The TOR-EIN2 axis mediates nuclear signalling to modulate plant growth.

The evolutionarily conserved target of rapamycin (TOR) kinase acts as a master regulator that coordinates cell proliferation and growth by integrating nutrient, energy, hormone and stress signals in all eukaryotes1,2. Research has focused mainly on TOR-regulated translation, but how TOR orchestrates the global transcriptional network remains unclear. Here we identify ethylene-insensitive protein 2 (EIN2), a central integrator3-5 that shuttles between the cytoplasm and the nucleus, as a direct substrate of TOR in Arabidopsis thaliana. Glucose-activated TOR kinase directly phosphorylates EIN2 to prevent its nuclear localization. Notably, the rapid global transcriptional reprogramming that is directed by glucose-TOR signalling is largely compromised in the ein2-5 mutant, and EIN2 negatively regulates the expression of a wide range of target genes of glucose-activated TOR that are involved in DNA replication, cell wall and lipid synthesis and various secondary metabolic pathways. Chemical, cellular and genetic analyses reveal that cell elongation and proliferation processes that are controlled by the glucose-TOR-EIN2 axis are decoupled from canonical ethylene-CTR1-EIN2 signalling, and mediated by different phosphorylation sites. Our findings reveal a molecular mechanism by which a central signalling hub is shared but differentially modulated by diverse signalling pathways using distinct phosphorylation codes that can be specified by upstream protein kinases.

Cross-kingdom RNA interference mediated by insect salivary microRNAs may suppress plant immunity.

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.

Complete genome sequence of a novel robigovirus infecting Mentha arvensis.

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.

Complete genome sequence and genetic characterization of a novel segmented RNA virus infecting Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.

Single-dose methamphetamine administration impairs ORM retrieval in mice via excessive DA-mediated inhibition of PrLGlu activity.

Methamphetamine (METH), an abused psychostimulant, impairs cognition through prolonged or even single-dose exposure, but animal experiments have shown contradictory effects on memory deficits. In this study we investigated the effects and underlying mechanisms of single-dose METH administration on the retrieval of object recognition memory (ORM) in mice. We showed that single-dose METH administration (2 mg/kg, i.p.) significantly impaired ORM retrieval in mice. Fiber photometry recording in METH-treated mice revealed that the activity of prelimbic cortex glutamatergic neurons (PrLGlu) was significantly reduced during ORM retrieval. Chemogenetic activation of PrLGlu or glutamatergic projections from ventral CA1 to PrL (vCA1Glu-PrL) rescued ORM retrieval impairment. Fiber photometry recording revealed that dopamine (DA) levels in PrL of METH-treated mice were significantly increased, and micro-infusion of the D2 receptor (D2R) antagonist sulpiride (0.25 µg/side) into PrL rescued ORM retrieval impairment. Whole-cell recordings in brain slices containing the PrL revealed that PrLGlu intrinsic excitability and basal glutamatergic synaptic transmission were significantly reduced in METH-treated mice, and the decrease in intrinsic excitability was reversed by micro-infusion of Sulpiride into PrL in METH-treated mice. Thus, the impaired ORM retrieval caused by single-dose METH administration may be attributed to reduced PrLGlu activity, possibly due to excessive DA activity on D2R. Selective activation of PrLGlu or vCA1Glu-PrL may serve as a potential therapeutic strategy for METH-induced cognitive dysfunction.

Identification and Genome Characterization of a Novel Nege-like Virus Isolated from Aphids (Aphis gossypii) in Yunnan Province.

Negeviruses are insect-specific enveloped RNA viruses that exhibit a wide geographic distribution. A novel nege-like virus, tentatively named Aphis gossypii nege-like virus (AGNLV, GenBank: OR880429.1), was isolated from aphids (Aphis gossypii) in Lijiang City, Yunnan, China. AGNLV has a genome sequence of 9258 nt (excluding the polyA tail) encoding three open reading frames (ORFs). ORF1 (7149 nt) encodes a viral methyltransferase, a viral RNA helicase, and an RNA-dependent RNA polymerase. ORF2 (1422 nt) encodes a DiSB-ORF2_chro domain and ORF3 encodes an SP24 domain. The genome sequence of AGNLV shares the highest nucleotide identity of 60.0% and 59.5% with Wuhan house centipede virus 1 (WHCV1) and Astegopteryx formosana nege-like virus (AFNLV), respectively. Phylogenetic analysis based on the RNA-dependent RNA polymerase shows that AGNLV is clustered with other negeviruses and nege-like viruses discovered in aphids, forming a distinct "unclassified clade". Interestingly, AGNLV only encodes three ORFs, whereas AFNLV and WHCV1 have four ORFs. Structure and transmembrane domain predictions show the presence of eight alpha helices and five transmembrane helices in the AGNLV ORF3. Translational enhancement of the AGNLV 5' UTR was similar to that of the 5' UTR of plant viruses. Our findings provide evidence of the diversity and structure of nege-like viruses and are the first record of such a virus from a member of the genus Aphis.

Complete genome sequence of a new virus from Allium sativum L in China.

The complete genome of a new virus belonging to the family Betaflexiviridae was identified in garlic and sequenced by next-generation sequencing and reverse transcription PCR. The complete RNA genome (GenBank accession number OP021693) is 8191 nucleotides in length, excluding the 3' poly(A) tail, and contains five open reading frames (ORFs). These open reading frames encode the viral replicase, triple gene block, and coat protein, and the genome organization is typical of members of the subfamily Quinvirinae. The virus has been tentatively named "garlic yellow curl virus" (GYCV). Phylogenetic analysis suggested that it represents an independent evolutionary lineage in the subfamily, clustering with the currently unclassified garlic yellow mosaic associated virus (GYMaV) and peony betaflexivirus 1 (PeV1). Differences between the phylogenies inferred for the replicase and coat protein indicate that the new virus does not belong to any established genus of the family Betaflexiviridae. This is the first report of GYCV in China.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Distinct replication and gene expression strategies of the Rice Stripe virus in vector insects and host plants.

Persistent propagative plant viruses are usually transmitted between a vector insect and a host plant. To adapt to the two different organisms, viruses may show distinct genomic replication or gene expression patterns. To verify this hypothesis, we applied an aboslute real-time quantitative PCR method to measure and compare the replication levels of four genomic RNA segments and the expression levels of seven genes of rice stripe virus (RSV) according to the infection time in the small brown planthopper and rice plant, respectively. In the vector insect, RNA3 began replicating later than the other segments, and RNA2 remained nearly constant during the infection process. RNA1 was the dominant segment, and a difference of over 300-fold appeared among the four segments. In rice plants, the size of the four segments increased with infection time, but decreased to a low level in the late infection period. The ratios of the four segments varied by no more than 15-fold. In planthoppers, three expression patterns were observed for the seven viral genes during viral infection, while in rice plants, the expression patterns of the seven viral genes were similar. These results reflect distinct genomic replication and gene expression patterns in a persistent propagative plant virus in adapting to vector insects and host plants.

A novel invertebrate toll-like receptor with broad recognition spectrum from thick shell mussel Mytilus coruscus.

Toll-like receptors (TLRs) are a category of most well recognized pattern recognition molecules that act on a vital role in both innate and adaptive immunity. In the present study, a novel toll-like receptor (McTLRw) was identified and characterized in thick shell mussel Mytilus coruscus. McTLRw possesses one intracellular Toll/interleukin-1 (IL-1) receptor (TIR) domain, one transmembrane region (TM), one leucine rich repeat N-terminal domain (LRR_NT) and a few of leucine-rich repeats (LRRs), which all are common in typical TLRs. McTLRw transcripts were constitutively expressed in all examined tissues with higher expression levels in immune related tissues, and were significantly induced in haemocytes with the challenges of live Vibrio alginolyticus, lipopolysaccharide (LPS), peptidoglycans (PGN) and ß-glucan (GLU), but not induced by polyinosinic-polycytidylic acid (poly I:C). rMcTLRw exhibited affinity to LPS, PGN and GLU while no affinity to poly I:C. Further, the downstream of TLR signaling pathway myeloid differentiation factor 88a (MyD88a), interleukin-1 receptor-associated kinase-4 (IRAK4) and tumor necrosis factor receptor-associated factor 6 (TRAF6) were significantly repressed in McTLRw silenced mussels while challenged with LPS. These results collectively indicated that McTLRw is one member of TLR family and involved in immune response to against invaders by taking participate in TLR mediated signaling pathway.

Rice stripe virus-derived siRNAs play different regulatory roles in rice and in the insect vector Laodelphax striatellus.

BACKGROUND: Most plant viruses depend on vector insects for transmission. Upon viral infection, virus-derived small interfering RNAs (vsiRNAs) can target both viral and host transcripts. Rice stripe virus (RSV) is a persistent-propagative virus transmitted by the small brown planthopper (Laodelphax striatellus, Fallen) and can cause a severe disease on rice. RESULTS: To investigate how vsiRNAs regulate gene expressions in the host plant and the insect vector, we analyzed the expression profiles of small RNAs (sRNAs) and mRNAs in RSV-infected rice and RSV-infected planthopper. We obtained 88,247 vsiRNAs in rice that were predominantly derived from the terminal regions of the RSV RNA segments, and 351,655 vsiRNAs in planthopper that displayed relatively even distributions on RSV RNA segments. 38,112 and 80,698 unique vsiRNAs were found only in rice and planthopper, respectively, while 14,006 unique vsiRNAs were found in both of them. Compared to mock-inoculated rice, 273 genes were significantly down-regulated genes (DRGs) in RSV-infected rice, among which 192 (70.3%) were potential targets of vsiRNAs based on sequence complementarity. Gene ontology (GO) analysis revealed that these 192 DRGs were enriched in genes involved in kinase activity, carbohydrate binding and protein binding. Similarly, 265 DRGs were identified in RSV-infected planthoppers, among which 126 (47.5%) were potential targets of vsiRNAs. These planthopper target genes were enriched in genes that are involved in structural constituent of cuticle, serine-type endopeptidase activity, and oxidoreductase activity. CONCLUSIONS: Taken together, our results reveal that infection by the same virus can generate distinct vsiRNAs in different hosts to potentially regulate different biological processes, thus reflecting distinct virus-host interactions.

Genomic variations in the 3'-termini of Rice stripe virus in the rotation between vector insect and host plant.

A large number of plant RNA viruses circulate between plants and insects. For RNA viruses, host alternations may impose a differential selective pressure on viral populations and induce variations in viral genomes. Here, we report the variations in the 3'-terminal regions of the multiple-segment RNA virus Rice stripe virus (RSV) that were discovered through de novo assembly of the genome using RNA sequencing data from infected host plants and vector insects. The newly assembled RSV genome contained 16- and 15-nt extensions at the 3'-termini of two genome segments compared with the published reference RSV genome. Our study demonstrated that these extensional sequences were consistently observed in two RSV isolates belonging to distinct genetic subtypes in RSV-infected rice, wheat and tobacco. Moreover, the de novo assembled genome of Southern rice black-streaked dwarf virus also contained 3'-terminal extensions in five RNA segments compared with the reference genome. Time course experiments confirmed that the 3'-terminal extensions of RSV were enriched in the vector insects, were gradually eliminated in the host plant and potentially affected viral replication. These findings indicate that variations in the 3'-termini of viral genomes may be different adaptive strategies for plant RNA viruses in insects and plants.

The evolution and functional divergence of 10 Apolipoprotein D-like genes in Nilaparvata lugens.

Apolipoprotein D (ApoD), a member of the lipocalin superfamily of proteins, is involved in lipid transport and stress resistance. Whereas only a single copy of the ApoD gene is found in humans and some other vertebrates, there are typically several ApoD-like genes in insects. To date, there have been relatively few studies that have examined the evolution and functional differentiation of ApoD-like genes in insects, particularly hemi-metabolous insects. In this study, we identified 10 ApoD-like genes (NlApoD1-10) with distinct spatiotemporal expression patterns in Nilaparvata lugens (BPH), which is an important pest of rice. NlApoD1-10 were found to be distributed on 3 chromosomes in a tandem array of NlApoD1/2, NlApoD3-5, and NlApoD7/8, and show sequence and gene structural divergence in the coding regions, indicating that multiple gene duplication events occurred during evolution. Phylogenetic analysis revealed that NlApoD1-10 can be clustered into 5 clades, with NlApoD3-5 and NlApoD7/8 potentially evolving exclusively in the Delphacidae family. Functional screening using an RNA interference approach revealed that only NlApoD2 was essential for BPH development and survival, whereas NlApoD4/5 are highly expressed in testes, and might play roles in reproduction. Moreover, stress response analysis revealed that NlApoD3-5/9, NlApoD3-5, and NlApoD9 were up-regulated after treatment with lipopolysaccharide, H2 O2 , and ultraviolet-C, respectively, indicating their potential roles in stress resistance.

Molecular Characterization of an Isolate of Bean Common Mosaic Virus First Identified in Gardenia Using Metatranscriptome and Small RNA Sequencing.

Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.

Identification and Genome Characterization of a Novel Virus within the Genus Totivirus from Chinese Bayberry (Myrica rubra).

Chinese bayberry (Myrica rubra) is an economically significant fruit tree native to eastern Asia and widely planted in south-central China. However, studies about the viruses infecting M. rubra remain largely lacking. In the present study, we employed the metatranscriptomic method to identify viruses in M. rubra leaves exhibiting yellowing and irregular margin symptoms collected in Fuzhou, a city located in China's Fujian province in the year 2022. As a consequence, a novel member of the genus Totivirus was identified and tentatively named "Myrica rubra associated totivirus 1" (MRaTV1). The genome sequencing of MRaTV1 was determined by overlapping reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The two deduced proteins encoded by MRaTV1 have the highest amino acid (aa) sequence identity to the coat protein (CP) and RNA-dependent RNA polymerase (RdRP) of Panax notoginseng virus A (PNVA), a member of the genus Totivirus within the family Totiviridae, at 49.7% and 61.7%, respectively. According to the results of the phylogenetic tree and the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for the genus Totivirus, MRaTV1 is considered a new member of the genus Totivirus.

Metatranscriptome and small RNA sequencing revealed a mixed infection of newly identified bymovirus and bean yellow mosaic virus on peas.

Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.

Histone deacetylase OsHDA706 orchestrates rice broad-spectrum antiviral immunity and is impeded by a viral effector.

Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.

Viromic approach reveals differences in the composition, diversity and relative abundance of pumpkin viruses across main growing regions of China.

China is the leading country for pumpkin production in the world. As other cucurbits, diseases caused by viruses are among the serious threats to pumpkin production, but our knowledge on the virus species infecting pumpkin plants is fragmentary. To understand the occurrence of viral diseases on pumpkin, we determined the geographical distribution characteristics, relative abundance and evolutionary relationship of pumpkin infected viruses by meta-transcriptome sequencing (RNA-seq) and viromic analysis of 159 samples exhibited typical viral symptoms collected across China in this study. Totally, 11 known and 3 new viruses were identified. Interestingly, 3 new viruses identified in this study should be positive-sense single-stranded RNA virus whose hosts are prokaryotes. The viruses identified in different sampling locations exhibit significant variations in term of virus species and relative abundance. Here, the results provide valuable information for understanding the virus species and their diversity in cultivated pumpkin across major growing regions of China.