Andrias davidianus ranavirus 1R encoding a delayed-early protein promotes cell proliferation by driving cell cycle progression into S phase.

Andrias davidianus ranavirus 1R (ADRV-1R), a core gene of the family Iridoviridae, is predicted to encode a viral transcription factor (vTF) since the protein contains a virus late transcription factor-3 like (VLTF3 like) domain. However, its characteristics and function are still unclear. In this study, the transcription and expression of ADRV-1R were investigated in Chinese giant salamander thymus cells (GSTCs). ADRV-1R transcription starts 6 hours post-infection (hpi), while the protein expression starts 8 hpi. Drug inhibition assay showed that the transcripts are inhibited by cycloheximide (CHX), a de novo protein synthesis inhibitor, indicating that ADRV-1R is a viral delayed-early (DE) gene. Subcellular localization showed that ADRV-1R is distributed in the cell nucleus and cytoplasm. The effect of ADRV-1R overexpression on cell proliferation and virus titer was analyzed. ADRV-1R overexpression significantly promoted the cell proliferation starting at day 2. Flow cytometry analysis further indicated that the protein promotes the GSTC cell cycle progression from G1 phase into S phase (G1/S transition). Moreover, ADRV-1R overexperession significantly increased ADRV titer in GSTCs. The virus titer was 6.3-6.9-fold higher at 36 hpi and further after than the control GSTC lines. These data showed that ADRV-1R is a delayed-early protein promoting cell proliferation and virus titers. Keywords: ranavirus; Andrias davidianus ranavirus; core gene; cell cycle; cell proliferations.

A simplified method for the simultaneous detection of nervous necrosis virus and iridovirus in grouper Epinephelus spp.

Grouper nervous necrosis virus (GNNV) and grouper iridovirus (GIV) are major grouper-infecting viruses in southern China that can cause serious economic losses. A duplex reverse transcription-PCR (duplex RT-PCR) method was developed for the simultaneous detection of GNNV and GIV. Eight groups of primers specifically targeting the capsid protein genes of GNNV and GIV were designed and analyzed. The primer set GN4 was selected and used to amplify fragments of 887 bp and 319 bp in length from GNNV and GIV, respectively. Furthermore, the duplex PCR assay was shown to be sensitive because it could detect at least 20 pg of plasmid-viral DNA from a mixture of viruses. Using this assay, 18 GNNV infected groupers and 7 GIV infected groupers were detected amongst 41 suspected samples in Hainan. The duplex RT-PCR assay proved to be a rapid, specific, and sensitive method for detecting the two grouper viruses. This method could be used to facilitate better control of fish viruses through early detection. Keywords: duplex reverse transcription-PCR; nervous necrosis virus; iridovirus; grouper.

First Report of Chilli ringspot virus on Chili Pepper in China.

Viral diseases have been a major limiting factor in the production of chili pepper (Capsicum chinense Jacp. cv. Yellow Lantern) in Hainan Province, China. In a 2009 disease survey, we found heavily infected fields of chili pepper exhibiting typical viral disease symptoms in three counties in Hainan. Total RNA was extracted from leaves of 14 randomly sampled plants and used as templates for reverse transcription (RT)-PCR using a pair of primers (forward 5' CGTAGACAACACACTCATGGT 3', reverse 5' GTTTTCCCAGTCACGAC(T)16 3') that were originally designed to detect Chilli veinal mottle virus (ChiVMV) (2). PCR fragments of 1.6 kb were amplified from the diseased but not the symptom-free samples and were subsequently sequenced. While most samples were found to be infected with ChiVMV, sequences of PCR fragments from three samples showed identities greater than 90% to two sequences of Chilli ringspot virus (ChiRSV), a member of Potyviridae, available in GenBank (Accession Nos. DQ925439 and DQ925438) (1), but less than 60% to that of the Hainan isolate of ChiVMV (Accession No. GQ981316), a distinct potyvirus (2). Furthermore, two of the samples contained one ChiRSV genotype while the third sample contained a different ChiRSV genotype, with a sequence identity of 91.7% between the two. Using these sequences, we subsequently designed a pair of primers (forward 5' TGGGATAGAGCATCTGAGC 3' and reverse 5' GAGTCATTTAGGTCATAATCAGTTT 3') for specific amplification of ChiRSV but not ChiVMV by RT-PCR. A ChiRSV-specific 0.6-kb DNA fragment was amplified from 8 of the 14 samples. Sequencing of these amplicons confirmed the presence of ChiRSV in these samples. Flexuous, rod-shaped virus particles, typical of the potyviruses, were observed by electron microscopy in the virion preparations purified from chili plants infected only with ChiRSV. Virion protein was purified and subjected to analysis by the MALDI-TOF/TOF tandem mass spectrometer (BGI, Shenzhen, China), yielding 35 peptide fragments that share the highest sequence homology to the coat protein of Vietnamese ChiRSV C8 and C9 isolates (GenBank Accession Nos. ABL09413 and ABL09414) (1) with protein sequence coverage of 61.8% and 52.9%, respectively. On the basis of these data, we concluded that the chili plants in Hainan were infected with ChiRSV. This virus was first reported in Vietnam in 2008 (1) but has not been found elsewhere. Leaves of the chili plants infected only with the Hainan isolate of ChiRSV displayed green banding along the main and major lateral veins, light interveinal chlorosis, and crinkling, similar to the symptoms of ChiVMV previously reported in Hainan (2). However, ChiVMV-infected leaves were notably more distorted than those infected by ChiRSV. We did not observe the characteristic ringspots described on ChiRSV-infected chili peppers in Vietnam (1). The difference in the symptoms may be accounted for by different ChiRSV genotypes, chili varieties, or a combination of both. The finding of two distinct viruses causing similar symptoms will help to improve identification and management of viral diseases on chili peppers. References: (1) C. Ha et al. Arch. Virol. 153:45, 2008. (2) J. Wang et al. Plant Dis. 90:377, 2006.

First Report of Leaf Spot Disease Caused by Exserohilum rostratum on Pineapple in Hainan Province, China.

Pineapple (Ananas comosus (L.) Merr.) is an important perennial monocotyledonous plant that serves as an important fruit crop globally and is also produced in the Hainan Province of China where production in 2009 was 296,600 t. In July 2009, atypical symptoms of a leaf spot disease were observed on mature pineapple leaves in Chengmai County; approximately 15% of plants propagated from suckers became symptomatic after 150 to 300 days, eventually causing a 3 to 10% yield loss. In the initial infection stage, grayish white-to-yellowish white spots emerged on the leaf surfaces that ranged from 1.0 to 2.4 × 0.3 to 0.7 cm; black specks were not always present in the spots. Leaf spots also had distinctive light brown-to-reddish brown banding pattern on the edges. Several spots would often merge to form large lesions, 6.5 to 15.4 × 2.5 to 5.6 cm, covering more than 67% of the leaf surface, which can lead to death of the plant. Infected pineapple leaves collected from an orchard of Chengmai County were surface sterilized (75% ethanol for 30 s, 0.1% HgCl2 for 2 min, and rinsed three times in sterile distilled water). Leaf pieces were placed on potato dextrose agar medium and then incubated at 25°C. The emerging fungal colonies were grayish white to brown. Similar strains were obtained from Qionghai City and Wanning City subsequently. Two isolates, ITF0706-1 and ITF0706-2, were used in confirmation of the identity of the pathogen and in pathogenicity tests. Colonies were fast growing (more than 15 mm per day at 25 to 30°C) with dense aerial mycelia. Conidia were fusiform, pyriform to oval or cylindrical, olive brown to dark brown, 3 to 10 septate (typically 5 to 8), 33.2 to 102.5 × 9.0 to 21.3 µm, with a strongly protruding hilum bulged from the basal cell, which were similar to the Type A conidia described by Lin et al. (3). The strains were subjected to PCR amplification of the internal transcribed spacer (ITS)1-5.8S-ITS2 regions with universal primer pair ITS1/ITS4. The ITS sequence comparisons (GenBank Accession Nos. JN711431 and JN711432) shared between 99.60 and 99.83% identity with the isolate CATAS-ER01 (GenBank Accession No. GQ169762). According to morphological and molecular analysis, the two strains were identified as Exserohilum rostratum (Drechs.) Leonard & Suggs. Pathogenicity experiments were conducted five times and carried out by spraying a conidial suspension (105 CFU/ml) on newly matured leaves of healthy pineapple plants; plants sprayed with sterile water served as the negative control. Plants were incubated in the growth chamber at 20 to 25°C. Symptoms of leaf spot developed on test plants 7 days after inoculation while the control plants remained asymptomatic. Koch's postulates were fulfilled with the reisolation of the two fungal strains. Currently, E. rostratum is one of the most common pathogens on Bromeliads in Florida (2) and has been reported on Zea mays (4), Musa paradisiacal (3), and Calathea picturata (1) in China, but to our knowledge, this is the first report of leaf spot disease caused by E. rostratum on pineapple in Hainan Province of P.R. China. References: (1) L. L. Chern et al. Plant Dis. 95:1033, 2011. (2) R. M. Leahy. Plant Pathol. Circ. No. 393. Florida Department of Agriculture and Consumer Services Division of Plant Industry, 1999. (3) S. H. Lin et al. Australas. Plant Pathol. 40:246, 2011. (4) J. N. Tsai et al. Plant Pathol. Bull. 10:181, 2001.

Light absorption, electron paramagnetic resonance and resonance Raman characteristics of nitridochromium(V) protoporphyrin-IX and its reconstituted hemoproteins.

A surprisingly stable complex of the photolyzed product of azidochromium(III)protoporphyrin-IX was prepared and examined by light absorption, electron paramagnetic resonance (EPR) and resonance Raman spectroscopies. The characteristic EPR spectrum for this complex was consistent with a nitridochromium(V)-porphyrin complex which was two oxidation equivalents above the resting Cr(III) complex. The Cr(V)-N stretching mode was observed at 1010 cm-1 by resonance Raman spectroscopy. A simple diatomic harmonic oscillation model gave a force constant of 6.7 mdyn/A for the Cr(V)-N bond, in the region characteristic for the metal-nitrogen triple bond. Nitridochromium(V) protoporphyrin-IX reconstituted myoglobin and cytochrome c peroxidase were prepared for the first time. The nitridochromium(V)-porphyrins in these apo-proteins were unstable in contrast with the protein-free chromium(V)porphyrin. Upon irradiation of the azide complexes of the chromium(III) protoporphyrin-IX reconstituted myoglobin and cytochrome c peroxidase with ultraviolet light aerobically at room temperature, the characteristic optical and EPR spectra for nitridochromium(V) derivatives were observed. The optical spectra of these photo-induced products were different from those of the nitridochromium(V) protoporphyrin-IX reconstituted hemoproteins. The electrochemical structures of the unusual metalloporphyrin seemed to be modulated by the heme surrounding amino acid residues.

Laser Raman spectra of oxidized hydroperoxidases.

Resonance Raman spectra of oxidized hydroperoxidases are examined for shifts in the structure-sensitive, anomalously polarized bands; these are found, respectively, at 1576, 1567 and 1570 cm-1 in the high-spin resting enzymes: horse radish peroxidase, horse blood catalase, and cytochrome c peroxidase. In compound II of horse radish peroxidase and horse blood catalase, and in the enzyme-substrate complex of cytochrome c peroxidase, this band appears at 1587-1590 cm-1 and indicates the iron atom is now in-plane with the porphyrin ring. Weak Raman scattering found with horse radish peroxidase I is consistant with a porphyrin eta-cation radical formulation.

Haem-rotational disorder in monomeric allosteric cyano-Met insect haemoglobins monitored by resonance Raman spectroscopy.

The haem-rotational disorder (insertion of haem into globin rotated about the alpha, gamma-meso axis by 180 degrees) has been investigated in the cyano-Met form of the monomeric allosteric insect haemoglobins, CTT III and CTT IV, by resonance Raman spectroscopy. The effect of haem disorder on the resonance Raman spectra has been observed in proto-IX, deutero-IX, and meso-IX CTTs. Most importantly, in the absence of overlapping vinyl vibrations, we have identified two Fe-C-N bending vibrations at 401 cm-1 and 422 cm-1 (pH 9.5) for 57Fe deutero-IX CTT IV ligated with 13C15N-, which are attributed to the two haem-rotational components. One Fe-C-N bending mode at 422 cm-1 shows a pH-induced shift to 424 cm-1 (pH 5.5) indicating the t----r conformational transition, whereas the other bending mode is pH-insensitive, representing a non-allosteric component. By replacing the unsymmetrical porphyrins with the "symmetrical" protoporphyrin-III we eliminate the haem disorder. Then, sharpening of the Fe-N epsilon(His) (at 313 cm-1) and Fe-CN (at 453 cm-1) stretching modes is observed and a single Fe-C-N bending mode (at 412 cm-1) appears. In cyano-Met proto-IX CTT III two vinyl bending vibrations at 412 cm-1 and 591 cm-1 assigned by deuteration of the vinyl groups also reflect the haem disorder. The 412 cm-1 vinyl vibration is intensity-enhanced via through-space coupling with one of the Fe-C-N bending modes (at 412 cm-1). In the cyano-Met form of proto-III CTT III this vinyl vibration is shifted to 430 cm-1 resulting in a dramatic drop in intensity. It is most likely that the specific vinyl-protein interaction at position 4 in one of the haem-rotational components is the origin of the coupling between the Fe-C-N and vinyl bending modes. The Fe-N epsilon(proximal His) and the Fe-CN stretching vibrations as well as the Fe-C-N bending vibration have been identified by 54Fe/57Fe and 13C15N/12C15N/13C14N/12C14N isotope exchange.

Resonance Raman evidence for an unusually strong exogenous ligand-metal bond in a monomeric nitrosyl manganese hemoglobin.

Resonance Raman spectroscopy has been employed to determine the vibrational modes of monomeric nitrosyl manganese Chironomus thummi thummi hemoglobin (CTT IV). This insect hemoglobin has no distal histidine. By applying various isotope-labeled nitric oxides (14N16O, 15N16O, 14N18O), we have identified the Mn11-NO stretching model at 628 cm-1, the Mn11-N-O bending mode at 574 cm-1 and the N-O stretching mode at 1735 cm-1. The results suggest a strong Mn11-NO bond and a weak N-O bond. The vinyl group substitution does not influence the nu (Mn11-NO), delta (Mn11-N-O) and nu (N-O) vibrations. The Mn11-NO stretching frequency is insensitive to distal histidine interactions with NO, whereas the N-O stretching frequency is sensitive. Nitric oxide also binds to Met manganese CTT IV to form an Mn111. NO complex which undergoes a slow but complete autoreduction resulting in the Mn11.NO species. In manganese meso-IX CTT IV, the Mn111. NO Mn11. NO conversion alters the intensities of the porphyrin ring modes at 342, 360, 1587 and 1598 cm-1, but shifts the frequencies at 1504 and 1633 cm-1 (in Mn111.NO) to 1497 and 1630 cm-1 (in Mn11. NO), respectively. The unshifted marker line at 1378 cm-1 reflects the fact that the pi electron densities of the porphyrin ring are the same in the two complexes.

Assignment of the Fe-N epsilon (His) stretching mode in the resonance Raman spectra of a monomeric insect cyanomethaemoglobin.

Resonance Raman (RR) spectra of the monomeric cyanomethaemoglobin CTT III from insect larvae of Chironomus thummi thummi are shown for the range of 200-550 cm-1. By iron and cyanide isotope exchange a line varying between 307 cm-1 for 57Fe-13C15N and 311 cm-1 for 54Fe-12C14N, has been assigned to the Fe-N epsilon stretching mode of this haem complex. The substitution of 54Fe for 57Fe has no effect on the Fe-C = N bending mode whereas it affects the Fe-CN stretching mode.

Metabolic production of a blue-green fluorophor in lenses of dark-adapted mice and its increase with age.

A blue-green fluorophor (496 nm emission/406.7 nm excitation) occurs in the mouse lens; its increase with age is more pronounced in the nucleus than in the cortex. The level of fluorophor and its rate of production are the same for animals reared in the dark as for animals reared in the light. Thus, the fluorophor is not generated by a photochemical reaction but is a purely metabolic product.

Fluorophors and chromophors from rat lens crystallins in UV with hydroxykynurenine.

Isolated alpha-, beta-, and gamma-crystallins from young rat lenses were incubated in solution for 16 hr with 3-hydroxykynurenine under ultraviolet (366 nm) light. Controls included: incubation without light, without kynurenine, and with 2-mercaptoethanol. These procedures generated several chromophors (with absorption maxima or shoulders at 340, 370, and 470 nm) and fluorophors (with excitation/emission at 407/515, 458/550, 515/555, 647/664, and 647/740 nm). The formation of these pigments was inhibited by 2-mercaptoethanol. The findings are discussed in relation to the chromophors and fluorophors found in aged and brunescent human lenses.

Fluorescence/Raman intensity ratio for monitoring the pathologic state of human lens.

The authors have put quantitation of human lens fluorescence on a rational basis by using the accompanying Raman signal from lens protein as a normalization factor. The intensity ratio, Fluorescence/Raman (F/R), may be used to compare lenses of different ages when the exciting wavelength is long enough to give a measurable Raman signal. In younger lenses excited at 457.9 or 514.5 nm, the F/R shows a log increase with age. Older lenses, above 60 years of age, excited at 647.1 nm give a steeply rising sigmoid curve. In developing this procedure, the authors found that for each lens there is a characteristic wavelength that is called the critical wavelength (lambda critical). At wavelengths longer than lambda critical the Raman signal appears in the absence of a broad fluorescence peak; at shorter wavelengths the fluorescence intensity increases enough to overwhelm the Raman signal. For normal lenses, clear and not heavily pigmented, the lambda critical is age dependent, giving a curve that is a flattened sigmoid approximating a straight line.

Tryptophan Raman/457.9-nm-excited fluorescence of intact guinea pig lenses in aging and ultraviolet light.

Normal age-matched guinea pig lenses were compared with those exposed to (1) long-term ultraviolet (UV) light (9 months, 353-nm peak) in vivo, and (2) short-term UV light (3.5 hr, 325 nm) in vitro from a helium-cadmium laser. Tryptophan Raman and 457.9-nm-excited fluorescence profiles along the visual axis (VA) were obtained by taking 21 (for tryptophan) or 11 (for fluorescence) successive spectra for each intact lens using the Raman optical dissection technique. To indicate the extent of UV exposure, fluorescence spectra were obtained along the VA (excitation/emission = 457.9/497 nm); these spectra indicated that the major alteration by UV was in the nucleus with the least in the posterior cortex. Normal aging lenses had no apparent change in the tryptophan profile between 3 days and 12 months. The UV-irradiated lenses also showed no appreciable difference from the normal aging patterns. These results indicate that there is no detectable tryptophan photolysis in the intact guinea pig lens by longwave UV light.

A Raman study of disulfide and sulfhydryl in the Emory mouse cataract.

Emory mice (EM) are genetically predisposed to late-onset cataract formation. Our early work has shown UV-exposure slightly enhanced the expected 2 SH----SS conversion of normal mouse lenses only in the cortical regions. There was essentially no difference in the disulfide profiles of the nuclear region between UV-exposed and control lenses. Since the first noticeable change in the Emory mouse is a hazy nucleus when a lens is examined in vitro, we wondered if cataractogenesis in this model is different from the UV-produced cataract. This question was answered by comparing the visual axis profiles for SH and SS in early EM cataracts and in clear lenses from age-matched controls. The sulfhydryl profiles show that the SH level of 8.5-month-old EM lenses is essentially the same as that of the controls. Likewise, the disulfide profiles show no significant difference. The results clearly demonstrate that EM lenses do not undergo accelerated disulfide production. Therefore for the EM lens, the early stage of cataract formation must involve factors other than just accelerated oxidation of protein SH or glutathione SH. Invest Ophthalmol Vis Sci 29:823-826, 1988

Red fluorescence in older and brunescent human lenses.

Brunescent lenses and normal human lenses more than 70 years old exhibit red fluorescence due to a fluorophor with emission maximum at 672 nm under excitation by the 647.1 nm line of krypton ion laser. The properties and mode of occurrence of this fluorophor suggest that its formation is highly pertinent to senile nuclear pathology.

Effect of chronic near-ultraviolet radiation on the gray squirrel lens in vivo.

The effects of ambient exposure to near-ultraviolet (near-UV) radiation (300-400 nm) on the ocular lens of the diurnal squirrel (Sciurus carolinensis) are reported. Gray squirrels lived in cages illuminated for 12 hr a day with near-UV light (6 mW/cm2, 365 nm) for 1 yr. The non-UV-exposed controls were housed separately. In the lenses of UV-exposed animals, anterior pole changes occurred. Central epithelial cells swelled, disappeared, or underwent proliferation. A band of disoriented degenerating fiber cells was seen in the midcortex, with a degree of liquefaction. When lens protein compartments were separated by centrifugation, water-insoluble but urea-soluble fractions were enhanced in the outer and inner cortex and the nucleus. Both high-performance liquid chromatography and polyacrylamide gel electrophoresis revealed that proteins mainly in the midcortex and nucleus were altered considerably. Evidence of a loss of sulfhydryl compounds (by chemical and Raman spectroscopic analyses) and an increase of protein-thiol mixed disulfides (chemically) was also observed. These data prove that repetitive ambient exposure of diurnal animals to near-UV radiation at subsolar levels damages the lens by interfering with the maintenance of epithelial cells and altering the structural proteins; some of this may be due to the conversion of sulfhydryls to mixed disulfides.

Raman spectroscopy of human vitreous in proliferative diabetic retinopathy.

PURPOSE: Recent studies have demonstrated increased nonenzymatic glycation in vitreous from patients with diabetic retinopathy. The present study reports the use of Raman spectroscopy as a novel approach for investigating these molecular changes in human vitreous and experimental tissues. METHODS: Near-infrared laser-excited Fourier-transform (FT) Raman spectroscopy (RS) was performed on vitreous specimens obtained at surgery from seven patients with proliferative diabetic retinopathy and from 10 controls. Measurements were also obtained from samples of control and glycated (in vitro) rat tail tendon collagen and demineralized chick bone collagen. RESULTS: Spectroscopy of vitreous samples from patients with diabetic retinopathy revealed two prominent peaks at 1604 cm-1 and 3057 cm-1, corresponding to aromatic C = C and C-H stretching vibrations in pi-conjugated and aromatic molecules. The peak at 1604 cm-1 was threefold higher in vitreous from patients with diabetes than from controls. Spectra obtained from experimental tissues provided evidence suggesting that the results obtained in human vitreous may be due to nonenzymatic glycation and not to the lysyl oxidase pathway. CONCLUSIONS: These findings suggest that human vitreous obtained from subjects with diabetes may be distinguished from control vitreous by FT-RS and that the peaks characterizing the diabetic samples are possibly due to nonenzymatic glycation. Raman spectroscopy may provide a useful method to elucidate the molecular events underlying these abnormalities.

Laser raman spectroscopy of the lens in situ, measured in an anesthetized rabbit.

We have obtained the first Raman spectrum from the lens of a live animal. A laser beam (514.5 nm; 15 mW) was directed into the eye of an anesthetized rabbit at 60 degrees from the visual axis and Raman emission was collected at 90 degrees from the incident beam. The power density at the retina was estimated at 0.5 W/cm2. The entire scattering column in the lens can be imaged on the entrance slit of a spectrometer with so little distortion that Raman "optical dissection" analysis (Askren, Yu and Kuck (1979) Exp. Eye Res. 29, 647) can be performed on the in situ lens. The advantages of multichannel detectors over photomultiplier tubes with respect to in situ measurements are discussed.