First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi.

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 µm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 µm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 µm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

Four country healthcare associated infection prevalence survey 2006: risk factor analysis.

Point prevalence surveys are useful in detecting changes in the pattern of healthcare-associated infection (HCAI). In 2004 the Hospital Infection Society was asked to conduct a third national prevalence survey, which included England, Wales, Northern Ireland and the Republic of Ireland. A similar but not identical survey was carried out in Scotland. Data were collected on standardised forms using Centres for Disease Control and Prevention definitions. This report considers associations with a wide range of risk factors for all HCAI and for four main categories. The overall prevalence rate of HCAI was 7.6% and increased significantly with age. All risk factors considered were associated with highly significantly increased risk of HCAI, except recent peripheral IV catheter and other bladder instrumentation use. Primary bloodstream infection (PBSI) was associated with antibiotic, central intravenous catheter and parenteral nutrition use. Pneumonia was associated with antibiotic, central catheter, parenteral nutrition use, mechanical ventilation and current peripheral catheter use. Surgical site infection was associated with recent surgery, antibiotic and central catheter use, mechanical ventilation and parenteral nutrition. Urinary instrumentation and antibiotic use were associated with urinary tract infection. Patients under a critical care medicine consultant had the highest prevalence of HCAI (23.2%). This report highlights those areas requiring attention to prevent HCAI, i.e. device-related infections such as PBSI (e.g. central catheters) and pneumonia (e.g. mechanical ventilation) and should influence protocols for future prevalence surveys of HCAI, e.g. the recording of risk factors at the time of assessment only is sufficient.

Four country healthcare associated infection prevalence survey 2006: overview of the results.

A survey of adult patients was conducted in February 2006 to May 2006 in acute hospitals across England, Wales, Northern Ireland and the Republic of Ireland to estimate the prevalence of healthcare-associated infections (HCAIs). A total of 75 694 patients were surveyed; 5743 of these had HCAIs, giving a prevalence of 7.59% (95% confidence interval: 7.40-7.78). HCAI prevalence in England was 8.19%, in Wales 6.35%, in Northern Ireland 5.43% and in the Republic of Ireland 4.89%. The most common HCAI system infections were gastrointestinal (20.6% of all HCAI), urinary tract (19.9%), surgical site (14.5%), pneumonia (14.1%), skin and soft tissue (10.4%) and primary bloodstream (7.0%). Prevalence of MRSA was 1.15% with MRSA being the causative organism in 15.8% of all system infections. Prevalence of Clostridium difficile was 1.21%. This was the largest HCAI prevalence survey ever performed in the four countries. The methodology and organisation used is a template for future HCAI surveillance initiatives, nationally, locally or at unit level. Information obtained from this survey will contribute to the prioritisation of resources and help to inform Departments of Health, hospitals and other relevant bodies in the continuing effort to reduce HCAI.

Importance of environmental decontamination--a critical view.

The level of evidence supporting different disinfection and cleaning procedures performed in healthcare settings worldwide is low. With respect to environmental surfaces, the final assessment of whether use of disinfectants rather than detergents alone reduces nosocomial infection rates in different clinical settings still awaits conclusive study. It must be kept in mind that the effect of surface disinfection is only transient microbial contamination will have reached its former level within a few hours. While resistance to biocides is generally not judged to be as critical as antibiotic resistance, scientific data support the need for proper use, i.e. avoidance of widespread application, especially in low concentrations and in consumer products. The decontamination ability of the substances used; prevention of resistance; and safety for patients, personnel and the environment; are the cornerstones that interact with each other. Future work should focus on this complex background. Targeted disinfection of environmental surfaces (those frequently touched) is an established component of infection control activities to prevent the spread of nosocomial (multi-resistant) pathogens, but of lesser importance than proper hand hygiene. However, since the use of disinfectants may pose a danger to staff, patients and the environment, prudent use combined with the application of proven safety precautions is important. Since emerging resistant pathogens will challenge healthcare facilities in future even more than today, well-designed studies addressing the role of disinfection in the healthcare-setting are needed.

Instrumental learning, but not performance, requires dopamine D1-receptor activation in the amygdala.

Substantial experimental evidence exists suggesting a critical role for dopamine in reinforcer-related processes, such as learning and drug addiction. Dopamine receptors, and in particular D1 receptors, are widely considered as modulators of synaptic plasticity. The amygdala contains both dopamine terminals and dopamine D1 receptors and is intimately involved in motivation and learning. However, little is known about the involvement of D1 receptor activation in two subnuclei of the mammalian amygdala, the central nucleus and basolateral complex in instrumental learning. Following recovery from surgery and preliminary training, rats with bilateral indwelling cannulae aimed at the central nucleus or basolateral complex were trained to lever-press for sucrose pellets over 12 sessions. Infusion of the selective D1 antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine hydrochloride (0.3 nmol and 3.0 nmol) prior to the first five training sessions dose-dependently impaired instrumental learning when compared with vehicle-infused controls. All rats were then exposed to five sessions drug-free; lever-pressing quickly reached equal levels across groups. A drug infusion prior to an 11th session revealed no effect on performance. Control experiments indicated that basic motivational processes and general motor responses were intact, such as spontaneous feeding and locomotor activity. These results show an essential role for D1-receptor activation in both the central nucleus and basolateral complex on the acquisition of lever pressing for sucrose pellets in rats, but not the performance of the behavior once conditioned. We propose that instrumental learning is dependent on plasticity in the central nucleus and basolateral complex amygdala, and that D1 receptor activation participates in transcriptional processes that underlie this plasticity.

Bacillus anthracis.

The events of 11 September 2001 and the subsequent anthrax outbreaks have shown that the West needs to be prepared for an increasing number of terrorist attacks, which may include the use of biological warfare. Bacillus anthracis has long been considered a potential biological warfare agent, and this review will discuss the history of its use as such. It will also cover the biology of this organism and the clinical features of the three disease forms that it can produce: cutaneous, gastrointestinal, and inhalation anthrax. In addition, treatment and vaccination strategies will be reviewed.

Automated methods for identification of bacteria from clinical specimens.

Automated methods for measuring enzyme activities of bacterial suspensions in saline are described. The methods were applied to bacteria cultured from urine specimens, and specific enzyme profiles characteristic for Escherichia coli, Klebsiella sp, Proteus sp, and Pseudomonas sp were established. Identification of 294 freshly isolated strains by automated and conventional methods were compared. Results from automated identification based on eight enzyme tests and assay of protein content, all performed on a bacterial suspension made from one colony in 1 ml of saline, agreed 100% with those obtained by conventional methods. Identification was achieved in 6 hours.

Use of Counter and rocket immunoelectrophoresis in acute respiratory infections due to Streptococcus pneumoniae.

The use of Counter immunoelectrophoresis (CIE) for the detection of pneumococcal capsular antigen in the sputum and serum of patients suffering from acute respiratory infections is described. The CIE of sputum gave positive results in 224 (99%) out of 225 samples in which Streptococcus pneumoniae was isolated by cultural techniques, and in 23 (9%) out of 262 samples in which no or other potential pathogens had been isolated. In the detection of capsular antigen in serum, CIE was positive in 32 (35%) out of 92 pneumonia cases and was associated with an increase in mortality.

Laboratory contamination of blood cultures.

A prospective study of the use of a laminar flow cabinet, an exhaust-ventilated safety hood, and the open bench for the microbiological examination of blood is described. Blood samples from 1600 patients were subcultured on the open bench, 2700 in a safety hood, and 2607 in a laminar flow cabinet. Use of the laminar flow cabinet produced a significantly greater level of contamination than the other methods, and it is concluded that the exhaust-ventilated safety hood should be used for this procedure.

Evaluation of six screening methods for detecting significant bacteriuria.

Six screening methods for the successful detection of significant bacteriuria--electrical impedance (Malthus), automated acridine-orange staining (Autotrak), particle counting (Ramus), bioluminescence, nitrite and leucocyte test strip (BM Nephur), and microscopy--were evaluated. All had excellent predictive values for a negative result (97%-100%) but were less accurate in predicting a positive result (31%-83%). All methods had high sensitivities (83%-100%) but lower levels of specificity (68%-79%). Bioluminescence was the method with the highest specificity (79%) and the lowest rate of false positive results (15%). It would be inappropriate to decide on treatment and management on the basis of the positive results achieved with any of the methods evaluated, but all methods tested could be used for screening out negative results.

Effect of temperature on antimicrobial susceptibilities of Pseudomonas maltophilia.

After a case of peritonitis caused by Pseudomonas maltophilia had occurred 20 strains of the organism were investigated and the minimum inhibitory concentrations of a variety of antibiotics determined at 30 degrees C and 37 degrees C. There was a significant difference in susceptibility between 30 degrees C (most resistant) and 37 degrees C (most susceptible) for aminoglycosides and polymyxin B. No difference was seen with the other agents or in strains of Ps aeruginosa and Enterobacteriaceae tested under similar conditions. The possible mechanisms of this phenomenon are discussed below.

Identifying non-capsulate strains of Streptococcus pneumoniae isolated from eyes.

Over six months 10 biochemically and physiologically atypical strains of Streptococcus pneumoniae were isolated from eye swabs. Conventional methodology showed that these strains possessed characteristics of both S pneumoniae and other alpha haemolytic streptococci. The use of sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) enabled us to characterise these strains as S pneumoniae. Loss of the capsule seemed to be associated with atypical biochemical properties.

Terminal subculture of blood cultures using a multipoint inoculator device.

A multipoint inoculation method was used for the terminal subculture of blood cultures. This economical yet reliable technique successfully isolated important human pathogens such as Haemophilus influenzae from macroscopically negative blood cultures.

Aeromonas spp as a potential cause of diarrhoea in children.

AIMS: To determine the prevalence of Aeromonas spp in the faeces of children and the association with symptoms of gastroenteritis. METHODS: Faecal specimens (n = 1026) were cultured for Aeromonas spp using three selective media and an enrichment broth at both 30 degrees C and 37 degrees C. The isolation of Aeromonas spp was correlated with symptoms of gastroenteritis, previous antibiotic use, and environmental temperature. RESULTS: Aeromonas spp (n = 28) from 26 (2.5%) patients were recovered. Bile salt, Irgasan, and brilliant green agar was the most efficient selective culture medium. Eleven of the patients had symptoms of gastroenteritis, usually mild diarrhoea of two to three days' duration, in the absence of other recognised enteropathogens. A caviae was a particularly frequent isolate (nine out of 11 cases) in symptomatic individuals. Only one out of seven Aeromonas spp recovered by enrichment culture alone was possibly associated with symptoms of gastroenteritis. There was a close correlation between the environmental temperature and isolation of Aeromonas spp. CONCLUSIONS: Aeromonas spp and particularly A caviae may cause gastroenteritis in children, most often during warmer months of the year. Culture for these potential enteropathogens could be confined to summer and autumn months. Bile salt, Irgasan, and brilliant green selective agar, but not alkaline peptone water enrichment, is an efficient culture medium for recovering possibly clinically important isolates.

Pseudomembranous colitis associated with changes in an ileal conduit.

A case of antibiotic associated pseudomembranous colitis following total cystectomy is reported, in which there was involvement of the ileal conduit. The small bowel remaining in situ was uninvolved. Bacteriological studies revealed Clostridium difficile and the toxin in both colon and ileal conduit. Relevant publications concerning pathogenesis are discussed, in relation to the unusual site described in this case. Epidemiological evidence is reviewed which suggests that isolation of patients with pseudomembranous colitis is a logical course of action.

Evaluation of Malthus 128H microbiological growth analyser for detecting significant bacteriuria.

In a pilot study a prototype Malthus 128H microbiological growth analyser was used to study the growth of six commonly encountered urinary pathogens in a range of five different laboratory media. No single medium had been able to show acceptable conductance changes for all bacteria within five hours. Subsequently, the Malthus system, with fastidious anaerobe broth as the culture medium, was used to screen 500 consecutive clinical specimens of urine for significant bacteriuria. After two and a half hours the Malthus system detected 32 out of the 40 true positives and eight of the 44 contaminated urines. Increasing the detection time to five hours permitted the recognition of 39 true positives and 37 contaminated urines.

Documentation of blood culture results.

AIMS: To evaluate the adequacy of documentation of blood culture results in patients' medical notes. METHODS: A pro-forma was completed following review of medical notes at 24 and 48 hours after a blood culture had been reported as positive. The study was performed on blood cultures received at the Department of Microbiology, Royal Hallamshire Hospital, Sheffield, from two local hospitals. Two periods were studied: (A) May to June 1993 and (B) September to October 1993. RESULTS: There were 43 results studied in period A and 79 in period B, giving a total of 122 results studied. Overall, 72 (59%) of 122 results were recorded in the medical notes at 24 hours. Of those results deemed highly significant, 40 (63%) of 63 were recorded. There was no significant difference in the documentation of results if the result was given personally or via the telephone. Nor was there any difference in documentation between different medical grades. Throughout the study there were six inaccurate records. The cumulative documentation over 48 hours of positive results was 54 (86%) of 63 of highly significant, 27 (69%) of 39 of uncertain significance, and 11 (55%) of 20 probable contaminant results. CONCLUSIONS: Documentation of blood culture results is currently suboptimal.

Phenotypic methods for speciating clinical Aeromonas isolates.

AIMS: To establish the suitability of currently available phenotypic methods for speciation of clinical Aeromonas isolates in diagnostic microbiology laboratories. METHODS: Using 62 Aeromonas spp, three schemes based on biochemical reactions were compared: a series of conventional tests; a system based on the suicide phenomenon, comprising two tubes in total; and a commercially available test, API 20 NE, augmented with a plate assay for beta haemolysin production. The whole cell and outer membrane protein (OMP) profiles of strains were examined by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS PAGE), according to the results of the above schemes, to determine the intra-species homogeneity. RESULTS: Ninety per cent of strains were identified satisfactorily according to conventional criteria. For these strains, agreement was obtained using the suicide phenomenon and API schemes in 93% and 88% of cases, respectively. The three schemes concurred for 82% of strains. Whole cell protein profiles were unsuitable for comparing strains within a species. However, OMP patterns were similar for 89% of A caviae and 63% of A hydrophila. CONCLUSION: Phenospeciation of clinical Aeromonas isolates by the scheme based on the suicide phenomenon is simple to perform and accurate, and suitable for use in the diagnostic laboratory. OMP profiles are potentially useful for confirming the identity of A caviae and most A hydrophila, but not A sobria.

Comparison of techniques for antimicrobial susceptibility testing of mycobacteria.

AIMS: To evaluate adenosine triphosphate (ATP) bioluminescence as a rapid technique for antimicrobial susceptibility testing of Mycobacterium spp by comparing it with conventional and radiometric methods, and to assess its potential for use in clinical microbiology laboratories. METHODS: 115 clinical isolates from a wide range of mycobacterial species and four control organisms of known susceptibility were tested against six antimicrobial agents. Minimum inhibitory concentrations (MICs) were determined after 4-6 weeks' incubation on Middlebrook 7H10 agar. Susceptibility was also determined radiometrically using a Bactec 460, and by bioluminescent assay of ATP using a 1250 luminometer (LKB-Wallac). RESULTS: Susceptibility results after 7 days showed excellent correlation with conventionally determined MICs. 714 susceptibility tests were performed by both techniques, with seven major discrepancies between the two systems. For pyrazinamide, agreement was 100%, but five strains of M tuberculosis, including one control, and 11 mycobacteria other than M tuberculosis (MOTT) failed to grow on Middlebrook agar at pH 5.5. 606 tests were performed by radiometry, with four major discrepancies between this technique and ATP bioluminescence. No particular species of Mycobacterium gave aberrant results. Contamination was a problem; 12 of the 119 strains tested were contaminated at day 1 and had to be repeated before results were obtained. Contamination of individual tests increased significantly after 7 days of incubation. CONCLUSIONS: ATP bioluminescence can be used to monitor mycobacterial growth in fluid culture media; the technique has considerable potential for rapid susceptibility testing. Advantages include lower initial cost of analytical equipment, lower reagent cost per test, and the use of non-radioactive substrates.

Epidemiology of infection in ICUs.

Patients admitted to ICUs are at the greatest risk of acquiring nosocomial infections, partly because of their serious underlying disease, but also by exposure to life-saving invasive procedures. Nosocomial infections increase patient morbidity, increase the length of hospital stay and hospital costs, and may increase mortality rates. When serious infections are suspected, treatment must be commenced immediately to increase the likelihood of a satisfactory outcome for the patient. Empirical knowledge, to select appropriate antibiotics, must be used so that the most likely infecting organisms are treated. In the past this has meant that antibiotics with activity against Gram-negative pathogens were most likely to be selected. However, infections where Gram-positive pathogens are responsible (e.g. Staphylococcus aureus, Staphylococcus epidermidis and enterococci) are increasingly being found. The European Prevalence of Infection in Intensive Care Study (EPIC), the largest point-prevalence study of infection in ICUs in Western Europe was carried out on 28 April 1992. Data on 10,038 patients in 1417 adult ICU departments from 17 countries was collected and analysed. Of the ICU patients surveyed, 21% had at least one infection acquired in an ICU. The most common infections acquired in an ICU were pneumonia (47%), other infections of the lower respiratory tract (18%), infections of the urinary tract (18%) and infections of the blood-stream (12%). The bacterial isolates were equally divided between Gram-negative and Gram-positive species. The commonly reported bacteria were Enterobacteriaceae (34%), S. aureus (30%), Pseudomonas aeruginosa (29%), coagulase-negative staphylococci (19%) and enterococci (12%).