RESUMO
Antiphospholipid syndrome (APS) is a systemic autoimmune disorder with vascular, obstetric, and hematological manifestations associated with thrombotic and inflammatory mechanisms orchestrated by antiphospholipid (aPLs) antibodies. Current clinical practice in APS is highly variable duo to lack of high quality of evidence. Here, Chinese Rheumatology Association developed recommendations for management of APS in China. The recommendations cover the early diagnosis, disease evaluation, thrombotic risk assessment, and treatment.
Assuntos
Síndrome Antifosfolipídica , Trombose , Anticorpos Antifosfolipídeos , Síndrome Antifosfolipídica/complicações , Síndrome Antifosfolipídica/diagnóstico , Síndrome Antifosfolipídica/terapia , China , Feminino , Humanos , Gravidez , Medição de Risco , Trombose/complicaçõesRESUMO
Adult-onset Still's disease (AOSD) is a rare systemic autoinflammatory disorder. In China, standardized diagnosis and treatment for AOSD is insufficient. Based on the evidence from China and other countries, Chinese Rheumatology Association developed standardization of diagnosis and treatment of AOSD in China. The purpose is to standardize the methods for diagnosis of AOSD, treatment strategies, and reduce misdiagnosis, missed diagnosis and irreversible damage.
Assuntos
Doença de Still de Início Tardio , Adulto , China , Humanos , Doença de Still de Início Tardio/diagnóstico , Doença de Still de Início Tardio/terapiaRESUMO
OBJECTIVE: Catastrophic antiphospholipid syndrome (CAPS), also known as Asherson's syndrome, is a special subtype of antiphospholipid syndrome (APS) characterized by multiple intravascular thrombosis involving multiple organs systems or tissues simultaneously or continuously, high titer antiphospholipid antibodies and high mortality rate. This article's aims was to analyze the clinical manifestation, laboratory examination and treatment therapy of CAPS for the purpose of improving the understanding, diagnosis and treatment of the disease in clinical practice. METHODS: Retrospective analysis and descriptive statistics were applied to the clinical manifestations and laboratory findings of 14 CAPS cases from APS Shanghai Database (APS-SH) with catastrophic antiphospholipid. RESULTS: Of the 14 CAPS patients, 12 cases satisfied the 2003 CAPS Classification Criteria accepted in the 10th International Congress on Antiphospholipid Antibody, and were diagnosed as definite APS and 2 cases were diagnosed as probable CAPS. Three cases were categorized as primary APS and 11 as APS secondary to systemic lupus erythematosus (SLE). Infection was mostly commonly seen before the onset of CAPS, followed by SLE activity and surgery. Among the involved organs, systems and tissues, brain and lung were most commonly affected sites of arterial thrombosis while peripheral vein was most commonly affected in venous thrombosis events among the clinical events. Triple positivity of anticardiolipin antibody (aCL), anti-ß2 glyeoprotein I antibody (aß2GPI), lupus anticoagulant (LA) were detected in 54.55% of the patients. Thrombocytopenia and decreased hemoglobin were frequently seen in the CAPS patients, and the majority proved to be hemolytic anemia. Of all the cases, 6 ended with death. The triple therapy strategy (anticoagulants, glucocorticoid, intravenous immunoglobulin and/or plasma exchange) could help to improve prognosis, cyclophosphamide and rituximab might benefit the patients with other comorbidities such as SLE and micro-angiopathic hemolytic anemia (MHA). CONCLUSION: CAPS patients suffer from life-threatening acute multiple small vessel thrombosis with high titer of antiphospholipid antibody, potentially leading to multiple organ failure and a poor prognosis, thus early diagnosis and sufficient treatment are critical to prevent the progression of disease and improve the prognosis.
Assuntos
Anticorpos Antifosfolipídeos , Síndrome Antifosfolipídica , Trombose , Síndrome Antifosfolipídica/complicações , Síndrome Antifosfolipídica/diagnóstico , Síndrome Antifosfolipídica/terapia , Doença Catastrófica , Humanos , Inibidor de Coagulação do Lúpus , Estudos Retrospectivos , Trombose/etiologiaRESUMO
OBJECTIVE: This study aimed to analyze and evaluate the diagnostic efficacy of Ishikawa's, the modified Ishikawa's criteria, 1990 American College of Rheumatology (ACR ) classification criteria and the diagnostic model based on Chinese population in Chinese TA patients. METHODS: One hundred and forty-nine patients with Takayasu arteritis and 126 patients with other vascular disorders which involved aorta or its branches were recruited in this study.All the patients were admitted to the Department of rheumatism and Immunology clinic or inpatient department of Zhongshan Hospital affiliated to Fudan University from January 1(st), 2008 to June 31(st), 2015.General characteristics, clinical manifestations, laboratory results and imaging data of all the patients were collected.Sensitivity, specificity, accuracy and area under receiver operating characteristics (ROC) curve of different criteria were analyzed. RESULTS: Sensitivity, specificity, accuracy and area under ROC curve of Chinese diagnostic model were 90.60%, 80.95%, 86.18%, and 85.80%, respectively, while those of Ishikawa criteria were 34.23%, 99.21%, 64.00%, and 66.70%, respectively.These four indicators of the modified Ishikawa criteria were 84.13%, 79.87%, 81.82%, and 82.00%, respectively and that of ACR criteria were 83.89%, 83.33%, 83.64%, and 83.60%, respectively.No significant difference was found between any two of Chinese diagnostic model, the modified Ishikawa criteria and ACR criteria in all the indicators.Sensitivity of Chinese diagnostic model was highest, while specificity of Ishikawa criteria was the highest.Among these four criteria, the diagnostic efficacy of Chinese model was the best and that of Ishikawa criteria was the worst. CONCLUSION: Chinese diagnostic model, which is based on Chinese population and adopts advanced imaging modality, has better diagnostic efficacy.
Assuntos
Diagnóstico Diferencial , Arterite de Takayasu , Povo Asiático , Humanos , Curva ROCRESUMO
Rice sheath blight (ShB), which is caused by Rhizoctonia solani, has become the most serious rice disease in China. Yangdao 4, a cultivar with partial resistance to ShB, was crossed with Lemont, a susceptible cultivar, to develop mapping populations that were used to analyze quantitative trait loci (QTL) that confer resistance to ShB. QTL analysis were performed in 3 environments (E1-E3) using 2 F2 and 1 F2:3 populations, respectively. Three traits were recorded to evaluate ShB resistance, including disease rating (DR), lesion height (LH), and percentage of lesion height (PLH). Based on field evaluation of ShB resistance and the 2 genetic maps constructed, we identified a total of 8 QTLs for DR (4 in E1, 4 in E2, and 3 in E3), 6 QTLs for LH (1 in E1, 3 in E2, and 2 in E3), and 7 QTLs for PLH (1 in E1, 4 in E2, and 2 in E3). Sixteen of the ShB-QTLs co-localized as 6 clusters on chromosomes 3, 7, 11, and 12. Four of the 6 clusters contained ShB-QTLs that were detected in 2 environments, while the other 2 clusters with ShB-QTLs were detected in 1 environment. Three ShB-QTLs (qSBD-3-2, qSBL-3-1, and qSBPL-3-1) were delimited to a 581-kb region flanked by markers D333B and D334 on chromosome 3. The resistance alleles of Yangdao 4 at the qSBD-3-2 locus decreased DR by 0.68 and 0.79 in E2 and E3, respectively.
Assuntos
Mapeamento Cromossômico , Resistência à Doença/genética , Oryza/genética , Locos de Características Quantitativas , Alelos , China , Cromossomos de Plantas/genética , Ligação Genética , Marcadores Genéticos , Oryza/microbiologia , Fenótipo , Filogeografia , Doenças das Plantas/microbiologia , Rhizoctonia/isolamento & purificaçãoRESUMO
Saposhnikovia divaricata (Turcz) Schischk, a perennial plant in the Umbelliferae, is widely cultivated in north China. As a traditional Chinese medicine, it can be used to cure colds and rheumatism (1). During disease surveys on medicinal plants in August 2010, a bacterial leaf blight was discovered with a general incidence of 40 to 60% on S. divaricata farms in Longxi, Weiyuan County in Gansu China. In young plants, tiny yellow-white points were visible on the backs of the leaves. They then expanded to 2- to 3-mm oil-soaked lesions; leaves appeared crimped and deformed. Later the leaves shriveled; black-brown oil-soaked lesions appeared on the vein and the tissue around it; and black streaks appeared on the stems. Ten diseased leaf and stem tissues were cut into 4- to 5-mm squares, surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed three times, and macerated for 5 min in sterilized distilled water. They were then streaked onto nutrient agar (NA) medium and incubated at 28°C for 3 days. Colonies on NA were round, smooth, translucent, and yellowish green. They were Gram negative and induced a hypersensitive response on tobacco (Nicotiana tabacum L.) leaves. The strain was positive for gelatin, catalase, oxidase, and utilization of glucose and saccharose. Pathogenicity tests were performed by spraying bacterial suspension containing 107 CFU/ml on six leaves of three healthy potted S. divaricata plants and injecting it into another six leaves on three plants. Plants inoculated with sterile distilled water alone served as controls. They were placed in a growth chamber at 25°C and bagged for 24 h to maintain >95% humidity. Thirty-six hours after inoculation, the inoculated leaves appeared water-soaked; 10 days later, the symptoms were apparent on leaves and the plant wilted. The negative control appeared normal. Finally, Koch's postulates were verified by re-isolating P. viridiflava from the leaves with typical blight. The genomic DNA of the isolate was extracted, and the partial 16S rDNA sequence was amplified with a universal bacterial primer set (27f and 1492r) (2). The sequence was deposited in GenBank as KM030291. BLAST search yielded 99% identity with P. viridiflava strains, including the strains KNOX209 (AY604847), RMX3.1b (AY574911), ME3.1b (AY574909), and UASWS0038 (AY919300). Based on the symptoms, colony morphology, biochemical tests, and 16S rDNA sequence identity, the pathogen was identified as P. viridiflava. To our knowledge, this is the first report of leaf blight of S. divaricata by P. viridiflava in Gansu province of China. In Jilin province, the same disease was reported in 2008 (3). The impact of P. viridiflava on S. divaricata production is not yet known. References: (1) Committee of China Pharmacopoeia. Pharmacop. People's Repub. 1:102, 2005. (2) C. Morenol et al. Microbiology 148:1233, 2002. (3) W. Xue. Dissertation. Jilin Agric. Univ. 1, 2008.
RESUMO
In this study, a total of 1047 insertion-deletion (InDel) primer pairs distributed across the rice genome were developed and experimentally validated. The primer pairs were designed based on the InDel length polymorphisms between 93-11 (Oryza sativa ssp indica cv.) and Nipponbare (Oryza sativa ssp japonica cv.), aiming for utilization between indica and japonica rice, or between other inter-subspecific rice cultivars. The 1047 primer pairs were dispersed across all 12 of the rice chromosomes, with one InDel marker found every 371.3 kb on average. The InDel length of the markers varied from 3 to 39 bp: 88.2% of the markers contained 6 to 25 bp, only 6.2% of markers were ≤ 5 bp, and 5.6% were ≥ 26 bp. Six hundred and twenty-three (59.5%) of the 1047 InDel markers were shown to amplify well and were polymorphic between Taichung65 and IR8, and 476 (45.5%) markers were polymorphic between Lemont and Yangdao4, while 398 (38.0%) were polymorphic in both combinations. These results demonstrated that the polymerase chain reaction-based InDel markers developed in this study could be of immediate use for rice genetic studies and breeding programs.
Assuntos
Cruzamento , Marcadores Genéticos , Mutação INDEL , Oryza/genética , Cromossomos de Plantas , Ligação Genética , Genoma de Planta , Mapeamento Físico do Cromossomo , Polimorfismo GenéticoRESUMO
A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 µm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 µm. Chlamydospores were spherical and 27 to 81 × 18 to 63 µm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.
RESUMO
Glomerular microthrombosis (GMT) is a common vascular change in patients with lupus nephritis (LN). The mechanism underlying GMT is still unknown. In our previous study, we found that the level of IgG anti-beta2 glycoprotein I (beta2GPI) antibodies was higher in the LN-GMT group than in the LN-non-GMT group, which indicated that anti-beta2GPI antibodies may play a role in GMT formation. Many studies have demonstrated that the activation of the classical complement pathway may play a critical role in fetal loss and aPL-induced thrombosis formation. To investigate whether complement activation plays a role in GMT formation and to evaluate its relationship with aPL, we prospectively investigated deposition of C4d in 155 renal biopsy specimens of LN patients. The results revealed a strong relationship between the intensity of glomerular C4d staining and the presence of microthrombi (p < 0.001). The detection rate of IgG anti-beta2GPI antibodies was higher in the LN-GMT group than in the LN-non-GMT group (p < 0.05). Further, the intensity of glomerular C4d staining was significantly related with IgG anti-beta2GPI antibodies (p < 0.05). The results of our study suggest that anti-beta2GPI antibodies may play a role in GMT formation, and this process might involve complement activation.
Assuntos
Complemento C4b/metabolismo , Nefrite Lúpica/complicações , Fragmentos de Peptídeos/metabolismo , Trombose/fisiopatologia , beta 2-Glicoproteína I/imunologia , Adulto , Autoanticorpos/imunologia , Biópsia , Feminino , Humanos , Imunoglobulina G/imunologia , Glomérulos Renais/imunologia , Glomérulos Renais/patologia , Nefrite Lúpica/imunologia , Masculino , Pessoa de Meia-Idade , Estudos Prospectivos , Trombose/etiologia , Trombose/imunologia , Adulto JovemRESUMO
We report our experience of surgical treatment for instability of flail knees after poliomyelitis in 228 patients. We made carefully selective use of soft-tissue release, extension osteotomy of the femur, and a patellar bone block for hyperextension. After six to nine years follow-up, 87% of the patients had retained significant improvement in stability and walking ability.
Assuntos
Articulação do Joelho/cirurgia , Poliomielite/complicações , Adolescente , Adulto , Feminino , Fêmur/cirurgia , Seguimentos , Humanos , Artropatias/etiologia , Artropatias/patologia , Artropatias/cirurgia , Articulação do Joelho/patologia , Masculino , Métodos , Osteotomia/métodos , Patela/cirurgia , CaminhadaRESUMO
We investigated the relationship between the synthesis of bacterial magnetic particles (BMPs) and the transcription of magA gene-encoding iron transport protein using synchronous culture of Magnetospirillum magneticum AMB-1. Synchronously cultured cells were subjected to transmission electron microscopic observation and fluorescence in situ hybridization. The average number of BMPs slowly increased in the cell with increasing cell size. A sharp increase in BMPs occurred just before cell division and resulted in maximum BMP production of 30 particles/cell. The transcription of magA was regulated immediately before and after cell division.
Assuntos
Rhodospirillaceae/citologia , Rhodospirillaceae/metabolismo , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Biotecnologia , Proteínas de Transporte de Cátions/genética , Proteínas de Transporte de Cátions/metabolismo , Ciclo Celular , Óxido Ferroso-Férrico , Hibridização in Situ Fluorescente , Ferro/metabolismo , Magnetismo , Microscopia Eletrônica , Óxidos/metabolismo , RNA Bacteriano/genética , RNA Bacteriano/metabolismo , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Rhodospirillaceae/genética , Sulfetos/metabolismoRESUMO
From March 1983 to December 1989, day care operations were done for 12099 children (inguinal hernia 10913, hydrocele 1186) aging from 6 months to 13 years (75.9% of the children were under three). The postoperative complication rate was 0.84% and 15 children (0.12%) required hospitalization. The procedures and indications of the two operations and measures to prevent postoperative complications are discussed. We consider that day care surgery is safe and effective in minimizing the psychological burden of hospitalization, reducing hospital costs and decreasing the risk of cross-infection.
Assuntos
Procedimentos Cirúrgicos Ambulatórios/métodos , Hérnia Inguinal/cirurgia , Hidrocele Testicular/cirurgia , Adolescente , Criança , Pré-Escolar , Feminino , Humanos , Lactente , Masculino , Complicações Pós-Operatórias , RecidivaRESUMO
It is generally accepted that the major autoantigen for antiphospholipid antibodies (aPL) is beta(2)glycoprotein I (beta(2)GPI). Interestingly, some aPL bind to beta(2)GPI and the homologous enzymatic domains of several proteases involved in hemostasis and fibrinolysis, and correspondingly hinder anticoagulant regulation and resolution of clots. These findings are consistent with several early findings of aPL and provide a new perspective about some aPL in terms of their binding specificities and related functional properties in promoting thrombosis. In addition, homologous enzymatic domains of the involved proteases share conformation epitope(s) with beta(2)GPI, thus providing a possible structural basis for some non-mutually exclusive mechanisms of aPL-mediated thrombosis.
Assuntos
Anticorpos Antifosfolipídeos/fisiologia , Reações Antígeno-Anticorpo/fisiologia , Síndrome Antifosfolipídica/complicações , Fibrinólise/fisiologia , Serina Endopeptidases/fisiologia , Trombose/etiologia , Síndrome Antifosfolipídica/patologia , Síndrome Antifosfolipídica/fisiopatologia , Fatores de Coagulação Sanguínea/fisiologia , Humanos , Fosfolipídeos/fisiologiaRESUMO
Growth conditions for mass production of luciferase-bacterial magnetic particles (BMPs) by a recombinant Magnetospirillum magneticum AMB-1 were investigated in a pH-regulated fed-batch culture system. Enrichment of growth medium with L-cysteine, yeast extract and polypeptone enhanced both bacterial growth and BMP production. The presence of L-cysteine in the medium was useful for induction of cell growth. Strict anaerobic conditions led to a prolonged lag phase and limited the final cell density. Trace oxygen enhanced cell growth with increasing BMP production. As iron sources, ferrous sulfate and ferric gallate dramatically enhanced BMP yield as compared with ferric quinate, an iron chelate conventionally used. The optimized conditions increased cell density to 0.59 +/- 0.03 g cell dry weight/liter and BMP production to 14.8 +/- 0.5 mg dry weight/liter in fed-batch culture for four days.
RESUMO
Two kinds of plasmid expression vectors which expressed beta 2-glycoprotein 1 (beta 2GP1) and the fifth domain of beta 2-glycoprotein 1 (beta 2GP1-D5) were constructed respectively in this study. The antigenicity of recombinant beta 2GP1 (r beta 2GP1) and beta 2GP1-D5 (r beta 2GP1-D5) was identified by immunoblots using rabbit anti-beta 2GP1 antibodies, and the recombinant proteins were purified. Both anti-r beta 2GP1 and anti-beta 2GP1-D5 antibodies in 112 patients were detected by ELISA using r beta 2GP1 and r beta 2GP1-D5 as coating antigens. A significant statistical correlation (r = 0.667, P < 0.01) between the levels of anti-beta 2GP1 and anticardiolipin (ACL) antibodies was found. The presence of anti-r beta 2GP1 antibodies was associated with an increased frequency of history of thrombosis and/or recurrent abortion; hence anti-r beta 2GP1 assay provided better specificity than conventional ACL assay. Detection of anti-r beta 2GP1 antibodies may be of potential value in evaluating the risk of thrombosis and/or symptoms associated with other antiphospholipid syndromes (APS). The binding of anti-r beta 2GP1 from the sera of patients with APS to r beta 2GP1 was inhibited by r beta 2GP1-D5. Meanwhile, of 28 patients who had positive anti-r beta 2GP1 antibodies in sera, 27 (96.4%) had positive anti-r beta 2GP1-D1 antibodies. This indicated that the antigenic epitope of beta 2GP1 may be located in its fifth domain.
Assuntos
Apolipoproteínas/imunologia , Autoanticorpos/análise , Glicoproteínas/imunologia , Lúpus Eritematoso Sistêmico/imunologia , Proteínas Recombinantes de Fusão/imunologia , Aborto Habitual/imunologia , Anticorpos Anticardiolipina/análise , Clonagem Molecular , Primers do DNA/química , Ensaio de Imunoadsorção Enzimática , Feminino , Glicoproteínas/biossíntese , Glicoproteínas/genética , Humanos , Imunoglobulina G/análise , Lúpus Eritematoso Sistêmico/complicações , Plasmídeos , Reação em Cadeia da Polimerase , Gravidez , RNA/análise , Proteínas Recombinantes de Fusão/biossíntese , Proteínas Recombinantes de Fusão/genética , Recidiva , Trombose/imunologia , beta 2-Glicoproteína IRESUMO
Two additives, phenol, 2,6-bis(1,1-dimethylethyl)-4-methyl- and triphenyl phosphate with mass ratio of less than one thousandth in special super-high pressure hydraulic oil were determined by GC-MS. Tributyl phosphate ester was used as internal standard. The correction factor of each additive was determined before analysis. Each sample was analysed for 5 times to get good precision. It is satisfactory to use SIM as the detecting mode, and the CVs of correction factors and mass ratio were about 5%. The problems of how to select the monitoring ion in SIM mode and the sample size required are discussed in this paper. This method is satisfactory in analyzing low mass ratio constituents in a mixture.