artigo em Inglês | MEDLINE | ID: mdl-38673821

RESUMO

Isothermal nucleic acid amplification-based lateral flow testing (INAA-LFT) has emerged as a robust technique for on-site pathogen detection, providing a visible indication of pathogen nucleic acid amplification that rivals or even surpasses the sensitivity of real-time quantitative PCR. The isothermal nature of INAA-LFT ensures consistent conditions for nucleic acid amplification, establishing it as a crucial technology for rapid on-site pathogen detection. However, despite its considerable promise, the widespread application of isothermal INAA amplification-based lateral flow testing faces several challenges. This review provides an overview of the INAA-LFT procedure, highlighting its advancements in detecting plant viruses. Moreover, the review underscores the imperative of addressing the existing limitations and emphasizes ongoing research efforts dedicated to enhancing the applicability and performance of this technology in the realm of rapid on-site testing.


Assuntos
Técnicas de Amplificação de Ácido Nucleico , Doenças das Plantas , Vírus de Plantas , Técnicas de Amplificação de Ácido Nucleico/métodos , Vírus de Plantas/genética , Vírus de Plantas/isolamento & purificação , Doenças das Plantas/virologia , Técnicas de Diagnóstico Molecular/métodos , Plantas/virologia , Plantas/genética
8.
Int J Mol Sci ; 25(16)2024 Aug 21.
Artigo em Inglês | MEDLINE | ID: mdl-39201758

RESUMO

The average content of casein in yak milk is 40.2 g/L. Casein can be degraded by enzymatic digestion or food processing to produce abundant degradation peptides. International researchers have studied the degradation peptides of yak milk casein by using multiple techniques and methods, such as in vitro activity tests, cellular experiments, proteomics, bioinformatics, etc., and found that the degradation peptides have a wide range of functional activities that are beneficial to the human body, such as angiotensin-converting enzyme (ACE) inhibitory, antioxidant, anti-inflammatory, antidiabetic, antimicrobial, anticancer, and immunomodulatory activities, etc., and it has been proved that the types and strengths of functional activities are closely related to the structural characteristics of the peptides. This paper describes the characteristics of yak milk proteins, the functional activities, and mechanism of action of degraded peptides. Based on the types of functional activities of yak milk casein degradation peptides, we classified and elucidated the effects of structural factors, such as peptide molecular weight, peptide length, amino acid sequence, physicochemical properties, electrical charge, hydrophobicity, spatial conformation, chain length, and the type of enzyme on these activities. It reveals the great potential of yak milk casein degradation peptides as functional active peptide resources and as auxiliary treatments for diseases. It also provides important insights for analyzing yak casein degradation peptide activity and exploring high-value utilization.


Assuntos
Caseínas , Leite , Peptídeos , Caseínas/química , Caseínas/metabolismo , Animais , Leite/química , Bovinos , Peptídeos/química , Peptídeos/farmacologia , Peptídeos/metabolismo , Humanos , Antioxidantes/química , Antioxidantes/farmacologia , Sequência de Aminoácidos , Inibidores da Enzima Conversora de Angiotensina/química , Inibidores da Enzima Conversora de Angiotensina/farmacologia , Inibidores da Enzima Conversora de Angiotensina/metabolismo , Proteólise
9.
Molecules ; 29(6)2024 Mar 21.
Artigo em Inglês | MEDLINE | ID: mdl-38543039

RESUMO

Yak whey protein concentrates (YWPCs) have good functional properties, but there is still a gap in the study of their peptides. In this study, peptides were obtained by enzymatic hydrolysis, and the bioactivity of each ultrafiltration fraction was evaluated using an optimal process. YWPCs were isolated and purified from yak milk as the raw material. Alkaline protease, trypsin, and papain were used to hydrolyze YWPCs. The protease with the highest degree of hydrolysis (DH) and peptide concentration was selected as the most suitable enzyme. The effects of pH, temperature, time, and the enzyme-to-substrate ratio (E/S) on the DH and peptide concentration were investigated, and response surface methodology was utilized to optimize the hydrolysis process. The hydrolysate was separated using ultrafiltration membranes with molecular weight cut-offs of 10 kDa, 5 kDa, 3 kDa, and 1 kDa. The bioactivity of each ultrafiltration component was analyzed, including the inhibition rates of α-amylase and xanthine oxidase (XOD) activities and the scavenging rates of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) cation radicals. The results indicated that alkaline protease was the best enzyme for hydrolyzing YWPCs. The peptide concentration in the YWPC hydrolysate was the highest (17.21 mg/mL) at a pH of 8 and a concentration of 7500 U/g, after 2.5 h at 62 °C. The enzymatic hydrolysate was ultrafiltered to yield four peptide fractions, of which the <1 kDa peptides exhibited the highest α-amylase inhibitory activity (22.06%), XOD inhibitory activity (17.15%), and ABTS cationic free radical scavenging rate (69.55%). This demonstrates the potential of YWPC hydrolyzed peptides for hypoglycemic, uric acid-lowering, and antioxidant applications, providing a theoretical basis for the high-value utilization of YWPCs.


Assuntos
Antioxidantes , Benzotiazóis , Sequestradores de Radicais Livres , Ácidos Sulfônicos , Animais , Bovinos , Hidrólise , Sequestradores de Radicais Livres/química , Proteínas do Soro do Leite , Antioxidantes/química , Peptídeos/química , Papaína/metabolismo , alfa-Amilases , Hidrolisados de Proteína/química
10.
J Med Virol ; 95(1): e28380, 2023 01.
Artigo em Inglês | MEDLINE | ID: mdl-36478357

RESUMO

Children are the high-risk group for COVID-19, and in need of vaccination. However, humoral and cellular immune responses of COVID-19 vaccine remain unclear in vaccinated children. To establish the rational immunization strategy of inactivated COVID-19 vaccine for children, the immunogenicity of either one dose or two doses of the vaccine in children was evaluated. A prospective cohort study of 322 children receiving inactivated COVID-19 vaccine was established in China. The baseline was conducted after 28 days of the first dose, and the follow-up was conducted after 28 days of the second dose. The median titers of receptor binding domain (RBD)-IgG, and neutralizing antibody (NAb) against prototype strain and Omicron variant after the second dose increased significantly compared to those after the first dose (first dose: 70.0, [interquartile range, 30.0-151.0] vs. second dose: 1261.0 [636.0-2060.0] for RBD-IgG; 2.5 [2.5-18.6] vs. 252.0 [138.6-462.1] for NAb against prototype strain; 2.5 [2.5-2.5] vs. 15.0 [7.8-26.5] for NAb against Omicron variant, all p < 0.05). The flow cytometry results showed that the first dose elicited SARS-CoV-2 specific cellular immunity, while the second dose strengthened SARS-CoV-2 specific IL-2+ or TNF-α+  monofunctional, IFN-γ+ TNF-α+  bifunctional, and IFN-γ- IL-2+ TNF-α+ multifunctional CD4+ T cell responses (p < 0.05). Moreover, SARS-CoV-2 specific memory T cells were generated after the first vaccination, including the central memory T cells and effector memory T cells. The present findings provide scientific evidence for the vaccination strategy of the inactive vaccines among children against COVID-19 pandemic.


Assuntos
Vacinas contra COVID-19 , COVID-19 , Criança , Humanos , População do Leste Asiático , Interleucina-2 , Pandemias , Estudos Prospectivos , Fator de Necrose Tumoral alfa , COVID-19/prevenção & controle , SARS-CoV-2 , Vacinação , Imunidade Celular , Anticorpos Neutralizantes , Imunoglobulina G , Anticorpos Antivirais , Imunidade Humoral
11.
Anal Biochem ; 678: 115267, 2023 10 01.
Artigo em Inglês | MEDLINE | ID: mdl-37516424

RESUMO

MiRNAs are biomarkers widely used in research but their clinical application is still challenging due to their low expression levels. Current methods for miRNA detection involve separate transcription and quantification for each target, which is costly and unsuitable for large sample sizes. This study provides a strategy for designing and screening miRNA-specific stem-loop reverse transcription (RT) primers, which enable the simultaneous transcription of three miRNAs and U6, and the concurrent detection of miRNA and U6 in the same transcript using TaqMan probes labeled with different dyes. The strategy was successfully employed to establish multiplex RT-PCR and dual-quantitative PCR (qPCR) quantification systems for 21 differentially expressed miRNAs during wound healing. The corresponding system can accurately quantify the cell culture samples containing miR-7a-5p mimic, miR-7a-5p inhibitor, or negative control. In summary, our results demonstrate that this strategy could efficiently accomplish the design, screening, and analysis of stem-loop RT primers for multiplex miRNA detection. Compared with the commercially customized miRNA assay kits, our system showed a higher degree of automation, more accurate qPCR assay capabilities, and lower assay costs, which could provide practical value for clinical diagnosis.


Assuntos
MicroRNAs , MicroRNAs/análise , Biomarcadores , Reação em Cadeia da Polimerase Multiplex , Regulação Neoplásica da Expressão Gênica , Perfilação da Expressão Gênica/métodos , Reação em Cadeia da Polimerase em Tempo Real/métodos
12.
J Microsc ; 291(2): 186-196, 2023 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-37268302

RESUMO

Commercial electron backscatter diffraction (EBSD) systems generally use interplanar angle matching for pattern indexing, and thus, they are unable to distinguish between some similar phases with close interplanar angles, such as Al and Si. The interplanar spacing is more diagnostic but generally difficult to apply in pattern indexing because it lacks precision. In this study, we proposed an efficient approach for accurately measuring interplanar spacing by correcting the reciprocal-lattice vector (RLV). The phase discrimination of Al and Si was performed by interplanar spacing matching. The Kikuchi bands were identified automatically by the self-developed method using pattern rotation combined with grey gradient recognition without the help of human eyes. The reliable RLV relationship was extracted by accurately drawing reciprocal-lattice vectors. The lengths of RLVs were corrected, and then the RLVs were used for evaluating lattice spacing. The results of five Kikuchi patterns with different clarity showed that this new method reduced the average error of interplanar spacings by 50.611% and achieved an average accuracy of 1.644% for lattice spacing calculation. The method could distinguish structures with a difference in lattice spacing of at least 3.3%. This method was also effective for fuzzy patterns and partially missing Kikuchi bands and might be used as a new strategy for improving the calculation accuracy of lattice spacing for fuzzy patterns. The method did not have additional requirements concerning the number of detected Kikuchi bands and poles. The accuracy of lattice spacing could be effectively improved by correcting the RLVs based on routine pattern recognition. This method might be used as an auxiliary approach to differentiate between similar phases and is well-adapted to the existing commercial EBSD system.

13.
Prev Med ; 175: 107674, 2023 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-37604289

RESUMO

Numerous studies have revealed associations between high intake of whole grains and reduced risk of various cancers. Yet, in recent decades, the traditional Chinese diets have been challenged by reduction in whole grains and increase in refined grains. To assess the impact of this dietary transition on cancer prevention, we analyzed the time trend of whole grain intake using nationally representative sampling data of over 15 thousand individuals from the China Health and Nutrition Survey. We applied the comparative risk assessment method to estimate the population attributable fraction of cancers due to insufficient whole grain intake from 1997 to 2011 and projected the trend of whole grain intake and the associated burden of cancers to 2035. We found a significant decrease of approximately 59% of whole grain intake in the Chinese population from 1997 to 2011. Compared with 1997, insufficient intake of whole grains was responsible for 9940 more cases of breast cancer, 12,903 more cases of colorectal cancer and 434 more cases of pancreatic cancer in 2011. Our projections suggest that if every Chinese would consume 125 g whole grain per day as recommended by the latest Chinese Dietary Guidelines, 0.63% bladder cancer, 8.98% breast cancer, 15.85% colorectal cancer, 3.86% esophageal cancer, 2.52% liver cancer and 2.22% pancreatic cancer (totaling 186,659 incident cases) could theoretically be averted by 2035. Even if everyone maintained the 2011 whole grain intake level, an estimated 8.38% of cancer events could still be prevented by 2035.

14.
Arch Virol ; 168(12): 292, 2023 Nov 15.
Artigo em Inglês | MEDLINE | ID: mdl-37966521

RESUMO

A novel virus infecting a Paris polyphylla var. yunnanensis plant, tentatively named "Paris polyphylla chlorotic mottle virus" (PpCMV), was discovered in the city of Lijiang, Yunnan Province, China. Its genome consists of 6384 nucleotides (nt), excluding the 3'-terminal poly(A) tail, and contains two open reading frames: ORF1 and ORF2. ORF1 is 6150 nt in length, encoding a large 2050-aa polyprotein with at least two conserved regions encoding a replication-associated protein and a coat protein, the latter of which is located at the 3' end of ORF1. ORF2, consisting of 1185 nt, is located within ORF1 but has a different reading frame. It encodes a 394-aa-long putative movement protein. Phylogenetic analysis based on amino acid sequences revealed that the newly discovered virus exhibited the closest relationship to Hobart betaflexivirus 1 and rhodiola betaflexivirus 1, both of which belong to the genus Capillovirus, sharing 48.8% and 36.5% amino acid sequence identity, respectively, in the structural protein. This is the first report of the complete genome sequence of PpCMV in China.


Assuntos
Ascomicetos , Flexiviridae , Liliaceae , Melanthiaceae , China , Filogenia , Sequência de Aminoácidos , Nucleotídeos , RNA Mensageiro
15.
Nature ; 550(7676): 360-365, 2017 10 19.
Artigo em Inglês | MEDLINE | ID: mdl-28976962

RESUMO

The tumour suppressor complex BRCA1-BARD1 functions in the repair of DNA double-stranded breaks by homologous recombination. During this process, BRCA1-BARD1 facilitates the nucleolytic resection of DNA ends to generate a single-stranded template for the recruitment of another tumour suppressor complex, BRCA2-PALB2, and the recombinase RAD51. Here, by examining purified wild-type and mutant BRCA1-BARD1, we show that both BRCA1 and BARD1 bind DNA and interact with RAD51, and that BRCA1-BARD1 enhances the recombinase activity of RAD51. Mechanistically, BRCA1-BARD1 promotes the assembly of the synaptic complex, an essential intermediate in RAD51-mediated DNA joint formation. We provide evidence that BRCA1 and BARD1 are indispensable for RAD51 stimulation. Notably, BRCA1-BARD1 mutants with weakened RAD51 interactions show compromised DNA joint formation and impaired mediation of homologous recombination and DNA repair in cells. Our results identify a late role of BRCA1-BARD1 in homologous recombination, an attribute of the tumour suppressor complex that could be targeted in cancer therapy.


Assuntos
Proteína BRCA1/metabolismo , Pareamento de Bases , Pareamento Cromossômico , Rad51 Recombinase/metabolismo , Reparo de DNA por Recombinação , Homologia de Sequência do Ácido Nucleico , Proteínas Supressoras de Tumor/metabolismo , Ubiquitina-Proteína Ligases/metabolismo , Sequência de Aminoácidos , Proteína BRCA1/genética , Proteína BRCA2/genética , Proteína BRCA2/metabolismo , Proteína do Grupo de Complementação N da Anemia de Fanconi/genética , Proteína do Grupo de Complementação N da Anemia de Fanconi/metabolismo , Genes BRCA1 , Genes BRCA2 , Humanos , Complexos Multiproteicos/química , Complexos Multiproteicos/genética , Complexos Multiproteicos/metabolismo , Mutação , Ligação Proteica , Rad51 Recombinase/genética , Reparo de DNA por Recombinação/genética , Moldes Genéticos , Proteínas Supressoras de Tumor/química , Proteínas Supressoras de Tumor/genética , Ubiquitina-Proteína Ligases/química , Ubiquitina-Proteína Ligases/genética
16.
Molecules ; 28(10)2023 May 18.
Artigo em Inglês | MEDLINE | ID: mdl-37241919

RESUMO

Graphene oxide (GO) has shown remarkable performance in the multiple-equilibrium-route adsorption (MER) process, which is characterized by further activation of GO through an in-situ reduction process based on single-equilibrium-route adsorption (SER), generating new adsorption sites and achieving an adsorption capacity increase. However, the effect of GO on MER adsorption in lateral size and thickness is still unclear. Here, GO sheets were sonicated for different lengths of time, and the adsorption of MER and SER was investigated at three temperatures to remove the typical cationic dye, acridine orange (AO). After sonication, we found that freshly prepared GO was greatly reduced in lateral size and thickness. In about 30 min, the thickness of GO decreased dramatically from several atomic layers to fewer atomic layers to a single atomic layer, which was completely stripped off; after that, the monolayer lateral size reduction dominated until it remained constant. Surface functional sites, such as hydroxyl groups, showed little change in the experiments. However, GO mainly reduces the C=O and C-O bonds in MER, except for the conjugated carbon backbone (C-C). The SER adsorption kinetics of all temperatures fitted the pseudo-first-order and pseudo-second-order models, yet room temperature preferred the latter. An overall adsorption enhancement appeared as sonication time, but the equilibrium capacity of SER GO generally increased with thickness and decreased with the single-layer lateral size, while MER GO conversed concerning the thickness. The escalated temperature facilitated the exfoliation of GO regarding the adsorption mechanism. Thus, the isotherm behaviors of the SER GO changed from the Freundlich model to Langmuir as size and temperature changed, while the MER GO were all of the Freundlich. A record capacity of ~4.3 g of AO per gram of GO was obtained from the MER adsorption with a sixty-minute ultrasonicated GO at 313.15 K. This work promises a cornerstone for MER adsorption with GO as an adsorbent.

17.
J Clin Nurs ; 31(5-6): 623-632, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-34296490

RESUMO

AIM: To evaluate the dynamic changes in tracheal cuff pressure before and after four clinical nursing procedures including sputum suction, oral care, atomisation inhalation, and turning over, and thus provide references for the adjustment time of cuff pressure in clinical practice. BACKGROUND: Cuff pressure must be kept within the range of 25-30 cmH2 O to ensure effective ventilation and prevent aspiration, while maintaining tracheal blood flow perfusion. DESIGN: A prospective observational study. METHODS: The cuff pressure of 56 intubated patients was adjusted to 28-30 cmH2 O. A cuff pressure monitor was used to continuously monitor cuff pressure changes before and after four clinical nursing procedures (sputum suction, oral care, atomisation inhalation, and turning over) and the cuff pressures at various time points were compared. The semi-quantitative cough strength score (SCSS) was used to evaluate cough strength during sputum suction and the effect of cough strength on cuff pressure during sputum suction. This study followed the STROBE checklist for cross-sectional studies. RESULTS: The cuff pressures during the four clinical nursing procedures of sputum suction, atomisation inhalation, turning over, and oral care, all temporarily increased (p < 0.001) and decreased to varying degrees 20 min later (p < 0.001). Among them, the cuff pressure rose the highest under a state of moderate or strong coughing during sputum suction (78.38 ± 12.13 cmH2 O) and dropped the most at 20 min after the procedure (21.71 ± 4.80 cmH2 O). CONCLUSIONS: The four clinical nursing procedures of sputum suction, atomisation inhalation, turning over, and oral care can all cause different degrees of cuff pressure drop. The decision on whether the cuff pressure needs to be corrected depends on the specific situation. RELEVANCE TO CLINICAL PRACTICE: During clinical practice, the cuff pressure can be individually corrected according to different clinical nursing procedures, which can increase the qualified rate of cuff pressure and reduce the workload of nurses.


Assuntos
Tosse , Intubação Intratraqueal , Estudos Transversais , Humanos , Pressão , Sucção
18.
J Clin Monit Comput ; 36(2): 521-528, 2022 04.
Artigo em Inglês | MEDLINE | ID: mdl-33709233

RESUMO

To evaluate the effect of different inflation volume on the measurement accuracy of the modified cuff pressure measurement method in different shapes of cuffs, so as to provide reference for the correct monitoring of cuff pressure in clinic. In vitro study: The traditional cuff pressure measurement method (the cuff pressure gauge before measurement shows 0 cm H2O) and the modified cuff pressure measurement method (the cuff pressure before measurement shows 25 cm H2O, 28 cm H2O, 30 cm H2O or 32 cm H2O) were used to measure cylindrical and tapered cuffs, and the effect of different inflation volume on cuff pressure was analyzed statistically. Clinical study: patients with the artificial airway established by orotracheal intubation or tracheotomy in Neuro-ICU were prospectively selected as subjects, and the measurement procedure was the same as in vitro study. In vitro study showed that the pressure loss values of cylindrical cuff and tapered cuff using the traditional cuff pressure measurement method were (3.75 ± 0.31) cm H2O and (4.92 ± 0.44) cm H2O, respectively, and clinical study showed that the pressure loss values were (5.07 ± 0.83) cm H2O and (5.17 ± 0.93) cm H2O, respectively. The actual measured values measured by the traditional cuff pressure measurement method of the two cuff shapes were compared with the corrected target value of 28 cm H2O, and the differences were statistically significant (P < 0.000). Both in vitro and clinical study had shown that all differences between the actual measured value and the corrected target value using the modified cuff pressure measurement method (measured with 25 cm H2O, 30 cm H2O, 32 cm H2O) were statistically significant (P < 0.000), and the range of overall differences was (0-1.23 ± 0.25) cm H2O. In vitro study had shown that the pressure variation coefficient (CV) of the tapered cuff was greater than that of the cylindrical cuff, and the difference was statistically significant (3.08 ± 0.25 VS 2.41 ± 0.21, P < 0.000). The traditional cuff pressure measurement method can directly lead to the cuff pressure drop, which is easy to cause the leakage of secretions on the cuffs and the misjudgment of the cuff pressure by medical personnel. However, the modified cuff pressure measurement method can effectively reduce cuff pressure loss, and taking the actual cuff pressure value as the inflation volume is the highest measurement accuracy.The tapered cuff is more susceptible to air volume, so it is necessary to pay attention to its measurement and correction in clinical practice.


Assuntos
Intubação Intratraqueal , Humanos , Pressão
19.
Int J Mol Sci ; 24(1)2022 Dec 24.
Artigo em Inglês | MEDLINE | ID: mdl-36613767

RESUMO

(1) Transfer RNA (tRNA)-derived fragments (tRFs) are a new category of regulatory non-coding RNAs with distinct biological functions in cancer. They are produced from pre-tRNAs or mature tRNAs and their sequences are relatively short; thus, the amplification of tRFs, especially those in body fluids, is faced with certain technical difficulties. In this study, we established a quantitative method to detect plasma tRF-27-87R8WP9N1E5 (tRF-27) and used it to screen gastric cancer patients. (2) A specific stem-loop-structure reverse transcription primer, a TaqMan probe, and amplification primers for tRF-27 were prepared, and the absolute quantitative method was used to measure plasma tRF-27 levels. To determine the noninvasive diagnostic value of tRF-27 in gastric cancer, plasma tRF-27 levels in patients with benign and malignant lesions (120 healthy individuals, 48 patients with benign lesions, 48 patients with precancerous lesions, and 72 patients with early gastric cancer) were analyzed. Plasma tRF-27 levels were also analyzed in 106 preoperative gastric cancer patients, 106 postoperative gastric cancer patients, and 120 healthy individuals. Survival curves and Cox regression models were established and analyzed. (3) A new absolute quantitative method to determine the plasma tRF-27 copy number was established. Plasma tRF-27 levels were significantly increased in gastric cancer patients compared to healthy individuals, and the area under the receiver operating characteristic curve was 0.7767, when the cutoff value was 724,807 copies/mL, with sensitivity and specificity values of 0.6226 and 0.8917, respectively. The positive predictive and negative predictive values were 83.50% and 72.80%, respectively. Plasma tRF-27 levels in postoperative gastric cancer patients were significantly decreased compared to preoperative gastric cancer patients and tended to the levels of healthy individuals. Moreover, tRF-27 levels were closely related to tumor size and Ki67 expression in gastric cancer patients. Prognostic analysis showed that tRF-27 may be an independent predictor of overall survival. (4) This novel and non-invasive method of measuring plasma tRF-27 levels was valuable in the early diagnosis of gastric cancer.


Assuntos
Neoplasias Gástricas , Humanos , Neoplasias Gástricas/diagnóstico , Neoplasias Gástricas/genética , RNA de Transferência/genética , Transcrição Reversa
20.
Molecules ; 27(17)2022 Sep 03.
Artigo em Inglês | MEDLINE | ID: mdl-36080458

RESUMO

Bacillus Calmette-Guérin polysaccharide and nucleic acid (BCG-PSN), extracted from Mycobacterium bovis, is an immunoregulatory medicine commonly used in clinic. However, the structural characteristics and potential pharmacological efficacy of the polysaccharides from BCG-PSN remain unclear. Herein, two polysaccharides (BCG-1 and BCG-2) were purified and their structures were characterized. Monosaccharide composition analysis combined with methylation analysis and NMR data indicated that BCG-1 and BCG-2 were an α-D-(1→4)-mannan with (1→2)-linked branches, and an α-D-(1→4)-glucan with (1→6)-linked branches, respectively. Herein, the mannan from BCG-PSN was first reported. Bioactivity assays showed that BCG-1 and BCG-2 dose-dependently and potently increased the production of inflammatory mediators (NO, TNF-α, IL-6, IL-1ß, and IL-10), as well as their mRNA expressions in RAW264.7 cells; both have similar or stronger effects compared with BCG-PSN injection. These data suggest that BCG-1 and BCG-2 are very likely the active ingredients of BCG-PSN.


Assuntos
Mycobacterium bovis , Adjuvantes Imunológicos , Vacina BCG , Mananas/farmacologia , Mycobacterium bovis/química , Polissacarídeos/farmacologia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA