Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Loss of TDP43 inhibits progression of triple-negative breast cancer in coordination with SRSF3.

Aberrant alternative splicing has been highlighted as a potential hallmark of cancer. Here, we identify TDP43 (TAR DNA-binding protein 43) as an important splicing regulator responsible for the unique splicing profile in triple-negative breast cancer (TNBC). Clinical data demonstrate that TDP43 is highly expressed in TNBC with poor prognosis. Knockdown of TDP43 inhibits tumor progression, including proliferation and metastasis, and overexpression of TDP43 promotes proliferation and malignancy of mammary epithelial cells. Deep sequencing analysis and functional experiments indicate that TDP43 alters most splicing events with splicing factor SRSF3 (serine/arginine-rich splicing factor 3), in the regulation of TNBC progression. The TDP43/SRSF3 complex controls specific splicing events, including downstream genes PAR3 and NUMB The effect of reduced metastasis and proliferation upon the knockdown of TDP43 or SRSF3 is mediated by the splicing regulation of PAR3 and NUMB exon 12, respectively. The TDP43/SRSF3 complex and downstream PAR3 isoform are potential therapeutic targets for TNBC.

Ten-eleven translocation 2 demethylates the MMP9 promoter, and its down-regulation in preeclampsia impairs trophoblast migration and invasion.

Preeclampsia is the most common clinical disorder in pregnancy and might result from disordered uterine environments caused by epigenetic modifications, including deregulation of DNA methylation/demethylation. Recent research has indicated that 5-hydroxymethylcytosine (5hmC), a DNA base derived from 5-methylcytosine (5mC) via oxidation by ten-eleven translocation (TET) enzymes, is involved in DNA methylation-related plasticity. Here, we report that TET2 expression and 5hmC abundance are significantly altered in the placentas from preeclampsia patients. shRNA-mediated TET2 knockdown (shTET2) reduced trophoblast migration and invasion when cultured in Matrigel. Both real-time PCR of matrix metalloproteinase (MMP)-related transcripts and a human angiogenesis antibody array indicated that TET2 knockdown in trophoblasts inhibits the expression of MMP transcript, of which MMP9 represented one of the most significant TET2 downstream targets. Using an established shTET2 HTR-8/SVneo cell model, we further confirmed alterations of 5hmC levels and MMP9 expression at both mRNA and protein levels. In particular, we found that TET2 bound to and removed 5mC modifications at the MMP9 promoter region. Interestingly, in TET2 knockdown cells, both MMP9 expression and the compromised trophoblast phenotype could be rescued by vitamin C, an activator of TET enzyme activity. Finally, TET2 expression correlated with MMP9 levels in placenta samples from the preeclampsia patients, indicating that TET2 deregulation is critically involved in the pathogenesis of preeclampsia through down-regulation of MMP9 expression. Our findings highlight a critical role of TET2 in regulating trophoblast cell migration through demethylation at the MMP9 promoter, and suggest that down-regulation of the TET2-MMP9-mediated pathway contributes to preeclampsia pathogenesis.

[Apoptosis mechanism of taxol combined with resveratrol on human laryngeal carcinoma Hep-2 cells].

Laryngeal cancer is one of the most common malignant tumors in the respiratory tumors, and its incidence ranks second highest in the respiratory tumors. Resveratrol (Res) is a kind of polyphenols, which can inhibit nucleotides can inhibit the growth of liver cancer cells, gastric cancer cells, pancreatic cells and other tumor cells by inhibiting ribonucleotide reductase in the cells. Taxol (Tax) is a kind of secondary metabolites of Taxus chinensis, which has anti-tumor activity for breast cancer, cervical cancer, ovarian cancer and other tumors by inhibiting cellular microtubule depolymerization. But at present the effects of resveratrol combined with taxol on human laryngeal carcinoma cell strain Hep-2 and their underlying molecular mechanisms are rarely reported. After human laryngeal cancer cell Hep-2 cells were processed with resveratrol (Res) and taxol (Tax), CCK-8 assay was used to evaluate the effect of these two herbs on the proliferation of cancer cells; AO/PI staining and JC-1 were used to detect Hep-1 cells apoptosis; the expression of Bax, Bcl-2, PARP, TRIB3, and XIAP genes was detected by real time quantitative PCR; the activity of caspase-3 and caspase-8 was determined with quantitative fluorescence method. The experimental results showed that compared with Tax, Res medication alone, joint group significantly enhanced inhibition of Hep-2 cells activity, decreased the dosage of Tax, increased the expression of Bax and PARP, TRIB3, reduced the expression of the Bcl-2 and XIAP, and promoted the activity of caspase-3 and caspase-8. The test results showed that compared with the single medication, combined group could significantly increase the inhibitory effect on Hep-2 cells, significantly reduce Tax dosage, increase expressions of Bax, PARP, TRIB3, reduce expressions of Bcl-2, XIAP, and promote activity of caspase-3, caspase-8. This indicated apoptosis of human laryngeal carcinoma cell strain Hep-2 may be induced with Res, Tax, and the combination of these two herbs by mitochondria pathway. It provides valuable clue for further research on combination of Res and Tax for the treatment of laryngeal cancer, and expanding the combined application of Res and Tax.

[Anti-metastasis of celastrol on esophageal cancer cells and its mechanism].

Celastrol is a quinone methyl terpene extracted from the traditional Chinese medicine Tripterygium wilfordii, which has anti-inflammatory, immune suppression and pharmacological activities, as well as anti-tumor activity. The effects of celastrol on adhesion, migration and invasion of esophageal cancer cells were investigated in this experiment. Human esophageal cancer cell line ECA-109 was used. The inhibition of ECA-109 cells' adhesion induced by celastrol was measured by MTT test. The inhibition of ECA-109 cells' migration induced by celastrol was measured by scratch test. The invasion inhibition of ECA-109 cells induced by celastrol was measured by Transwell experiment. Quantitative real-time PCR and Western blot were used to determine the effects of different concentrations of celastrol on integrin family and Wnt signaling pathway in ECA-109 cells. The results showed that celastrol inhibited adhesion, migration and invasion of ECA-109 cells and expressions of integrins ß1, ß4, αv and ß-Catenin, LRP6 in Wnt signal pathway in a dose-dependent manner. Therefore the study suggests that celastrol could inhibit the cell metastasis of esophageal cancer by inhibiting the Wnt signaling pathway and the expressions of integrins.

[Effect of celastrol in inhibiting metastasis of lung cancer cells by influencing Akt signaling pathway and expressing integrins].

Celastrol is a type of quinone methyl triterpene isolated from traditional Chinese medicine Tripterygium wilfordii, with pharmacological activities, like anti-inflammatory, immunosuppression and anti-tumor. This study focused on the effects of celastrol on adhesion, migration and invasion of lung cancer cells. The migration inhibition of lung cancer cells induced by celastrol was detected by the scratch test. The invasion inhibition of lung cancer cells induced by celastrol was measured by the transwell experiment. RT-PCR and Western blot were used to determine the effect of different concentrations of celastrol in integrin family and Akt signaling pathway in lung cancer cells. The results showed that celastrol inhibited adhesion, migration and invasion of lung cancer cells and expressions of integrins ß3, ß4, αv and phosphorylated Akt, GSK-3ß, c-Raf, PDK1 in Akt signal pathway in a dose-dependent manner. Therefore, the study implies that Celastrol could inhibit the metastasis of lung cancer cells by suppressing Akt signaling pathway and expression of integrins.

Antioxidant and anti-inflammatory activity of constituents isolated from Dendrobium nobile (Lindl.).

Dendrobium nobile (Lindl.) have long been used as herbal tea and a traditional herbal medicine to treat Alzheimer's disease (AD). In the current study, nineteen compounds (1-19), including two new vitamin E homologues (1-2), one new sesquiterpene (6), and two new dendrobines (7, 8), were isolated and identified from stems of Dendrobium nobile. Their structures were elucidated on the basis of NMR, 13C NMR calculation, and DP4+ probability analyses. The absolute configurations of new compounds were determined by electronic circular dichroism (ECD) data analysis. Antioxidant, anti-inflammatory, and cytotoxic activities of isolated compounds were evaluated. Among them, compound 2 demonstrated significant antioxidant activity compared with ascorbic acid (VC), while compounds 2 and 4 also exhibited an equal effect to positive control cisplatin. This study on the biological activity of the new vitamin E homologues from Dendrobium nobile may indicate its potential application in the pharmaceutical and food industries.

A novel human IL-2 mutein with minimal systemic toxicity exerts greater antitumor efficacy than wild-type IL-2.

IL-2 is critical to the activation, growth, and survival of T cells and NK cells, and maintains the delicate balance between auto-immunity and anti-neoplasm surveillance. High IL-2 doses have clear antitumor capabilities, but also have severe side effects that limit its clinical use. Side effects include the vascular leak syndrome (VLS), which results in lung edema and liver damage. Therefore, a new version of IL-2 that does not induce organ toxicity would improve IL-2-based immunotherapy. We conducted a systematic screening by changing one amino acid at a time at the interaction area of IL-2 with its receptor IL-2R to select one particular mutant IL-2, FSD13, in which the proline at position 65 was substituted by lysine (P65L). FSD13 had a greater ability than wild-type IL-2 in stimulating CD4+ T, CD8+ T, and NK cell proliferation, enhancing the expression of CD69, CD183, CD44, and CD54 in these cells, and triggering cancer cell apoptosis. FSD13 had three-time lower than wild-type IL-2 in inducing CD4+ T to Tregs. Compared with wild-type IL-2, FSD13 greatly limited the growth, invasion into adjacent tissues, and metastasis of melanoma metastatic into the lung. In contrast to wild-type IL-2, high dose of FSD3 did not alter structures and induce any pathogenic changes in the liver and lung. Thus, we generated a novel the IL-2 mutant, FSD13, by targeting a different area than previously reported. FSD13 surpasses the wild-type IL-2's ability in stimulating the antitumor immune cell functions, but exerts much less systemic toxicity.

LncRNA MIR100HG promotes cell proliferation in triple-negative breast cancer through triplex formation with p27 loci.

Triple-negative breast cancer (TNBC) exhibits poor prognosis, with high metastasis and low survival. Long non-coding RNAs (lncRNAs) play critical roles in tumor progression. Here, we identified lncRNA MIR100HG as a pro-oncogene for TNBC progression. Knockdown of MIR100HG decreased cell proliferation and induced cell arrest in the G1 phase, whereas overexpression of MIR100HG significantly increased cell proliferation. Furthermore, MIR100HG regulated the p27 gene to control the cell cycle, and subsequently impacted the progression of TNBC. In analyzing its underlying mechanism, bioinformatics prediction and experimental data demonstrated that MIR100HG participated in the formation of RNA-DNA triplex structures. MIR100HG in The Cancer Genome Atlas (TCGA) and breast cancer cell lines showed higher expression in TNBC than in other tumor types with poor prognosis. In conclusion, our data indicated a novel working pattern of lncRNA in TNBC progression, which may be a potential therapeutic target in such cancers.

Epidemiology and clinical features of segmental/lobar pattern Mycoplasma pneumoniae pneumonia: A ten-year retrospective clinical study.

Mycoplasma pneumoniae plays an important role in community-acquired pneumonia. However, epidemiological and clinical studies on the segmental/lobar pattern (S/L) radiographic-pathologic subtype of pediatric Mycoplasma pneumoniae pneumonia (MPP) are rare. The current study retrospectively analyzed the epidemiological and clinical characteristics of pediatric MPP patients. A total of 1,933 children with MPP received treatment at a single hospital between 2000 and 2009, of which 684 (35.4%) were diagnosed with S/L-MPP. The annual incidence of S/L-MPP in children with MPP increased throughout the duration of this study (from 6.4 to 59.6%, P<0.001), which was particularly evident after 2003. S/L-MPP was predominantly found in pre-school-aged children (4-6 years old; 56.6%). Compared with non-S/L-MPP, S/L-MPP was more closely associated with severe manifestations, including higher rates of fever (90.2 vs. 83.3%), pleural effusion (3.9 vs. 1.3%), extrapulmonary manifestations (26.2 vs. 21.2%), abnormal white blood cell counts (65.5 vs. 55.2%), abnormal C-reactive protein levels (30.9 vs. 23.7%) and bacterial co-infection (32.0 vs. 24.9%), as well as longer durations of fever (4.13±4.28 vs. 3.02±2.22 days) and hospitalization (12.70±4.54 vs. 9.22±5.12 days). Older S/L-MPP patients showed higher rates and longer durations of fever and cough; however, they also displayed a lower rate of extrapulmonary manifestations when compared with younger patients. In conclusion, the annual incidence of S/L-MPP has increased in recent years. Pre-school-aged children (4-6 years) with MPP are more likely to display a segmental/lobar pattern, which is associated with more severe clinical manifestations than other MPP infection patterns.

Correction of a genetic disease by CRISPR-Cas9-mediated gene editing in mouse spermatogonial stem cells.

Spermatogonial stem cells (SSCs) can produce numerous male gametes after transplantation into recipient testes, presenting a valuable approach for gene therapy and continuous production of gene-modified animals. However, successful genetic manipulation of SSCs has been limited, partially due to complexity and low efficiency of currently available genetic editing techniques. Here, we show that efficient genetic modifications can be introduced into SSCs using the CRISPR-Cas9 system. We used the CRISPR-Cas9 system to mutate an EGFP transgene or the endogenous Crygc gene in SCCs. The mutated SSCs underwent spermatogenesis after transplantation into the seminiferous tubules of infertile mouse testes. Round spermatids were generated and, after injection into mature oocytes, supported the production of heterozygous offspring displaying the corresponding mutant phenotypes. Furthermore, a disease-causing mutation in Crygc (Crygc(-/-)) that pre-existed in SSCs could be readily repaired by CRISPR-Cas9-induced nonhomologous end joining (NHEJ) or homology-directed repair (HDR), resulting in SSC lines carrying the corrected gene with no evidence of off-target modifications as shown by whole-genome sequencing. Fertilization using round spermatids generated from these lines gave rise to offspring with the corrected phenotype at an efficiency of 100%. Our results demonstrate efficient gene editing in mouse SSCs by the CRISPR-Cas9 system, and provide the proof of principle of curing a genetic disease via gene correction in SSCs.

The roles of testicular c-kit positive cells in de novo morphogenesis of testis.

C-kit positive (c-kit(+)) cells are usual tissue-specific stem cells. However, in postnatal testis, undifferentiated spermatogonial stem cells (SSCs) are c-kit negative (c-kit(-)) and activation of c-kit represents the start of SSC differentiation, leaving an intriguing question whether other c-kit(+) cells exist and participate in the postnatal development of testis. To this end, a feasible system for testicular reconstitution, in which a specific type of cells can be manipulated, is needed. Here, we first establish de novo morphogenesis of testis by subcutaneous injection of testicular cells from neonatal testes into the backs of nude mice. We observe testicular tissue formation and spermatogenesis from all injected sites. Importantly, functional spermatids can be isolated from these testicular tissues. Using this system, we systemically analyze the roles of c-kit(+) cells in testicular reconstitution and identify a small population of cells (c-kit(+):CD140a(+):F4/80(+)), which express typical markers of macrophages, are critical for de novo morphogenesis of testis. Interestingly, we demonstrate that these cells are gradually replaced by peripheral blood cells of recipient mice during the morphogenesis of testis. Thus, we develop a system, which may mimic the complete developmental process of postnatal testis, for investigating the testicular development and spermatogenesis.

Shikonin attenuates lung cancer cell adhesion to extracellular matrix and metastasis by inhibiting integrin ß1 expression and the ERK1/2 signaling pathway.

Integrin ß1 facilitates cancer cell adhesion, migration and metastasis by activating intracellular signaling pathways including the ERK and PI3K signaling pathways. In previous studies, shikonin, an active naphthoquinone isolated from the Chinese medicine Zi Cao (gromwell), showed effective anticancer activity both in vivo and in vitro. However, the mechanisms underlying shikonin's anticancer activity are not fully elucidated. Increasing evidence indicates that shikonin inhibits tumor metastasis, but little is known about the effect of shikonin on lung cancer cells. To better understand the anti-metastatic role of shikonin in lung cancer, in this study we sought to investigate the effect of shikonin on lung cancer cell proliferation, adhesion to extracellular matrices (ECM), migration and invasion in non-small cell lung cancer A549 cells. We also sought to investigate the molecular mechanisms underlying shikonin's anticancer effects. Here we showed that when non-small cell lung cancer A549 cells were treated with shikonin for 24h, 8.0µM shikonin significantly inhibited cell proliferation, while cells treated with less than 2.0µM shikonin for 24h significantly suppressed cell adhesion to the ECM, invasion and migration in a dose-dependent manner. Moreover, real-time PCR and Western blot analysis showed that shikonin led to a reduction in the expression of integrin ß1 at the mRNA and protein levels. Further elucidation of the mechanisms involved revealed that shikonin repressed the phosphorylation of extracellular signal-regulated kinase (ERK1/2). Taken together, our findings provide new evidence that shikonin suppresses lung cancer invasion and metastasis by inhibiting integrin ß1 expression and the ERK1/2 signaling pathway.

Resveratrol inhibits TGF-ß1-induced epithelial-to-mesenchymal transition and suppresses lung cancer invasion and metastasis.

Epithelial-to-mesenchymal transition (EMT) is a cellular process during which epithelial polarized cells become motile mesenchymal-appearing cells, which in turn promotes carcinoma invasion and metastasis. Resveratrol (trans-3,4',5-trihydroxystilbene) is a natural polyphenolic compound found in grapes, red wine and several other plants. Numerous reports in the literature indicate that resveratrol can suppress cancer invasion and metastasis. However, the underlying mechanisms of inhibiting metastasis by resveratrol are complex, not fully elucidated and the subject of intense scientific debate. Despite evidence indicating that EMT can be a target for resveratrol, little is known about the effect of resveratrol on lung cancer cells. Our previous studies demonstrated that TGF-ß1 induces EMT to promote lung adenocarcinoma invasion and metastasis. To understand the repressive role of resveratrol in lung cancer invasion and metastasis, we sought to investigate the potential use of resveratrol as an inhibitor of TGF-ß1-induced EMT development in A549 lung cancer cells in vitro. Here we show that when A549 cells are treated with TGF-ß1 and resveratrol, the latter inhibits the initiation of TGF-ß1-induced EMT. Our results show that 20 µM resveratrol increases expression of the epithelial phenotype marker E-cadherin and represses the expression of the mesenchymal phenotype markers, Fibronectin and Vimentin during the initiation of TGF-ß1-induced EMT. Resveratrol also inhibits expression of EMT-inducing transcription factors Snail1 and Slug, although the expression of the Twist1 transcription factor remained unchanged. Resveratrol inhibits the TGF-ß1-induced increase in cell adhesion, migration and invasion of A549 lung cancer cells. Taken together, our findings provide new evidence that resveratrol suppresses lung cancer invasion and metastasis in vitro through inhibiting TGF-ß1-induced EMT.

miRNA-29c suppresses lung cancer cell adhesion to extracellular matrix and metastasis by targeting integrin ß1 and matrix metalloproteinase2 (MMP2).

Our pilot study using miRNA arrays found that miRNA-29c (miR-29c) is differentially expressed in the paired low-metastatic lung cancer cell line 95C compared to the high-metastatic lung cancer cell line 95D. Bioinformatics analysis shows that integrin ß1 and matrix metalloproteinase 2 (MMP2) could be important target genes of miR-29c. Therefore, we hypothesized that miR-29c suppresses lung cancer cell adhesion to extracellular matrix (ECM) and metastasis by targeting integrin ß1 and MMP2. The gain-of-function studies that raised miR-29c expression in 95D cells by using its mimics showed reductions in cell proliferation, adhesion to ECM, invasion and migration. In contrasts, loss-of-function studies that reduced miR-29c by using its inhibitor in 95C cells promoted proliferation, adhesion to ECM, invasion and migration. Furthermore, the dual-luciferase reporter assay demonstrated that miR-29c inhibited the expression of the luciferase gene containing the 3'-UTRs of integrin ß1 and MMP2 mRNA. Western blotting indicated that miR-29c downregulated the expression of integrin ß1 and MMP2 at the protein level. Gelatin zymography analysis further confirmed that miR-29c decreased MMP2 enzyme activity. Nude mice with xenograft models of lung cancer cells confirmed that miR-29c inhibited lung cancer metastasis in vivo, including bone and liver metastasis. Taken together, our results demonstrate that miR-29c serves as a tumor metastasis suppressor, which suppresses lung cancer cell adhesion to ECM and metastasis by directly inhibiting integrin ß1 and MMP2 expression and by further reducing MMP2 enzyme activity. The results show that miR-29c may be a novel therapeutic candidate target to slow lung cancer metastasis.

Effect of Pinus massoniana bark extract on IFN-gamma-induced ICAM-1 expression in HaCaT human keratinocytes.

AIMS OF THE STUDY: Pinus massoniana bark extract (PMBE) with known anti-oxidant activity is comprised of various flavonoids including several bioactive compounds. We found that PMBE contains 1.27% taxifolin, a well-studied compound with known anti-inflammatory activity. Therefore, in the present study, we evaluated the effects of PMBE and taxifolin on intercellular adhesion molecule-1 (ICAM-1) expression. MATERIALS AND METHODS: PMBE and taxifolin were prepared. After HaCaT cells were pre-treatmented with PMBE and taxifolin, HaCaT cells were treatmented with 1000 U/ml IFN-gamma for 24 h. RESULTS: Treatment of HaCaT cells with 1000 U/ml IFN-gamma for 24 h markedly increased ICAM-1 expression. However, PMBE pre-treatment (40 microg/ml for 24 h) significantly inhibited IFN-gamma-induced ICAM-1 expression. In equal concentrations of taxifolin, PMBE-mediated inhibition of ICAM-1 mRNA and protein expression was greater than taxifolin mediated-inhibition, and the front on inhibition of ICAM-1 protein expression was 2.24-2.30-fold of the latter. When cells were treated with both compounds at a concentration of 40 microg/ml, PMBE-mediated inhibition of ICAM-1 mRNA was also greater than taxifolin-mediated inhibition and PMBE on inhibition of ICAM-1 protein expression was 2.60-3.00-fold the inhibition mediated by taxifolin. CONCLUSIONS: PMBE including additional bioactive compounds may possibly synergize to inhibit transcription and translation of inducible ICAM-1expression and PMBE was greater than monomeric flavonoid taxifolin. These results indicate that PMBE exhibits great potential as a therapeutic treatment for inflammatory skin diseases.