GTPBP8 modulates mitochondrial fission through a Drp1-dependent process.

Mitochondrial fission is a tightly regulated process involving multiple proteins and cell signaling. Despite extensive studies on mitochondrial fission factors, our understanding of the regulatory mechanisms remains limited. This study shows the critical role of a mitochondrial GTPase, GTPBP8, in orchestrating mitochondrial fission in mammalian cells. Depletion of GTPBP8 resulted in drastic elongation and interconnectedness of mitochondria. Conversely, overexpression of GTPBP8 shifted mitochondrial morphology from tubular to fragmented. Notably, the induced mitochondrial fragmentation from GTPBP8 overexpression was inhibited in cells either depleted of the mitochondrial fission protein Drp1 (also known as DNM1L) or carrying mutated forms of Drp1. Importantly, downregulation of GTPBP8 caused an increase in oxidative stress, modulating cell signaling involved in the increased phosphorylation of Drp1 at Ser637. This phosphorylation hindered the recruitment of Drp1 to mitochondria, leading to mitochondrial fission defects. By contrast, GTPBP8 overexpression triggered enhanced recruitment and assembly of Drp1 at mitochondria. In summary, our study illuminates the cellular function of GTPBP8 as a pivotal modulator of the mitochondrial division apparatus, inherently reliant on its influence on Drp1.

The Transcription Factor Zfp335 Promotes Differentiation and Survival of Effector Th1 Cells by Directly Regulating Lmna Expression.

Ag-specific effector CD4+ T cells play a crucial role in defending against exogenous pathogens. However, the mechanisms governing the differentiation and function of IFN-γ-producing effector CD4+ Th1 cells in immune responses remain largely unknown. In this study, we elucidated the pivotal role of zinc finger protein 335 (Zfp335) in regulating effector Th1 cell differentiation and survival during acute bacterial infection. Mice with Zfp335 knockout in OT-II cells exhibited impaired Ag-specific CD4+ T cell expansion accompanied by a significant reduction in resistance to Listeria infection. Furthermore, Zfp335 deficiency restricted the effector CD4+ Th1 cell population and compromised their survival upon Listeria challenge. The expression of T-bet and IFN-γ was accordingly decreased in Zfp335-deficient Th1 cells. Mechanistically, Zfp335 directly bound to the promoter region of the Lmna gene and regulated its expression. Overexpression of Lmna was able to rescue the survival and function of Zfp335-deficient effector Th1 cells. Therefore, our study provides novel insights into the mechanisms governing effector Th1 cell differentiation and survival during acute infection.

Ethylene Methoxycarbonylation over Heterogeneous Pt1/MoS2 Single-Atom Catalyst: Metal-Support Concerted Catalysis.

Ethylene methoxycarbonylation (EMC) to methyl propanoate (MP) is an industrially important reaction and commercially uses a homogeneous Pd-phosphine organometallic complex as the catalyst and corrosive strong acid as the promoter. In this work, we develop a Pt1/MoS2 heterogeneous single-atom catalyst (SAC) which exhibits high activity, selectivity, and good recyclability for EMC reaction without need of any liquid acid. The production rate of MP achieves 0.35 gMP gcat-1 h-1 with MP selectivity of 91.1% at 1 MPa CO, 1 MPa C2H4, and 160 °C, which can be doubled at 2 MPa CO and corresponds to 320.1 molMP molPt-1 h-1, at least 1 order of magnitude higher than the earlier reported heterogeneous catalyst and even comparable to some of homogeneous catalyst. Advanced characterizations and DFT calculations reveal that all the Pt single atoms are located at the Mo vacancies along the Mo edge of the MoS2 nanosheets, forming pocket-like Mo-S-Pt1-S-Mo ensembles with uniform and well-defined structure. Methanol is first adsorbed and dissociated on Mo sites, and the produced H spillovers to the adjacent Pt site forming Pt-H species which then activate ethylene, forming Pt-ethyl species. Meanwhile, CO adsorbed on the other Mo site reacts with the Pt-ethyl species, yielding propionyl species, and this carbonylation is the rate-determining step. The final methoxylation step proceeds via the nucleophilic attack of propionyl species by -OCH3 affording the final product MP. Such a metal-support concerted catalysis enabled by the Mo-S-Pt1-S-Mo multisite ensemble opens a new avenue for SACs to promote the multimolecular reactions that prevail in homogeneous catalysis.

TGF-ß1-Induced LINC01094 promotes epithelial-mesenchymal transition in hepatocellular carcinoma through the miR-122-5p/TGFBR2-SAMD2-SMAD3 Axis.

Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. It has been proven that long non-coding RNAs (lncRNAs) play an essential role in regulating HCC progression. However, the involvement of LINC01094 in regulating epithelial-mesenchymal transition (EMT) in HCC remains unclear. LINC01094 expression in HCC patients was retrieved from the Cancer Genome Atlas database. Overexpressing and downregulating LINC01094 were conducted to investigate its biological functions using Hep3B, SNU-387, and HuH-7 cells. Western blotting and morphological observation were performed to study the EMT in HCC cells. Transwell assay was adopted to determine the migration and invasion of HCC cells. The underlying mechanism of competitive endogenous RNAs (ceRNAs) was investigated using bioinformatics analysis, quantitative reverse-transcription polymerase chain reaction, and rescue experiments. Elevated LINC01094 expression was observed in HCC and associated with a poor prognosis. Knockdown of LINC01094 expression in SNU-387 and HuH-7 cells could inhibit migration, invasion, and EMT markers. Overexpression of LINC01094 indicated that LINC01094 promoted EMT via the TGF-ß/SMAD signaling pathway. The bioinformatics analysis revealed that miR-122-5p was a target of LINC01094. The miRWalk database analysis showed that TGFBR2, SMAD2, and SMAD3 were downstream targets of miR-122-5p. Mechanically, LINC01094 acted as a ceRNA that facilitated HCC metastasis by sponging miR-122-5p to regulate the expression of TGFBR2, SMAD2, and SMAD3. Further, TGF-ß1 could enhance the expression of LINC01094, forming a positive feedback loop. TGF-ß1-induced LINC01094 expression promotes HCC cell migration and invasion by targeting the miR-122-5p/TGFBR2-SMAD2-SMAD3 axis. LINC01094 may be a potential prognostic biomarker and therapeutic target for HCC metastasis.

Quantifying carboxymethyl lysine and carboxyethyl lysine in human plasma: clinical insights into aging research using liquid chromatography-tandem mass spectrometry.

OBJECTIVE: The objective of this study was to establish a methodology for determining carboxymethyl lysine (CML) and carboxyethyl lysine (CEL) concentrations in human plasma using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The test results were also used for clinical aging research. METHODS: Human plasma samples were incubated with aqueous perfluorovaleric acid (NFPA), succeeded by precipitation utilizing trichloroacetic acid, hydrolysis facilitated by hydrochloric acid, nitrogen drying, and ultimate re-dissolution utilizing NFPA, followed by filtration. Cotinine-D3 was added as an internal standard. The separation was performed on an Agela Venusil ASB C18 column (50 mm × 4.6 mm, 5 µm) with a 5 mmol/L NFPA and acetonitrile/water of 60:40 (v/v) containing 0.15% formic acid. The multiple reaction monitoring mode was used for detecting CML, CEL, and cotinine-D3, with ion pairs m/z 205.2 > 84.1 (for quantitative) and m/z 205.2 > m/z 130.0 for CML, m/z 219.1 > 84.1 (for quantitative) and m/z 219.1 > m/z 130.1 for CEL, and m/z 180.1 > 80.1 for cotinine-D3, respectively. RESULTS: The separation of CML and CEL was accomplished within a total analysis time of 6 minutes. The retention times of CML, CEL, and cotinine-D3 were 3.43 minutes, 3.46 minutes, and 4.50 minutes, respectively. The assay exhibited linearity in the concentration range of 0.025-1.500 µmol/L, with a lower limit of quantification of 0.025 µmol/L for both compounds. The relative standard deviations of intra-day and inter-day were both below 9%, and the relative errors were both within the range of ±4%. The average recoveries were 94.24% for CML and 97.89% for CEL. CONCLUSION: The results indicate that the developed methodology is fast, highly sensitive, highly specific, reproducible, and suitable for the rapid detection of CML and CEL in clinical human plasma samples. The outcomes of the clinical research project on aging underscored the important indicative significance of these two indicators for research on human aging.

Customizable Click Biochemistry Strategy for the Design and Preparation of Glucagon-like Peptide-1 Conjugates and Coagonists.

The development of oligomeric glucagon-like peptide-1 (GLP-1) and GLP-1-containing coagonists holds promise for enhancing the therapeutic potential of the GLP-1-based drugs for treating type 2 diabetes mellitus (T2DM). Here, we report a facile, efficient, and customizable strategy based on genetically encoded SpyCatcher-SpyTag chemistry and an inducible, cleavable self-aggregating tag (icSAT) scheme. icSAT-tagged SpyTag-fused GLP-1 and the dimeric or trimeric SpyCatcher scaffold were designed for dimeric or trimeric GLP-1, while icSAT-tagged SpyCatcher-fused GLP-1 and the icSAT-tagged SpyTag-fused GIP were designed for dual GLP-1/GIP (glucose-dependent insulinotropic polypeptide) receptor agonist. These SpyCatcher- and SpyTag-fused protein pairs were spontaneously ligated directly from the cell lysates. The subsequent icSAT scheme, coupled with a two-step standard column purification, resulted in target proteins with authentic N-termini, with yields ranging from 35 to 65 mg/L and purities exceeding 99%. In vitro assays revealed 3.0- to 4.1-fold increased activities for dimeric and trimeric GLP-1 compared to mono-GLP-1. The dual GLP-1/GIP receptor agonist exhibited balanced activity toward the GLP-1 receptor or the GIP receptor. All the proteins exhibited 1.8- to 3.0-fold prolonged half-lives in human serum compared to mono-GLP-1 or GIP. This study provides a generally applicable click biochemistry strategy for developing oligomeric or dual peptide/protein-based drug candidates.

Legumain-Triggered Macrocyclization of Radiofluorinated Tracer for Enhanced PET Imaging.

Enhancing the accumulation and retention of small-molecule probes in tumors is an important way to achieve accurate cancer diagnosis and therapy. Enzyme-stimulated macrocyclization of small molecules possesses great potential for enhanced positron emission tomography (PET) imaging of tumors. Herein, we reported an 18F-labeled radiotracer [18F]AlF-RSM for legumain detection in vivo. The tracer was prepared by a one-step aluminum-fluoride-restrained complexing agent ([18F]AlF-RESCA) method with high radiochemical yield (RCY) (88.35 ± 3.93%) and radiochemical purity (RCP) (>95%). More notably, the tracer can be transformed into a hydrophobic macrocyclic molecule under the joint action of legumain and reductant. Simultaneously, the tracer could target legumain-positive tumors and enhance accumulation and retention in tumors, resulting in the amplification of PET imaging signals. The enhancement of radioactivity enables PET imaging of legumain activity with high specificity. We envision that, by combining this highly efficient 18F-labeled strategy with our intramolecular macrocyclization reaction, a range of radiofluorinated tracers can be designed for tumor PET imaging and early cancer diagnosis in the future.

Identification of key genes associated with cervical cancer based on bioinformatics analysis.

BACKGROUND: Cervical cancer has extremely high morbidity and mortality, and its pathogenesis is still in the exploratory stage. This study aimed to screen and identify differentially expressed genes (DEGs) related to cervical cancer through bioinformatics analysis. METHODS: GSE63514 and GSE67522 were selected from the GEO database to screen DEGs. Then GO and KEGG analysis were performed on DEGs. PPI network of DEGs was constructed through STRING website, and the hub genes were found through 12 algorithms of Cytoscape software. Meanwhile, GSE30656 was selected from the GEO database to screen DEMs. Target genes of DEMs were screened through TagetScan, miRTarBase and miRDB. Next, the hub genes screened from DEGs were merged with the target genes screened from DEMs. Finally, ROC curve and nomogram analysis were performed to assess the predictive capabilities of the hub genes. The expression of these hub genes were verified through TCGA, GEPIA, qRT-PCR, and immunohistochemistry. RESULTS: Six hub genes, TOP2A, AURKA, CCNA2, IVL, KRT1, and IGFBP5, were mined through the protein-protein interaction network. The expression of these hub genes were verified through TCGA, GEPIA, qRT-PCR, and immunohistochemistry, and it was found that TOP2A, AURKA as well as CCNA2 were overexpressed and IGFBP5 was low expression in cervical cancer. CONCLUSIONS: This study showed that TOP2A, AURKA, CCNA2 and IGFBP5 screened through bioinformatics analysis were significantly differentially expressed in cervical cancer samples compared with normal samples, which might be biomarkers of cervical cancer.

Near-infrared fluorescence-assisted superficial inguinal lymph-node excision for low-risk penile cancer.

OBJECTIVE: Identification of superficial inguinal lymph nodes during low-risk penile cancer surgery using near-infrared (NIR) fluorescence to improve the accuracy of lymph-node dissection and reduce the incidence of missed micrometastases and complications. METHODS: Thirty-two cases were selected, which were under the criteria of < T1, and no lymph-node metastasis was found with magnetic resonance imaging (MRI) detection. Two groups were randomly divided based on the fluorescence technique, the indocyanine green (ICG) group and the non-ICG group. In the ICG group, the ICG preparation was subcutaneously injected into the edge of the penile tumor 10 min before surgery, and the near-infrared fluorescence imager was used for observation. After the lymph nodes were visualized, the superficial inguinal lymph nodes were removed first, and then, the penis surgery was performed. The non-ICG group underwent superficial inguinal lymph-node dissection and penile surgery. RESULTS: Among the 16 patients in the ICG group, we obtained 11 lymph-node specimens using grayscale values of images (4.13 ± 0.72 vs. 3.00 ± 0.82 P = 0.003) along with shorter postoperative healing time (7.31 ± 1.08 vs. 8.88 ± 2.43 P = 0.025), and less lymphatic leakage (0 vs. 5 P = 0.04) than the 16 patients in the non-ICG group. Out of 11, 3 lymph nodes that are excised were further grouped into fluorescent and non-fluorescent regions (G1/G2) and found to be metastasized. CONCLUSION: Near-infrared fluorescence-assisted superficial inguinal lymph-node dissection in penile carcinoma is accurate and effective, and could reduce surgical complications.

Engineering quorum sensing-based genetic circuits enhances growth and productivity robustness of industrial E. coli at low pH.

BACKGROUND: Microbial organisms hold significant potential for converting renewable substrates into valuable chemicals. Low pH fermentation in industrial settings offers key advantages, including reduced neutralizer usage and decreased wastewater generation, particularly in the production of amino acids and organic acids. Engineering acid-tolerant strains represents a viable strategy to enhance productivity in acidic environments. Synthetic biology provides dynamic regulatory tools, such as gene circuits, facilitating precise expression of acid resistance (AR) modules in a just-in-time and just-enough manner. RESULTS: In this study, we aimed to enhance the robustness and productivity of Escherichia coli, a workhorse for amino acid and organic acid production, in industrial fermentation under mild acidic conditions. We employed an Esa-type quorum sensing circuit to dynamically regulate the expression of an AR module (DsrA-Hfq) in a just-in-time and just-enough manner. Through careful engineering of the critical promoter PesaS and stepwise evaluation, we developed an optimal Esa-PBD(L) circuit that conferred upon an industrial E. coli strain SCEcL3 comparable lysine productivity and enhanced yield at pH 5.5 compared to the parent strain at pH 6.8. CONCLUSIONS: This study exemplifies the practical application of gene circuits in industrial environments, which present challenges far beyond those of well-controlled laboratory conditions.

LncRNA-mir3471-limd1 regulatory network plays critical roles in HIBD.

The purpose of this study was to identify the target genes of tcon_00044595, elucidate its activation site, and provide novel insights into the pathogenesis and treatment of neonatal hypoxic-ischemic brain damage (HIBD). Through homologous blast analysis, we identified predicted target sequences in the neighboring regions of the long non-coding RNA (lncRNA) tcon_00044595, suggesting that limd1 is its target gene. Starbase was utilized to identify potential candidate microRNAs associated with the lncRNA. The interaction between the candidate microRNAs and limd1 was investigated and validated using various experimental methods including in vitro cell culture, cell transfection, dual fluorescence reporter detection system, and real-time PCR. Homology alignment analysis revealed that the lncRNA tcon_00044595 exhibited a 246 bp homologous sequence at the 3' end of the adjacent limd1 gene, with a conservation rate of 68%. Analysis conducted on Starbase online identified three potential microRNA candidates: miR-3471, miR-883a-5p, and miR-214-3p. Intracellular expression of the limd1 gene was significantly down-regulated upon transfection with miR-3471, while the other two microRNAs did not produce noticeable effects. Luciferase reporter assays identified two interaction sites (UTR-1, UTR-2) between miR-3471 and the limd1 3'UTR, with UTR-1 exhibiting a strong influence. Further CCK8 assay indicated a protective role of miR-3471 during low oxygen stroke in HIBD. The potential regulatory relationship between lncRNA (tcon_00044595), miR-3471, and the target gene limd1 suggests their involvement in the occurrence and development of HIBD, providing new insights for investigating the underlying mechanisms and exploring targeted therapeutic approaches for HIBD.

The Transcription Factor Zfp335 Promotes Differentiation and Persistence of Memory CD8+ T Cells by Regulating TCF-1.

Memory CD8+ T cells play an essential role in providing effective and lifelong protection against pathogens. Comprehensive transcriptional and epigenetic networks are involved in modulating memory T cell development, but the molecular regulations of CD8+ memory T cell formation and long-term persistence remain largely unknown. In this study, we show that zinc finger protein 335 (Zfp335) is indispensable for CD8+ T cell memory establishment and maintenance during acute infections. Mice with Zfp335 deletion in CD8+ T cells exhibit a significant reduction of memory T cells and memory precursor cells in the contraction phase. Zfp335 deficiency in CD8+ T cells resulted in decreased expression of memory featured genes Eomes and IL-2Rß, leading to a loss of memory identity and an increase of apoptosis in response to IL-7 and IL-15. Mechanistically, Zfp335 directly binds to and regulates TCF-1, known to be critical for memory T cell development. Importantly, overexpression TCF-1 could rescue the defects in the survival of both CD8+ memory precursors and memory T cells caused by Zfp335 deficiency. Collectively, our findings reveal that Zfp335 serves as a novel transcriptional factor upstream of TCF-1 in regulating CD8+ T cell memory.

Med1 Controls Effector CD8+ T Cell Differentiation and Survival through C/EBPß-Mediated Transcriptional Control of T-bet.

Effector CD8+ T cells are crucial players in adaptive immunity for effective protection against invading pathogens. The regulatory mechanisms underlying CD8+ T cell effector differentiation are incompletely understood. In this study, we defined a critical role of mediator complex subunit 1 (Med1) in controlling effector CD8+ T cell differentiation and survival during acute bacterial infection. Mice with Med1-deficient CD8+ T cells exhibited significantly impaired expansion with evidently reduced killer cell lectin-like receptor G1+ terminally differentiated and Ly6c+ effector cell populations. Moreover, Med1 deficiency led to enhanced cell apoptosis and expression of multiple inhibitory receptors (programmed cell death 1, T cell Ig and mucin domain-containing-3, and T cell immunoreceptor with Ig and ITIM domains). RNA-sequencing analysis revealed that T-bet- and Zeb2-mediated transcriptional programs were impaired in Med1-deficient CD8+ T cells. Overexpression of T-bet could rescue the differentiation and survival of Med1-deficient CD8+ effector T cells. Mechanistically, the transcription factor C/EBPß promoted T-bet expression through interacting with Med1 in effector T cells. Collectively, our findings revealed a novel role of Med1 in regulating effector CD8+ T cell differentiation and survival in response to bacterial infection.

Xiangchun 37, a spring soybean variety with multiplexed traits of medium maturity period, high yield, and high seed oil content.

Soybean is an indispensable crop producing the majority of vegetative oils and proteins. China has been importing millions of ton of soy beans in recent years. Developing new varieties with favorable traits in both yield and resilience has great potential to meet the market needs in China. In this study, we bred a new variety (Xiangchun 37) which has been licensed by Ministry of Agriculture and Rural Affairs of the People's Republic of China in 2024. In the field tests, Xiangchun 37 showed medium maturity period (107.4 days from sowing to harvest), high yield (187.3 kg/667m2), and high seed oil content (22.19%). Overall assessment showed Xiangchun 37 had other favorable traits including the plant architecture and disease resistance. In conclusion, Xiangchun 37 is a new variety suitable for Hunan Province, China and has promising future for further genetic improvement as a germplasm with multiple favorable traits. Supplementary Information: The online version contains supplementary material available at 10.1007/s11032-024-01505-5.

RAP1 is essential for silencing telomeric variant surface glycoprotein genes in Trypanosoma brucei.

Trypanosoma brucei expresses variant surface glycoprotein (VSG) genes in a strictly monoallelic fashion in its mammalian hosts, but it is unclear how this important virulence mechanism is enforced. Telomere position effect, an epigenetic phenomenon, has been proposed to play a critical role in VSG regulation, yet no telomeric protein has been identified whose disruption led to VSG derepression. We now identify tbRAP1 as an intrinsic component of the T. brucei telomere complex and a major regulator for silencing VSG expression sites (ESs). Knockdown of tbRAP1 led to derepression of all VSGs in silent ESs, but not VSGs located elsewhere, and resulted in stronger derepression of genes located within 10 kb from telomeres than genes located further upstream. This graduated silencing pattern suggests that telomere integrity plays a key role in tbRAP1-dependent silencing and VSG regulation.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Research and Analysis of Molecules such as CD28, CD45RA, CD45RO, CD38, HLA-DR, and CD57 on T Cells in Multiple Myeloma.

BACKGROUND: For many years it has been postulated that the immune system controls the progress of multiple myeloma (MM). However, the phenotypes of T cells in MM remain to be elucidated. In this study, we compared the phenotypes of T cells, which were obtained from the peripheral blood, in MM patients with those in healthy donors (HD). The expression of CCR7, CD57, CD28, HLA-DR, CD38, CD45RA, and CD45RO were assessed on T cells from MM patients and HDs using multicolor flow cytometry (MFC). METHODS: For this study, 17 newly diagnosed MM patients were selected, and 20 healthy people were selected as a control group. MFC was used to detect the markers on T cells. RESULTS: We detected significant increases in the expression levels of HLA-DR, CD38, and CD57on CD8+ T cells, significant decreases in the expression levels of CD28 and CD45RA on CD8+ T cells, and a decrease of CD4+ effec-tor T cells in MM patients, compared to the HD group. CONCLUSIONS: Our study shows that the accumulation of peripheral CD8+CD57+T cells, CD8+CD38high T cells, and CD8+HLA-DR+CD38high T cells is reflective of an ongoing antitumor T cell response and a progressive immune dysfunction in MM. During chemotherapy, the recovery of immune function can be monitored by detecting the proportion of activated molecules of T lymphocytes.

Analysis of Th1/Th2 Balance and Related Cytokine Changes in the Peripheral Blood of Patients with Multiple Myeloma.

BACKGROUND: This study aimed to explore the changes in Th cells and cytokines in the peripheral blood of patients with multiple myeloma before and after treatment and at the time of the bacterial infection. METHODS: In total, 23 newly diagnosed MM patients admitted to the Hospital and 23 healthy individuals were selected as the study group and the control group, respectively. Flow cytometry was used to detect the Th1 and Th2 lymphocytes and cytokines, such as IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, INF-γ, IL-17A, IL-1b, TNF-α, TNF-ß, and IL-12P70, in the peripheral blood of the patients at initial diagnosis, before and after treatment, and at the time of the bacterial infection. RESULTS: The Th1% and Th1/Th2 ratio at the time of the initial diagnosis were lower in the MM patients than in the control group, whereas the Th2% at initial diagnosis was higher in the MM patients than in the control group. The levels of IL-6, IL-8, IL-10, and IL-17A at initial diagnosis were higher in the MM patients than in the control group. After 4 cycles of treatment, the Th2% in the patients was lower than before the treatment and the Th1/Th2 ratio in the patients was higher than before the treatment. The Th1% and the levels of IL-6, IL-8, IL-10, and INF-γ increased, while the level of IL-12P70 decreased, when MM patients got a bacterial infection. The abovementioned differences were statistically significant (p < 0.05). CONCLUSIONS: The Th1/Th2 deviation affects the immune function of the MM patients. There were significant changes in the Th1 and Th2 lymphocytes and cytokines in newly diagnosed MM patients after the treatment. The changes in the Th lymphocytes and cytokines may be an indicator of bacterial infection.

AML with RUNX1::RUNX1T1 Cooperating two Mutations Relapsed Quickly after Achieving CR.

BACKGROUND: Acute myeloid leukemia (AML) with t(8;21)(q22;q22.1); RUNX1::RUNX1T1 has a relatively favorable prognosis with a high complete remission rate and long disease-free survival. METHODS AND RESULTS: Here we describe a patient who had AML with t(8;21)(q22;q22.1); RUNX1::RUNX1T1. Cooperating mutations including KRAS and ASXL1, and with other abnormal karyotype del(17) and with a myelomonocytic differentiation. CONCLUSIONS: The patient relapsed despite achieving a morphologic complete remission (CR).

Investigation of Clinical Value of NKT-like Cells in Tumor Diseases.

BACKGROUND: The goal is to study the changes of natural killer T-like (NKT-like) cells with age and explore the value of NKT-like cell changes in the evaluation of immune function and prognosis of tumor patients. METHODS: From January 2021 to December 2021, 19 patients with lung cancer, 37 patients with lymphoma, 16 patients with multiple myeloma (MM), 13 patients with acute lymphoblastic leukemia (ALL), 70 patients with acute myeloid leukemia (AML) treated in the Affiliated Hospital of Chengde Medical College and 141 healthy volunteers included in the healthy control group were recruited to study the change trend of NKT-like cells with age and changes in different tumor patients. RESULTS: With the increase of age, NKT-like cells in peripheral blood increased gradually in healthy people, mainly composed of CD8+NKT-like cells and CD8-CD4-NKT-like cells. The proportion of NKT-like cells in the lymphoma group and AML group was significantly higher than that in the control group (p < 0.05). The proportion of CD8+NKT-like cells decreased in the Lymphoma, AML, ALL, and lung cancer groups (p < 0.05), there was no statistical significance between MM group and control group (p > 0.05). CONCLUSIONS: With the increase of age, NKT-like cells in peripheral blood gradually increased in healthy people and were mainly composed of CD8+NKT-like cells and CD8-CD4-NKT-like cells. The increase of CD8+NKT-like cells in peripheral blood has important reference value for the evaluation of immune function and prognosis of patients with lymphoma, AML, ALL, and lung cancer and provides direction for immunotherapy.