The interaction of Lolium latent virus major coat protein with ankyrin repeat protein NbANKr redirects it to chloroplasts and modulates virus infection.

The Lolium latent virus (LoLV) major coat protein sequence contains a typical chloroplast transit peptide (cTP) domain. In infected Nicotiana benthamiana leaf tissue, LoLV coat proteins can be detected at the chloroplast. In transient expression, several N-terminal deletions of the CP sequence, increasing in length, result in disruption of the domain functionality, markedly affecting intracellular localization. A yeast two-hybrid-based study using LoLV CP as bait identified several potentially interacting Arabidopsis host proteins, most of them with chloroplast-linked pathways. One of them, an ankyrin repeat protein, was studied in detail. The N. benthamiana homologue (NbANKr) targets chloroplasts, is able to co-localize with LoLV CP at chloroplast membranes in transient expression and shows a robust interaction with LoLV CP in vivo by BiFC, which has been confirmed by yeast two-hybrid data. Silencing NbANKr genes in N. benthamiana plants, prior to challenging with LoLV by mechanical inoculation, affects LoLV infection, significantly reducing the level of viral RNA in young leaves, compared to levels in control plants, and suggesting an inhibition of virus movement. Silencing of NbANKr has no obvious effect on plant phenotype, but is able to interfere with LoLV infection, opening the way for a new strategy for virus infection control.

First Report of Freesia sneak virus Associated with Foliar Necrosis of Freesia refracta in Bulgaria.

In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage. References: (1) A. A. Brunt. In: Virus and Virus-Like Diseases of Flower Crops, pp. 274-280, Wiley, 1995. (2) M. N. Pearson et al. Austr. Plant Path. 38:305, 2009. (3) A. M. Vaira and R. G Milne. In: Encyclopedia of Virology, III ed., vol. 3, pp. 447-454, Elsevier, 2008. (4) A. M. Vaira et al. Plant Dis. 93:965, 2009.

First Report of Freesia sneak virus in Freesia sp. in Virginia.

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5'-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3' and FreSVf-CP-BamHI 5'-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3', based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

First Report of Freesia sneak virus Infecting Lachenalia Cultivars in South Africa.

Lachenalia (Lachenalia species, family Hyacinthaceae) is a bulbous ornamental plant endemic to southern Africa. In 1998, several lachenalia lines from ARC-Roodeplaat showing virus-like symptoms, and presumed to be infected with Ornithogalum mosaic virus (OrMV), were sent from South Africa under an APHIS permit for examination in Beltsville, MD. In addition to potyvirus-like particles, fine filamentous particles consistent with those of ophioviruses were observed with electron microscopy in some of the plant samples. Ophiovirus virions are filamentous nucleocapsids approximately 3 nm in diameter forming circularized structures of different lengths and are not easily detectable with electron microscopy. A reverse transcription (RT)-PCR assay using genus-specific degenerate primers that yield a 136-bp fragment from the RdRp gene is currently the best tool for detecting ophioviruses (3). Complementary DNA was produced from lachenalia total RNA extracts using either random hexamers or ophiovirus-specific primer OP1 (3). The ophiovirus diagnostic 136-bp fragment was amplified by PCR from plants of five lines (B12, L. unicolor × L. namaquensis, released in South Africa as cv. Rodelein; B24, L. aloides × L. rubida, cv. Robekkie; B48, a complex hybrid of L. aloides, L. rubida, L. orchioides, and L. bulbifera, cv. Leipoldt; B51, a complex hybrid of L. aloides, L. bulbifera, and L. orchioides, cv. Winsome; and B52, an intraspecies cross of L. aloides, cv. Fransie) of the six lines examined. Electron microscopy revealed ophiovirus particles in three of these five lines. The PCR products from three lachenalia lines were sequenced and found to be identical; the deduced 45 amino acid sequence showed 100% identity with the corresponding sequence obtained from Freesia sneak virus (FreSV), a tentative ophiovirus species referred to in the 8th ICTV report as Freesia ophiovirus (4) (for which the name Freesia sneak virus is now proposed). Currently, available sequence information shows only approximately 50 to 70% similarity between ophiovirus species and almost 100% identity between isolates, suggesting that the lachenalia ophiovirus is an isolate of FreSV. Symptoms associated with ophiovirus-infected lachenalias include fine chlorotic streaking and occasional gray flecking; more prominent chlorotic streaking, necrosis, and/or leaf deformation were observed in plants also infected with OrMV, similar potyviruses, and possibly other viruses. No ophiovirus was detected in five lines of Lachenalia hybrids obtained from U.S. commercial sources showing potyvirus-associated foliar chlorotic streaking, including cv. Fransie. Potyviruses were detected by RT-PCR (1) or ELISA with potyvirus-specific monoclonal antibodies (2) in plants from the United States and South Africa. It is of interest that the known hosts of FreSV, freesia and lachenalia, are both ornamental monocot genera of South African origin. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:25, 1991. (3) A. M. Vaira et al. Arch. Virol. 148:1037, 2003. (4) A. M. Vaira et al. Pages 673-679 in: Virus Taxonomy: 8th Report of the ICTV, 2005.

Opposite effect of tumor necrosis factor alpha on granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor-dependent growth of normal and leukemic hemopoietic progenitors.

The effect of recombinant human tumor necrosis factor alpha (TNF-alpha) on normal and chronic myeloid leukemia granulocyte-macrophage progenitors (CFU-GM) growing in semisolid agar cultures in the presence of recombinant granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor was studied. Granulocyte-macrophage colony-stimulating factor-dependent growth of normal and chronic myeloid leukemia bone marrow CFU-GM was greatly enhanced by TNF-alpha at doses of 0.1 to 100 units/ml. Growth enhancement included neutrophil, eosinophil, and monocyte-macrophage colonies and clusters at 7 and 14 days of culture. Since similar results were achieved with highly enriched progenitor cell populations, devoid of accessory cells, an indirect effect on CFU-GM growth through the release by accessory cells of other cytokines upon TNF-alpha stimulation was thus ruled out. By contrast, the same doses of TNF-alpha inhibited the growth of normal CFU-GM in granulocyte colony-stimulating factor-dependent cultures. Taken together, our findings indicate that the final effect of TNF-alpha on normal bone marrow granulocyte-macrophage progenitor growth is dependent on the specific growth factor interacting with it, and that both normal and chronic myeloid leukemia CFU-GM are equally responsive to the combined effects of TNF-alpha and a given colony-stimulating factor.

Resistance to tospoviruses in Nicotiana benthamiana transformed with the N gene of tomato spotted wilt virus: correlation between transgene expression and protection in primary transformants.

Nicotiana benthamiana was transformed with the nucleoprotein (N) gene of an Italian isolate of tomato spotted wilt virus (TSWV). Forty-five T1 primary transformant lines were analyzed for the expression of N protein and for resistance to TSWV and three other tospoviruses: impatiens necrotic spot virus (INSV), groundnut bud necrosis virus (GBNV), and groundnut ringspot virus (GRSV). Thirteen of these lines were further characterized. Resistance to all TSWV isolates tested was found in two lines. The expression of the transgene (N mRNA) was lower in these resistant lines than in any of the susceptible lines, and the transgene N protein was either absent or present below detectable levels. These lines were susceptible to the other tospoviruses tested, but they developed symptoms milder than controls when inoculated with GRSV. Some of the lines producing high levels of N protein showed delays (of 2-3 weeks) in symptom expression with at least one of the TSWV isolates tested and symptom delay or attenuation with INSV or GRSV (or both). From our results it appears that high expression of TSWV N protein retards, in some cases, disease development by TSWV and INSV. In contrast, the lack of detectable expression of the transgenic N protein, accompanied by limited production of N transcripts, conferred TSWV-specific resistance.

A polyclonal antiserum against a recombinant viral protein combines specificity with versatility.

A polyclonal rabbit antiserum was obtained to the nucleoprotein of tomato spotted wilt tospovirus expressed as a recombinant fusion protein in E. coli. In indirect plate trapping ELISA, the antiserum gave similar titres against purified TSWV nucleocapsids in native form, the fusion protein and the carrier protein. The crude antiserum was also tested by Western blotting, indirect plate trapping ELISA and immunogold electron microscopy of thin sections: purified immunoglobulins were tested by DAS-ELISA. In all cases, with both glasshouse and field material, the antibodies had good detectability and specificity. By ELISA and Western blots against other tospoviruses, impatiens necrotic spot and groundnut bud necrosis viruses did not react but there was a reaction with groundnut ringspot virus, reflecting the nucleoprotein amino acid sequence similarity. These antibodies combine specificity to the target protein and versatility with regard to all the more important serological techniques. There were no undesired reactions resulting from immunization using a complex virus purified from infected host material.

Peptide-derived broad-reacting antisera against tospovirus NSs-protein.

Sequence alignments of tospovirus species of serogroup I to IV revealed a stretch of 24 amino acids at the C terminus of the non-structural protein NSs with a highly conserved sequence. Based on this sequence the 24 amino acids peptide YFLSKTLEVLPKNLQTMSYLDSIQC was synthesized and used to raise antisera in two rabbits. The specificity of the antisera against NSs from infected plants was confirmed with Western blots and by immunogold labelling and electron microscopy. These antisera detected tospovirus isolates of serogroup I to III in antigen-coated plate ELISA and Western blots but failed to detect isolates of serogroup IV. Epitope scanning using overlapping octopeptides composing the peptide suggested that the antisera contained antibodies against two different epitopes. Strongly reacting peptides were found at the C-terminus of the original peptide sequence when probing with one of the antisera. In this part the sequence was homologous to serogroup I, II and III, with all deviations from serogroup IV located here. Additional octopeptides, based on this region, synthesized with sequence modifications back to the serogroup IV sequence in all possible combinations, had low reactivity. However two of the modified peptides with partly restored serogroup IV sequences revealed promising reactivity and could be suitable to raise an antiserum with broader reactivity, including serogroup IV.

Evaluation of resistance in Osteospermum ecklonis (DC.) Norl. plants transgenic for the N protein gene of tomato spotted wilt virus.

The nucleocapsid protein (N) gene of tomato spotted wilt virus (TSWV) was inserted into Osteospermum ecklonis via Agrobacterium tumefaciens leaf strips co-cultivation. Sixteen primary transformant clones of two O. ecklonis genotypes were analysed. Southern blots of restricted genomic DNA demonstrated integration of the transgene and indicated the number of integrated copies. Expression of the transgene was estimated by DAS-ELISA and Western and Northern blotting. Plants were challenged with TSWV inoculation, either mechanically or by the thrips Frankliniella occidentalis; they were then monitored for symptom appearance and tested by TAS-ELISA for infection. Inoculation of the transgenic clones via the natural TSWV vector was more efficient and led to the identification of 1 clone, characterised by multiple transgene integration and no transgene expression, with improved resistance to TSWV.

First Report of Anemone Plants Infected by Ranunculus white mottle virus.

Ranunculus white mottle virus (RWMV) (1), genus Ophiovirus, has been reported in crops of several cultivars of commercial ranunculus (Ranunculus asiaticus hybrids) during the 1990s in Liguria in Northwest Italy. Symptoms associated with RWMV in ranunculus are not clear-cut owing to the presence of mixed viral infections. During autumn 1999, a severe disease in commercial crops of anemone (Anemone coronaria) was noted in the same area. Plants appeared stunted with young leaves showing curling, deformation, and necrotic spotting. Disease incidence in some fields reached 40 to 50%. DAS- and TAS-enzyme-linked immunosorbent assays (ELISAs) for presence of RWMV and for the viruses most frequently infecting anemone in Italy were run on 24 field samples. Seven proved to be infected by RWMV in mixed infection with Cucumber mosaic virus subgroup II or with Tobacco necrosis virus. Ophiovirus-like particles were detected by negative staining and electron microscopy from sap extracts of field plants that were RWMV-positive by ELISA. Sap from these plants was also mechanically inoculated to indicator plants. Total RNAs were extracted from RWMV-infected field samples and from inoculated Nicotiana benthamiana and N. clevelandii and used in molecular tests. A DIG-DNA probe targeting the 1.8-kb RNA2 of RWMV was used in Northern blots and dot blots of total RNAs, confirming the infection in field samples and multiplication of the virus in test plants, unfortunately still in mixed infection. At present, it is difficult to evaluate RWMV symptomatology in anemone, but the presence of this virus in mixed infection seems to produce serious effects. This is the first report of RWMV in anemone. Reference: (1) A. M. Vaira et al. Arch. Virol. 142:2131, 1997.

First Report of Tomato chlorosis virus in Italy.

During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato. Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.

Cucurbit yellow stunting disorder virus (Genus Crinivirus) Associated with the Yellowing Disease of Cucurbit Crops in Portugal.

During autumn 1998, chlorotic mottling, yellowing, and stunting symptoms were observed on cucumber (Cucumis sativus L.) plants in an experimental plot, in Algarve, southern Portugal. The first symptoms appeared 3 weeks after planting, associated with a heavy infestation of Bemisia tabaci (Gennadius). Plants affected early produced few and small fruits. Analysis of double-stranded RNA (dsRNA) extracted from symptomatic cucumber leaves revealed the presence of two dsRNAs of about 8 and 9 kbp, not present in healthy cucumber plants. Reverse-transcription polymerase chain reaction (RT-PCR) using dsRNA or total RNA extracts as template and the oligonucleotide primers 410L and 410U (1), specifically amplified a fragment of expected size of the HSP70-homolog gene of Cucurbit yellow stunting disorder virus (CYSDV). The RT-PCR-amplified fragment was sequenced (Acc. No. AF287474) and showed 99% sequence identities with the corresponding sequences (GenBank accessions AJ223619 and U67170) from two CYSDV isolates belonging to group I (2), confirming CYSDV detection. CYSDV was also detected in samples of cucumber, melon (Cucumis melo L.) and watermelon (Citrullus lanatus [Thunb.] Matsun.) collected during the summer of 1999 in commercial greenhouses. CYSDV is an emerging and important virus of cucurbits in the Middle East and Mediterranean Europe (2). This is the first report of CYSDV infecting cucurbit crops in Portugal. References: (1) A. Célix et al. Phytopathology 86:1370, 1996. (2) L. Rubio et al. Phytopathology 89:707, 1999.

First Report of Tomato infectious chlorosis virus in Spain.

During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Using non-radioactive probes on plants: a few examples.

Due to costs in using and disposing of radiochemicals and to health considerations, we have been developing applications which include non-isotopic detection of DNA and proteins using chemiluminescence. Our major interests are in the detection of viral nucleic acids and in the analysis of transgenic plants. Generally, probes were labelled with digoxigenin, either by the random priming method or by PCR, and then detected with CSPD or CDP-Star. We routinely use a tissue blotting protocol for diagnosing TYLCV, a plant virus becoming a post in the Mediterranean region. Test results were comparable with those using the same radiolabelled probe. When total nucleic acids are extracted from the plant samples and used in dot-blot or Southern blot assays, viral DNAs are promptly detected by chemiluminescence. In transgenic plants, chemiluminescence was used to detect the transgene on genomic Southern blots, the transgenic mRNAs on Northern blots, and the transgenic protein on Western blots. In Southern and Northern blots, the quality of the results obtained was usually satisfactory, but not as good as with a radiolabelled probe, the main problem being the signal-to-background ratio. Our goal is now to improve the quality of results in demanding applications such as genomic Southern blots, by reducing the background on membranes.

Amino acids in the capsid protein of tomato yellow leaf curl virus that are crucial for systemic infection, particle formation, and insect transmission.

A functional capsid protein (CP) is essential for host plant infection and insect transmission in monopartite geminiviruses. We studied two defective genomic DNAs of tomato yellow leaf curl virus (TYLCV), Sic and SicRcv. Sic, cloned from a field-infected tomato, was not infectious, whereas SicRcv, which spontaneously originated from Sic, was infectious but not whitefly transmissible. A single amino acid change in the CP was found to be responsible for restoring infectivity. When the amino acid sequences of the CPs of Sic and SicRcv were compared with that of a closely related wild-type virus (TYLCV-Sar), differences were found in the following positions: 129 (P in Sic and SicRcv, Q in Sar), 134 (Q in Sic and Sar, H in SicRcv) and 152 (E in Sic and SicRcv, D in Sar). We constructed TYLCV-Sar variants containing the eight possible amino acid combinations in those three positions and tested them for infectivity and transmissibility. QQD, QQE, QHD, and QHE had a wild-type phenotype, whereas PHD and PHE were infectious but nontransmissible. PQD and PQE mutants were not infectious; however, they replicated and accumulated CP, but not virions, in Nicotiana benthamiana leaf discs. The Q129P replacement is a nonconservative change, which may drastically alter the secondary structure of the CP and affect its ability to form the capsid. The additional Q134H change, however, appeared to compensate for the structural modification. Sequence comparisons among whitefly-transmitted geminiviruses in terms of the CP region studied showed that combinations other than QQD are present in several cases, but never with a P129.

An Ophiovirus isolated from lettuce with big-vein symptoms.

Big-vein is a widespread and damaging disease of lettuce, transmitted through soil by the chytrid fungus Olpidium brassicae, and generally supposed to be caused by Lettuce big-vein virus (LBVV; genus Varicosavirus). This virus is reported to have rigid rod-shaped particles, a divided double-stranded RNA genome, and one capsid protein of 48 kD, but has not been isolated or rigorously shown to cause the disease. We provide evidence that a totally different virus, here named Mirafiori lettuce virus (MiLV), is also very frequently associated with lettuce showing big-vein symptoms. MiLV was mechanically transmissible from lettuce to Chenopodium quinoa and to several other herbaceous test plants. The virus was partially purified, and an antiserum prepared, which did not react with LBVV particles in decoration tests. As reported for LBVV, MiLV was labile, soil-transmitted and had a single capsid protein of 48 kD, but the particles morphologically resembled those of ophioviruses, and like these, MiLV had a genome of three RNA segments approximately 8.5, 1.9 and 1.7 kb in size. MiLV preparations reacted strongly in Western blots and in ISEM with antiserum to Tulip mild mottle mosaic virus, an ophiovirus from Japan also apparently Olpidium-transmitted. They reacted weakly but clearly in Western blots with antiserum to Ranunculus white mottle virus, another ophiovirus. When lettuce seedlings were mechanically inoculated with crude or partially purified extracts from MiLV-infected test plants, many became systemically infected with MiLV and some developed big-vein symptoms. Such plants did not react in ELISA using an LBVV antiserum or an antiserum to tobacco stunt virus, and varicosavirus-like particles were never seen in them in the EM after negative staining. We conclude that MiLV is a hitherto undescribed virus assignable to the genus Ophiovirus. The cause or causes of lettuce big-vein disease and the properties of LBVV may need to be re-evaluated in light of our results.

Partial characterization of a new virus from ranunculus with a divided RNA genome and circular supercoiled thread-like particles.

An undescribed virus, here named ranunculus white mottle virus, was isolated in Italy from cultivated ranunculus showing mottle and distortion of leaves. The virus was mechanically transmissible to several herbaceous hosts. In negative stain, the particles appeared as circularised supercoiled threads 3 nm in diameter of different contour lengths; in some conditions the circles collapsed to form linear pseudobranched structures 9 nm in diameter. Immunolabeling of thin sections showed that viral antigen was widely distributed in the cytoplasm of parenchyma cells. The virus was not serologically related to the morphologically similar tenuiviruses, citrus psorosis-ringspot virus and tulip mild mottle mosaic virus. A major 43 kDa protein was present in purified preparations and in infected plant tissue, as also was a minor 28 kDa protein, serologically related to the major one. Nucleic acids extracted from purified particles consisted of at least three RNAs, of approximately 7.5, 1.8 and 1.5 kb, which appeared partly in single- and partly in double-stranded form. Purified preparations, but not viral RNAs, when mechanically inoculated, were infectious. Host range, tissue tropism, particle morphology and coat protein size place the virus closest to citrus psorosis-ringspot and tulip mild mottle mosaic viruses. These three viruses in turn show similarities with the Tenuiviruses and Bunyaviridae.