Translational level is a critical factor for the secretion of heterologous proteins in Escherichia coli.

A method for enhancing the secretion of heterologous proteins in Escherichia coli by optimizing, as opposed to simply maximizing, the translational level of a given protein is described. Random alteration of the translational initiation region (TIR) of the Heat-Stable Enterotoxin II (STII) signal sequence resulted in a library of vectors with varied translational strengths. Subsequent screening of this library using E. coli alkaline phosphatase as a reporter led to the selection of several TIR variants covering a 10-fold range of translational strength. These TIR variants, in combination with several previously generated variants, are shown to dramatically improve the secretion of a number of heterologous proteins. In fact, the heterologous proteins tested required a narrow translational range for optimal high-level secretion into the periplasm. Interestingly, the secretion of two native E. coli proteins was unaffected by TIR strength when tested over an identical range. The dependence of secretion on a narrow translational level demonstrates its critical role in the secretion of heterologous proteins in E. coli.

Overexpression of the retinoic acid-responsive gene Stra6 in human cancers and its synergistic induction by Wnt-1 and retinoic acid.

Genetic defects in the Wnt-1 signaling pathway contribute to human tumor progression and are especially prevalent in colorectal cancer. We screened mouse C57MG cells to isolate mRNAs induced by Wnt-1 and identified Stra6, an mRNA known to be up-regulated by retinoic acid. Up-regulation of Stra6 mRNA was also observed in hyperplastic mammary tissue and mammary gland tumors from transgenic mice expressing Wnt-1 and in human tumors that frequently harbor defects in Wnt-1 signaling. Stimulation of C57MG cells with retinoic acid plus Wnt-1 resulted in expression of Stra6 transcript to levels greatly exceeding that observed with either stimulus alone. This synergy could be explained in part by the up-regulation of retinoic acid receptor-gamma that was observed in response to Wnt-1 signaling. Accordingly, treatment of human colorectal cancer cell lines with retinoic acid resulted in the up-regulation of Stra6 mRNA and accumulation of Stra6 protein at the cell membrane. The data support a model in which Wnt-1 signaling synergizes with retinoids to activate retinoic acid receptor-gamma-responsive genes in human cancers.

Construction of a vector for cloning promoters in Bacillus subtilis.

A versatile vector for cloning DNA fragments containing promoter activity in Bacillus subtilis was derived from plasmids pBR322, pUB110 and pC194. Selection is based on chloramphenicol resistance which is dependent upon the introduction of DNA fragments allowing expression of a chloramphenicol acetyl transferase gene. The plasmid contains a second selectable marker, neomycin resistance, and contains functional origins of replication for both B. subtilis and Escherichia coli.

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.

Expression in Escherichia coli of a chemically synthesized gene for a "mini-C" analog of human proinsulin.

A gene has been constructed which codes for an analog of human proinsulin in which the normal 35-amino acid connecting peptide is replaced by a "mini-C" peptide of six amino acids (Arg-Arg-Gly-Ser-Lys-Arg). The gene, composed of oligonucleotide fragments synthesized by the triester method, was cloned and expressed as a beta-galactosidase hybrid protein. The proinsulin analog was separated from beta-galactosidase by cyanogen bromide cleavage and purified. Controlled disulfide exchange in the S-sulfonate of the analog generated a molecule having high-pressure liquid chromatography (HPLC) and radioimmunoassay (RIA) behavior consistent with a proinsulin-like structure.

Application of the E. coli trp promoter.

The Escherichia coli tryptophan (trp) promoter has been used extensively for the high level production of proteins on a small and large scale. This regulated promoter is readily available, relatively easy to turn on, and can be used in essentially any E. coli host background. This article gives a detailed use of the trp promoter including the design of expression vectors, subsequent culture conditions for promoter induction, and, finally, a protocol for the most common way of detecting the newly synthesized protein of interest. Its successful use for heterologous protein expression, however, sometimes requires consideration of parameters other than transcription such as translation initiation, translation elongation, and proteolysis. In this respect we offer guidance in getting through these post-transcriptional problems, which can occur with the use of any promoter.

Dose-response evaluation of a genetically engineered foot-and-mouth disease virus polypeptide immunogen in cattle.

Four groups of 9 cattle each were vaccinated with 10, 50, 250, or 1,250 micrograms of foot-and-mouth disease (FMD) virus A12 VP1 fusion protein that was produced in Escherichia coli and emulsified in an oil adjuvant. The groups given the 10 and 50 micrograms of antigen were revaccinated at 15 weeks and were challenge exposed at 30 weeks; 5 of 9 and 7 of 9 cattle, respectively, were protected from FMD virus infection. The remaining 2 groups, vaccinated with 250 or 1,250 micrograms of antigen, were revaccinated at 32 weeks and were challenge exposed at 45 weeks; 8 of 9 and 9 of 9 cattle, respectively, were protected. The results indicated that the biosynthetic polypeptide FMD vaccine was effective using vaccination intervals frequently followed with conventional whole-virus vaccines.

Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis.

The Escherichia coli lac operator has been placed on the 3' side of the promoter for the penicillinase gene of Bacillus licheniformis, creating a hybrid promoter controllable by the E. coli lac repressor. The E. coli lac repressor gene has been placed under the control of a promoter and ribosome-binding site that allows expression in Bacillus subtilis. When the penicillinase gene that contains the lac operator is expressed in B. subtilis on a plasmid that also produces the lac repressor, the expression of the penicillinase gene can be modulated by isopropyl beta-D-thiogalactoside (IPTG), an inducer of the lac operon in E. coli. A similar system was constructed from a promoter of the B. subtilis phage SPO-1 and the leukocyte interferon A gene, which allowed the controlled expression of interferon in B. subtilis. These two examples show that a functional control system can be introduced into B. subtilis from E. coli.

Studies on gene control regions. 1. Chemical synthesis of lactose operator deoxyribonucleic acid segments.

The chemical synthesis of lactose operator DNA segments is described. The 31-base-paired duplex contains the DNA recognized by lac repressor protein and twofold rotationally symmetric base pairs on either side of the tight binding region. The synthesis includes the deoxyoligonucleotides d(T-G-T-G-G), d(A-A-T-T-G-T-G-A-G), d(C-G-G-A-T-A-A-C-A-A-T-T), d(T-C-A-C-A), d(T-G-T-G-A-A-A-T-T-G-T), d(T-A-T-C-C-G-C-T-C-A-C), and d(A-A-T-T-C-C-A-C-A). These deoxyoligonucleotides were characterized by two-dimensional sequencing techniques, paper chromatography, and thin-layer chromatography.

Studies on gene control regions. VI. The 5- methyl of thymine, a lac repressor recognition site.

Three site specific deoxyuridine analogs of lac operator were tested for binding with wild type (SQ) and tight binding (QX86) lac repressors. Insertion of uracil for thymine at site 13 (our nomenclature) significantly reduced the dissociation half-life of QX86 repressor for lac operator DNA (21 vs 1.2 min). Two other sites (6 and 7) are affected to a much lesser extent.

Binding of synthetic lactose operator DNAs to lactose represessors.

The nitrocellulose filter assay was used to study the interactions of wild-type (SQ) and tight-binding (QX86) lac repressors with synthetic lac operators 21 and 26 base pairs long. The repressor binding properties of both operators were very similar, indicating that both contain the same specific repressor recognition sites. The repressor-operator association rate constants (k(a)) were more sensitive than dissociation rate constants (k(d)) to changes in ionic strength. The responses of both k(a) and k(d) to ionic strength were relatively small compared to the effects previously observed with lambdah80dlac as operator DNA. These results suggest that under natural conditions there are electrostatic interactions between lac repressor and DNA regions outside of the 26 base pair operator sequence. Association rate constants for SQ repressor with either operator are higher than have been predicted for diffusion-limited reactions. We postulate that long-range electrostatic attractions between repressor and operator accelerate the association reaction. The presence of nonoperator DNA decreased association rate constants, the effect being more noticeable at an ionic strength of 0.05 M than at 0.20 M. Nonoperator DNA reduced k(a) values for associations involving QX86 repressor to a greater extent than for those with SQ repressor. The two types of repressors also had different rate constants for interactions with synthetic operators. The values for k(a) and k(d) were both higher with SQ repressor than with QX86 repressor. However, the rate constants were more sensitive to ionic strength when the repressor used was QX86.

Studies on gene control regions. 2. Enzymatic joining of chemically synthesized lactose operator deoxyribonucleic acid segments.

The T4 polynucleotide ligase catalyzed joining of six chemically synthesized deoxypolynucleotides corresponding to lactose operator DNA has been investigated. Joining was studied using various combinations of segments. Joining reactions involving multiple sites and the formation of duplex operator DNA were complete in a few hours. Joining reactions involving a single site and the formation of only one strand of operator DNA required several days and repeated annealing in order to go to completion. These studies have permitted the synthesis on a preparative scale (several nanomoles) of operator duplexes and operator single strands.

How lac repressor recognizes lac operator.

Nucleotide analogs were substituted for unmodified nucleotides at specific sites in the lac operator sequence by a combination of chemical and enzymatic procedures. The nitrocellulose filter assay was used to study the interactions of these modified operators with wild-type (SQ) and tight-binding (QX86) lac repressors. These studies implicate directly the 5 methyl of thymine and the 2 amino of guanine as important operator-repressor contact sites. Furthermore, when these findings are combined with published results from other laboratories, a model for the lac operator-lac repressor interaction can be derived. Two important postulates follow from this model. (i) The repressor interacts at specific and defined sites with the N7 of guanine, the 5 methyl of thymine, the 2 amino of guanine, and the central major groove of the operator. (ii) The repressor binds to one side of the operator.

Studies of gene control regions. III. Binding of synthetic and modified synthetic lac operator DNAs to lactose repressor.

Chemically synthesized lactose operator DNA was tested for binding with lactose repressor protein. These operator DNAs were found to (1) bind specifically to lactose SQ repressor as measured by release of binding with the inducing ligand isopropyl-beta-D-thiogalactoside, (2) have dissociation half-lives of 37 seconds (21 base-paired duplex) and 46 seconds (26 base-paired duplex) and (3) have dissociation half-lives with x86 repressor of 9 minutes (21 base-paired duplex) and 18 minutes (26 base paired duplex). Modified operators containing 5-bromodeoxyuridine and deoxyuridine at specific sites were also prepared. These analogs bound both repressors about as tightly as the wild type sequence.