RESUMO
The pollen beetle (Meligethes aeneusâ F.) is the most devastating pest of oilseed rape (Brassica napus) and is controlled by pyrethroid insecticides. However, resistance to pyrethroids in Europe is becoming widespread and predominant. Pyrethroids target the voltage-sensitive sodium channel (VSSC), and mutations in VSSC may be responsible for pyrethroid insensitivity. Here, we analysed individual beetles that were resistant to esfenvalerate, a pyrethroid, from 14 populations that were collected from oilseed rape fields in Poland. We screened the VSSC domains that were presumed to directly interact with pyrethroids. We identified 18 heterozygous nucleic acid substitutions, amongst which six caused an amino acid change: N912S, G926S, I936V, R957G, F1538L and E1553G. Our analysis of the three-dimensional structure of these domains in VSSC revealed that some of these changes may slightly influence the protein structure and hence the docking efficiency of esfenvalerate. Therefore, these mutations may impact the susceptibility of the sodium channel to the action of this insecticide.
Assuntos
Besouros/efeitos dos fármacos , Besouros/fisiologia , Proteínas de Insetos/genética , Resistência a Inseticidas/genética , Inseticidas/farmacologia , Piretrinas/farmacologia , Canais de Sódio Disparados por Voltagem/genética , Sequência de Aminoácidos , Substituição de Aminoácidos , Animais , Besouros/genética , Proteínas de Insetos/química , Proteínas de Insetos/metabolismo , Simulação de Acoplamento Molecular , Dados de Sequência Molecular , Polônia , Polimorfismo de Nucleotídeo Único , Alinhamento de Sequência , Canais de Sódio Disparados por Voltagem/química , Canais de Sódio Disparados por Voltagem/metabolismoRESUMO
Candida yeasts are saprophytes naturally present in the environment and forming colonies on human mucous membranes and skin. They are opportunistic fungi that cause severe and even fatal infections in immunocompromised individuals. Several essential oils, including eucalyptus, pine, cinnamon and lemon, have been shown to be effective against Candida strains. This study addresses the chemical composition of some commercial lemon essential oils and their antifungal potential against selected Candida yeast strains. Antifungal potential and minimum inhibitory concentrations were determined for six commercial lemon essential oils against five Candida yeast strains (Candida albicans 31, Candida tropicalis 32, Candida glabrata 33, Candida glabrata 35 and Candida glabrata 38). On the basis of the GCMS analysis, it was found that the tested lemon essential oils had different chemical compositions, but mostly, they contained almost exclusively terpenes and oxygenated terpenes. The tests show that antifungal potential of lemon essential oils against Candida yeast strains was related to the high content of monoterpenoids and the type of Candida strains. From six tested commercial oils, only four (ETJA, Vera-Nord, Avicenna-Oil and Aromatic Art) shows antifungal potential against three Candida species (C. albicans, C. tropicalis and C. glabrata). Vera-Nord and Avicenna-Oil show the best activity and effectively inhibit the growth of the C. albicans strain across the full range of the concentrations used. Our study characterises lemon essential oils, which could be used as very effective natural remedies against candidiasis caused by C. albicans.
Assuntos
Antifúngicos/farmacologia , Candida/efeitos dos fármacos , Óleos Voláteis/farmacologia , Óleos de Plantas/farmacologia , Candida/classificação , Candida/crescimento & desenvolvimento , Cromatografia Gasosa-Espectrometria de Massas , Testes de Sensibilidade Microbiana , Monoterpenos/química , Monoterpenos/farmacologiaRESUMO
Spinal anaesthesia is the preferred anaesthetic technique for elective Caesarean deliveries. Hypotension is the most common side-effect and has both maternal and neonatal consequences. Different strategies have been attempted to prevent spinal-induced hypotension, including the use of low-dose bupivacaine. We conducted a systematic search for randomized controlled trials comparing the efficacy of spinal bupivacaine in low dose (LD ≤8 mg) with conventional dose (CD >8 mg) for elective Caesarean delivery. Thirty-five trials were identified for eligibility assessment, 15 were selected for data extraction, and 12 were finally included in the meta-analysis. We investigated sources of heterogeneity, subgroup analysis, and meta-regression for confounding variables (baricity, intrathecal opioids, lateral vs sitting position, uterine exteriorization, and study population). Sensitivity analysis was performed to test the robustness of the results. In the LD group, the need for analgesic supplementation during surgery was significantly higher [risk ratio (RR)=3.76, 95% confidence interval (95% CI)=2.38-5.92] and the number needed to treat for an additional harmful outcome (NNTH) was 4 (95% CI=2-7). Furthermore, the LD group exhibited a lower risk of hypotension (RR=0.78, 95% CI=0.65-0.93) and nausea/vomiting (RR=0.71, 95% CI=0.55-0.93). Conversion to general anaesthesia occurred only in the LD group (two events). Neonatal outcomes (Apgar score, acid-base status) and clinical quality variables (patient satisfaction, surgical conditions) showed non-significant differences between LD and CD. This meta-analysis demonstrates that low-dose bupivacaine in spinal anaesthesia compromises anaesthetic efficacy (risk of analgesic supplementation: high grade of evidence), despite the benefit of lower maternal side-effects (hypotension, nausea/vomiting: moderate grade of evidence).
Assuntos
Anestesia Obstétrica , Raquianestesia , Anestésicos Locais/administração & dosagem , Bupivacaína/administração & dosagem , Cesárea , Adulto , Bupivacaína/efeitos adversos , Feminino , Humanos , Satisfação do Paciente , GravidezRESUMO
NiFe/Cu multilayer films have been electrodeposited potentiostatically on (001)-oriented Si and polycrystalline Cu substrates by a single bath technique. Standard error of mean and energy dispersive X-ray studies of single NiFe(Cu) layers allow us to establish the right deposition parameters for NiFe and Cu sublayer. Standard error of mean results reveal the layered structure of deposits for relatively thick bilayer thickness (ca. approximately 200 nm). The modulated structure of NiFe/Cu multilayers with extremely thin bilayer thickness (nominal period Lambda= 8 nm) was investigated by transmission electron microscope techniques. A columnar structure of the deposit with column diameter in the range from 10 to 30 nm was observed. These results are comparable with X-ray diffraction measurements of crystallites size obtained by Scherer equation. The line scans acquired using EDS confirmed the layered structure of the deposit, but pointed towards possibility of intermixing of species from alternating sublayers especially in case of those with finer period.
RESUMO
Airway anaesthesia using atomised lidocaine for awake oral fibreoptic intubation in morbidly obese patients was evaluated using two doses of local anaesthetic. In this randomised, blinded prospective study, 40 ml of atomised 1% (n = 11) or 2% (n = 10) lidocaine was administered with high oxygen flow as carrier. Outcomes included time for intubation, patient tolerance to airway manipulation, haemodynamic parameters, the bronchoscopist's overall satisfaction, and serial serum lidocaine concentrations. Patients receiving lidocaine 1% had a longer mean (SD) time from the start of topicalisation to tracheal tube cuff inflation than those receiving lidocaine 2% (8.6 (0.9) min vs 6.9 (0.5) min, respectively; p < 0.05). Patients in the 1% cohort demonstrated increased responses to airway manipulation (p < 0.0001), reflecting lower bronchoscopist's satisfaction scores (p < 0.03). Haemodynamic responses to topicalisation and airway manipulation were similar in both groups. Peak plasma concentration was lower in the 1% group (mean (SD) 1.4 (0.3) and 3.8 (0.5) microg.ml(-1), respectively; p < 0.001). Airway anaesthesia using atomised lidocaine for awake oral fibreoptic intubation in the morbidly obese is efficacious, rapid and safe. Compared with lidocaine 1%, the 2% dose provides superior intubating conditions.
Assuntos
Anestésicos Locais/administração & dosagem , Intubação Intratraqueal/métodos , Lidocaína/administração & dosagem , Obesidade Mórbida/cirurgia , Adulto , Anestesia Local/métodos , Anestésicos Locais/sangue , Pressão Sanguínea/efeitos dos fármacos , Relação Dose-Resposta a Droga , Método Duplo-Cego , Feminino , Tecnologia de Fibra Óptica/métodos , Derivação Gástrica , Frequência Cardíaca/efeitos dos fármacos , Humanos , Lidocaína/sangue , Masculino , Pessoa de Meia-Idade , Estudos ProspectivosRESUMO
Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Lódz County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.
RESUMO
The application of supported liquid membrane (SLM) extraction for the enrichment of short peptides is presented. The extraction efficiency is dependent on the pH of donor phase and salt concentration in acceptor phase. Moreover, the extraction efficiency is also influenced by the peptide amino-acid sequence and hydrophobicity.
Assuntos
Peptídeos/química , Bioquímica/métodos , Cátions , Relação Dose-Resposta a Droga , Concentração de Íons de Hidrogênio , Leucina/química , Fenilalanina/química , Sais/farmacologiaRESUMO
The possible application of the supported liquid membrane (SLM) technique for the extraction of glyphosate is presented. For the extraction of this compound the SLM system has been applied with utilisation of Aliquat 336 as a cationic carrier incorporated into the membrane phase. The extraction efficiency of glyphosate [N-(phosphonomethyl)glycine] is dependent on the donor phase pH, carrier concentration in the organic phase and NaCl concentration in the acceptor phase. The optimal extraction conditions are: donor phase pH>11, acceptor phase of 2 M NaCl solution and the organic phase composed of 20% (w/w) Aliquot 336 solution in di-hexyl ether. Counter-coupled transport of chloride anions from the acceptor phase to the donor phase is a driving force of the mass transfer in this system.
Assuntos
Glicina/análogos & derivados , Glicina/isolamento & purificação , Técnicas de Laboratório Clínico , Eletroforese Capilar/métodos , Glicina/química , Herbicidas/química , Herbicidas/isolamento & purificação , Concentração de Íons de Hidrogênio , Membranas , Concentração Osmolar , Compostos de Amônio Quaternário/química , GlifosatoRESUMO
A simple and efficient method for the determination of enantiomeric purity of structurally diverse phosphonic and phosphinic acid analogues of phenylalanine and phenylglycine using capillary electrophoresis is presented. These preliminary studies indicated that the enantiomer separation is strongly dependent on the structure of the aminophosphonic acid.
Assuntos
Aminoácidos/química , Ciclodextrinas/química , Eletroforese Capilar/métodos , Organofosfonatos/química , alfa-CiclodextrinasRESUMO
The influence of the concentration of sodium, lithium, caesium, and potassium ions as well as of the ionic strength of the solutions used on the dismutation rate of ascorbyl radicals has been investigated. While the dismutation rate was not influenced by Li+, it decreased, however, with increasing concentrations of the other ions investigated. The largest effect was obtained with Na+. This change in dismutation rate indicates a stabilizing effect on ascorbyl radical by these ions.
Assuntos
Ácido Ascórbico , Césio , Lítio , Potássio , Sódio , Ascorbato Oxidase , Radicais Livres , Concentração OsmolarRESUMO
Case management and managed care systems are emerging in the 1990s as ways to deliver quality, cost effective patient cae. The essential tool of managed care systems is a critical pathway, which is developed through the collaboration of health care team members. The critical pathway is an abbreviated version of the patients hospital course according to his or her medical diagnosis or case type and it allows health care team members to continually evaluate the patients care. It has helped team members at Johns Hopkins Hospital, Baltimore, identify more effective and cost-efficient ways to deliver patient care.
Assuntos
Ponte de Artéria Coronária , Procedimentos Clínicos/organização & administração , Enfermagem Perioperatória/organização & administração , Idoso , Baltimore , Ponte de Artéria Coronária/enfermagem , Humanos , Masculino , Programas de Assistência Gerenciada , Equipe de Assistência ao Paciente/organização & administraçãoRESUMO
Marfan's syndrome is an inherited, degenerative connective tissue disorder that affects many body systems (eg, skeletal, ocular, cardiovascular, cutaneous, pulmonary, abdominal, neurologic). The cause of Marfan's syndrome is unknown, but recent genetic studies have linked this disorder to chromosome 15q15-q21.3. The characteristics associated with Marfan's syndrome require a multidisciplinary approach to patient care. This article discusses one serious complication of Marfan's syndrome-aortic root dilatation- and composite graft repairs of ascending aortic aneurysms. Physicians and nurses must be more aware of Marfan's syndrome so that life-threatening medical conditions can be evaluated and followed by health care providers.
Assuntos
Aneurisma Aórtico/enfermagem , Aneurisma Aórtico/cirurgia , Próteses Valvulares Cardíacas/enfermagem , Síndrome de Marfan/complicações , Síndrome de Marfan/enfermagem , Enfermagem Perioperatória , Adolescente , Adulto , Aneurisma Aórtico/etiologia , Valva Aórtica/cirurgia , Criança , Feminino , Humanos , Masculino , Síndrome de Marfan/diagnóstico , Planejamento de Assistência ao Paciente , Gravidez , Complicações na GravidezRESUMO
Scrotal sonography was performed on 172 patients treated for infertility ranging 1-10 years. The results of the sonographic examinations were compared with palpations. Pathological deviations were found in 71.5% of patients using sonography and ony 53.5% of patients examined clinically. Our study found varicocele in 55.2% of patients, spermatoceles in 6.4% of patients and pathological amount of fluid surrounding the testicles in 15.1% of patients. The results of our study show that sonography should be used for more exact and more correct findings in the examination of scrotal organs and accurate monitoring of applied treatment.
Assuntos
Infertilidade Masculina/diagnóstico por imagem , Cordão Espermático/diagnóstico por imagem , Testículo/diagnóstico por imagem , Adulto , Epididimo/diagnóstico por imagem , Humanos , Masculino , Pessoa de Meia-Idade , Palpação , UltrassonografiaRESUMO
The authors analyse the effectiveness of ectopic pregnancy diagnosis in women with clinical history and high psychological motivation for treatment. The effectiveness of the diagnostic algorithm was studied in 21 women with previous history of infertility treatment (including 15 who had undergone tube surgery). The diagnostic process was begun between 20th and 25th days after the suspected conception. The only clinical symptom that the patients complained of was spotting (7 cases). The algorithm used serum HCG determination (EIA); in cases of HCG ranging between 2 mIU/ml and 1500 mIU/ml (or clinical uncertainty)-transvaginal sonography (with colour Doppler) was used. If ectopic pregnancy was suspected, laparoscopy was done. It was found that in 15 cases laparoscopic images agreed with diagnostic results; in 5 cases, the image obtained was false negative; in 1 case it was false positive. The diagnostic efficiency of sonography alone was higher than if it was correlated with HCG, but it, too, did not secure against false positive and false negative results. The conclusion was drawn that despite very high sensitivity (70%) and specificity (93%) of the diagnostic procedures used, in high-risk patients the diagnosis should be verified by laparoscopy.
Assuntos
Gravidez Ectópica/diagnóstico , Adulto , Algoritmos , Gonadotropina Coriônica/sangue , Erros de Diagnóstico , Endométrio/diagnóstico por imagem , Feminino , Humanos , Técnicas Imunoenzimáticas , Laparoscopia , Gravidez , Fatores de Risco , Sensibilidade e Especificidade , Ultrassonografia Doppler em CoresRESUMO
The results of clinical examinations, semen analysis and endosonographic examinations of prostate and seminal vesicles were analysed in 172 male patients treated due to infertility. Ultrasound equipment with transrectal multiplane transducers 6.5 and 7.0 MHz frequency has been used to the evaluation of size, symmetry and echostructure of prostate and the seminal vesicles. In 62% patients pathological changes have been displayed in the prostate and 32% in the seminal vesicles.
Assuntos
Infertilidade Masculina/diagnóstico por imagem , Próstata/diagnóstico por imagem , Glândulas Seminais/diagnóstico por imagem , Adulto , Humanos , Masculino , Pessoa de Meia-Idade , UltrassonografiaRESUMO
A rare case of coexistence of gonadal neoplasm Sertolioma with boundary line tumor with epithelial fill in ovaries in 69 old patient was described. Current diagnostic and prognostic possibilities in such cases were discussed.
Assuntos
Neoplasias Primárias Múltiplas/patologia , Neoplasias Ovarianas/patologia , Tumor de Células de Sertoli/patologia , Idoso , Feminino , HumanosRESUMO
20 patients were treated for endometriosis with combined treatment, we have divided prospectively our patients on the 2 groups. One group was operated by laparoscopic marsupialisation of endometrial cyst and coagulation. The second group was operated by stripping of lining. Second-look laparoscopy was performed after six month medical treatment. Two techniques laparoscopic was very efficacy (decrease of AFS score). The difference between them wasn't significant.
Assuntos
Endometriose/terapia , Laparoscopia/métodos , Doença Inflamatória Pélvica/terapia , Adulto , Eletrocoagulação/métodos , Endometriose/cirurgia , Feminino , Humanos , Doença Inflamatória Pélvica/cirurgia , Estudos Prospectivos , Índice de Gravidade de Doença , Resultado do TratamentoRESUMO
Among 172 examined male patients varicoceles have been found in 57.6% patients. The frequency of varicocele appearance increased according to the fall of sperm concentration. Simple relations between sperm motility and varicocele have not been observed. Larger per cent of pathological sperm forms in patients with varicoceles has been shown. In patients with varicoceles three times as frequent appearance of richer periprostatic and periseminnal blood vessels have been observed in comparison with patients without varicocele.
Assuntos
Sêmen/fisiologia , Varicocele/patologia , Adulto , Humanos , Masculino , Pessoa de Meia-Idade , Contagem de Espermatozoides , Motilidade dos Espermatozoides , Espermatozoides/anormalidades , Testículo/irrigação sanguíneaRESUMO
The authors described case of 27 years old female patient treated due to infertility of unknown etiology. The female was pregnant after series of intrauterine insemination. During caesarean section due to pelvic longitudinal lie the chocolate cyst and endometriosis of the ovary were found. The authors did not find any information in the literature about coincidence of endometriosis of female reproductive organs and full-term pregnancy.