Biology of tongue coating in different disease stages of RA and its value in disease progression.

OBJECTIVE: To assess and compare the composition of tongue coating microbiota among patients at different stages of rheumatoid arthritis (RA). METHODS: A total of 47 patients diagnosed with RA, as per the American College of Rheumatology criteria, and 10 healthy individuals were enrolled in this study. The RA patients were stratified considering their Disease Activity Score 28 (DAS28), a composite measure based on the 28 tender and swollen joint count and erythrocyte sedimentation rate (ESR). The study population was further categorized into active phase group (LMH group) and inactive phase group (RE group) according to their DAS28 values. DNA extraction was extracted from tongue coating samples. Subsequently, the V3-V4 16S rDNA region was selectively amplified and sequenced through high-throughput 16S rDNA analysis. The resulting data were then utilized to ascertain the microbial contents. RESULTS: Significant variations were observed in the tongue coating microbiota of patients with RA during active and inactive phases, in comparison to healthy individuals (p < 0.05). At the genus level, the presence of Prevotellan, Veillonella, Rothia, and Neisseria in RA patients was notably more evident than in the healthy control (HC) group. These disparities find support in existing research on gut and oral microbiota. During the active phase of RA, the relative abundance of Veillonella, Rothia, and Neisseria in the tongue coating microbiota of patients was significantly higher than in those with inactive RA. These findings underscore the need for further and in-depth research on the potential impact of these microorganisms on the progression of RA disease. CONCLUSION: The results substantiate the hypothesis that tongue coating microbes actively contribute to the progression of RA.

TYR mutation in a Chinese population with oculocutaneous albinism: Molecular characteristics and ophthalmic manifestations.

Oculocutaneous albinism (OCA) is a rare inherited disorder characterized by a partial or complete reduction of melanin biosynthesis that leads to hypopigmentation in the skin, hair and eyes. The OCA1 subtype is caused by mutations in TYR. The purpose of this study was to investigate the genetic and clinical ophthalmic characteristics of TYR mutations in patients with OCA. Herein, 51 probands with a clinical diagnosis of OCA were enrolled. Whole-exome sequencing and comprehensive ophthalmic examinations were performed. Overall, TYR mutations were detected in 37.3% (19/51) in the patients with OCA. Fifteen patients had compound heterozygous variants, and four cases had homozygous variants. Eleven different pathogenic variants in TYR were detected in these 19 patients, with missense, insertion, delins and nonsense in 71.1% (27/38), 15.8% (6/38), 2.6% (1/38), and 10.5% (4/38), respectively. Clinical examinations revealed that 84.2% (16/19) of patients were OCA1A, and 15.8% (3/19) were OCA1B. Most TYR probands (52.6%, 10/19) had moderate vision impairment, 15.8% (3/19) had severe visual impairment, 10.5% (2/19) exhibited blindness, only 5.3% (1/19) had mild visual impairment and 15.8% (3/19) were not available. Photophobia and nystagmus were found in 100% (19/19) of the patients. In addition, grade 4 foveal hypoplasia was detected in 100% (12/12) of the patients. In conclusion: The TYR patients exhibited severe ocular phenotypes: the majority (93.8%, 15/16) of them had a moderate vision impairment or worse, and 100% (12/12) had severe grade 4 foveal hypoplasia. These novel findings could provide insight into the understanding of OCA.

Association between dietary folate intake and severe headache among adults in the USA: a cross-sectional survey.

Folate, also known as vitamin B9, is a water-soluble vitamin. Previous studies on dietary folate intake in severe headache patients were equivocal. Therefore, we conducted a cross-sectional study to elucidate the relationship between folate intake and severe headache. This cross-sectional study used data from participants over 20 years old who participated in the National Health and Nutrition Examination Survey (NHANES) from 1999 to 2004. The diagnosis of severe headache was made through participants' self-report in the NHANES questionnaire section. We performed multivariate logistic regression and restricted cubic spline (RCS) regression to explore the relationship between folate intake and severe headache. A total of 9859 participants took part in the study, 1965 of whom were severe headache patients and the rest were non-severe headache. We found that dietary folate intake was significantly and inversely associated with severe headache. Compared with participants with lower folate intake Q1 (≤ 229·97 ug/d), the adjusted OR values for dietary folate intake and severe headache in Q2 (229·98-337 ug/d), Q3 (337·01-485 ug/d) and Q4 (≥ 485·01 ug/d) were 0·81 (95 % CI: 0·67, 0·98, P = 0·03), 0·93 (95 % CI: 0·77, 1·12, P = 0·41) and 0·63 (95 % CI: 0·49, 0·80, P < 0·001), respectively. For women aged 20-50 years, there was a non-linear association between folate intake and severe headache in the RCS. Women aged 20-50 years should have higher awareness of dietary folate and increase their dietary intake of folate, which may aid in preventing severe headache.

The associations of self-perception, movement competence, and clinical features of young school-aged children with glaucoma.

The purpose of the study was to determine the associations of self-perception, motor skills, and clinical features of young school-age children with glaucoma (CG). This is a cross-sectional observational study. Children from preschool to second grade, including CG (N = 19), children with amblyopia (CA, N = 28), and controls (N = 32), completed the Manual Dexterity and Aiming and Catching Scales of the Movement Assessment Battery for Children-2nd edition (MABC-2), including Manual Dexterity, Aiming and Catching, and Balance. CG, CA, and their parent completed the Pictorial Scale of Perceived Competence and Social Acceptance for Young Children, respectively, assessing the child's cognitive competence, peer acceptance, physical competence, and maternal acceptance. The Kruskal-Wallis H test and Bonferroni post hoc test compared motor skills among groups. Spearman's correlation analysis evaluated the correlations between motor skills, self-perception, and clinical features. The CG reported lower peer acceptance than CA (P = 0.040), and the parents of CG reported lower cognitive competence than CG reported (P = 0.046). Compared with controls, CG had worse performance of Aiming and Catching, and Balance (P = 0.018 and P = 0.001), and CA had worse performance of Balance (P = 0.009). The motor skills were comparable between CG and CA. For CG, older age correlated with worse competence of Aiming and Catching (r = - 0.620, P = 0.005), better best-corrected visual acuity of better-seeing eye correlated with higher competence of Manual Dexterity and Balance (r = - 0.494, P = 0.032, and r = - 0.516, P = 0.024), and longer duration of glaucoma correlated with worse competence of Manual Dexterity (r = - 0.487, P = 0.034). CONCLUSION:  Glaucoma and amblyopia have significant negative impacts on children's daily motor skills. The acuity of a better-seeing eye is an important factor influencing motor movement. TRIAL REGISTRATION: ClinicalTrials.gov identifier, ChiCTR2100050415. WHAT IS KNOWN: • The state of mental health in early childhood influences the development of their future personality and physical development. The prognosis and management of glaucoma may seriously impair the mental health development of the affected children. However, the exploration of psychological aspects and motor movement of childhood glaucoma was limited. WHAT IS NEW: • Children with glaucoma have impaired motor skills and self-perception development, especially in terms of peer socialization.

Interaction between diabetes and body mass index on severe headache or migraine in adults: a cross-sectional study.

BACKGROUND: Research on the effects of body mass index (BMI) on severe headache or migraine is limited and controversial. The aim of this study was to explore the association between BMI and the prevalence of migraine, with particular interest in diabetes status difference. METHODS: The present study used analyzed data from people who participated in the National Health and Nutrition Examination Survey (NHANES) between 1999 and 2004. Logistic regression models and restricted cubic spline (RCS) models were applied to investigate the relationship between body mass index and migraine. RESULTS: A total of 10,074 adults aged 20 years or older were included in this study. Body mass index was positively related to migraine, and the corresponding odds ratio (OR; 95% CI) was 1.02 (1.01, 1.03; p < 0.001). And compared to participants in the lowest group of body mass index (< 25 kg/m2), the adjusted ORs for migraine in medium group (25-29.9 kg/m2), and highest group (≥ 30 kg/m2) were 1.14 (95% CI: 0.98-1.32, p = 0.09) and 1.30 (95% CI: 1.11-1.52, p = 0.0022), respectively. The relationship between BMI and migraine exhibited a linear in overall in the RCS. Our findings also suggested an interaction between BMI and diabetes. The relationship between BMI and migraine in adults with diabetes was non-linear. The OR of developing migraine was 1.30 (95% CI: 1.10-1.54) in individuals with BMI ≥ 29.71 kg/m2 in adults with diabetes. CONCLUSION: A higher body mass index is significantly associated with an increased prevalence of migraine, and diabetes status can modify the association between them.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

Dietary zinc intake in relation to migraine among adults: a cross sectional study of NHANES 1999-2004.

BACKGROUND: Previous studies have revealed that an antioxidant diet is a protective factor against migraine. However, the association between zinc, an important antioxidant obtained from the diet, and migraine has received little attention. The purpose of this study was to explore the association between zinc intake with migraine. METHODS: The present study used cross-sectional data from individuals who participated in the National Health and Nutrition Examination Survey (NHANES) between 1999 and 2004. Logistic regression models and restricted cubic spline models were performed to explore the association between zinc intake and migraine. RESULTS: A total of 9849 adults aged 20 years or older were included in this study. Zinc intake was negatively associated with migraine. Compared to participants in the lowest group of dietary zinc intake Q1 (≤5.93 mg/day), the adjusted ORs for migraine in Q2 (5.94-8.38 mg/day), Q3 (8.39-11.26 mg/day), Q4 (11.27-15.75 mg/day), and Q5 (≥15.76 mg/day) were 0.73 (95% CI: 0.60-0.89, p = 0.004), 0.72 (95% CI: 0.55-0.95, p = 0.02), 0.76 (95% CI: 0.58-0.99, p = 0.04) and 0.73 (95% CI: 0.50-1.05, p = 0.08), respectively. Our findings also suggested an interaction between zinc intake and age (P for interaction = 0.007). Additionally, the relationship between zinc intake and migraine in adults with 20-50 years was non-linear. CONCLUSIONS: A higher zinc intake is significantly associated with a decreased prevalence of migraine, and age can modify the association between them.

Dietary niacin intake in relation to depression among adults: a population-based study.

BACKGROUND: Previous studies have shown that an antioxidant diet is a protective factor against depression. However, the association between niacin, an important antioxidant consumed from the diet, and depression has received little attention. Therefore, we explored the association between niacin intake and depression through a cross-sectional analysis of the National Health and Nutrition Examination Survey (NHANES) from 2007 to 2016. METHODS: Depression was measured using the Patient Health Questionnaire (PHQ-9, score ≥ 10). Niacin intake was assessed through 24-h dietary recall interviews. The relationship of niacin intake with depression among adults in US was assessed by using a weighted multiple logistic regression model with subgroup analysis. Non-linear associations were explored using restricted cubic spline models. And we used a two-piece-wise logistic regression model with smoothing to explore the threshold for association between them. RESULTS: A total of 16,098 adults were included in this study. Compared with individuals with lowest niacin intake Q1 (≤ 15.96 mg/day), the adjusted OR values for dietary niacin intake and depression in Q2 (15.97-22.86 mg/day), Q3 (22.87-32.28 mg/day) and Q4 (≥ 32.29 mg/day), were 0.92 (95% CI: 0.70-1.20), 0.76 (95% CI: 0.56-0.99,) and 0.68 (95% CI: 0.48-0.98), respectively. The results were not modified by sex, by age and by BMI. Furthermore, the relationship between dietary niacin intake and depression exhibited a U-shaped curve (nonlinear, p < 0.001). And depression risk was lowest when dietary consumption of niacin was around 36 mg/day. CONCLUSIONS: In present study, moderate niacin intake, but not high intake, was associated with lower odds of depression suggesting a U-shaped association.

Identification of autophagy-related genes in neuropathic pain through bioinformatic analysis.

BACKGROUND: Neuropathic pain (NP) is one of the most common types of chronic pain and significantly compromises the quality of life. Autophagy is an intracellular catabolic process that is required to maintain cellular homeostasis in response to various stresses. The role of autophagy-related genes in the diagnosis and treatment of neuropathic pain remains unclear. METHODS: We identified autophagy-related differentially expressed genes (ARDEGs) and differentially expressed miRNAs (DE-miRNAs) in neuropathic pain by bioinformatics analysis of the GSE145226 and GSE145199 datasets. These ARDEGs and their co-expressed genes were subjected to Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis, Gene Set Enrichment Analysis (GSEA) and friends analysis. Meanwhile, we constructed TFs-ARDEGs, miRNA-ARDEGs regulatory network through ChIPBase database and the HTFtarget database, multiMir R package. Finally, we performed immune infiltration analysis of ARDEGs by Single Sample Gene Set Enrichment Analysis (ssGSEA). RESULTS: We identified 2 potential autophagy-related differentially expressed genes (Sirt2 and ST7) that may be closely associated with the pathogenesis of neuropathic pain. GO, KEGG and GSEA analysis revealed that these two ARDEGs were mainly enriched in pyridine nucleotide metabolic process, nicotinamide nucleotide metabolic process, Nicotinate and nicotinamide metabolism, NF-κB pathway, KRAS signaling, P53 pathway. In the TFs-ARDEGs and miRNA-ARDEGs regulatory network, miR-140-5p and Cebpb were predicted to be as crucial regulators in the progression of NP. For the ssGSEA results, Sirt2 was positively correlated with Eosinophil and Effector memory CD8+ T cell infiltration, which suggested that it may be involved in the regulation of neuroimmune-related signaling. CONCLUSION: Two autophagy-related differentially expressed genes, especially Sirt2, may be potential biomarkers for NP, providing more evidence about the crucial role of autophagy in neuropathic pain.

Experimental investigations on the vertical distribution and properties of oil-mineral aggregates (OMAs) formed by different clay minerals.

After oil spills, the floating oil may interact with suspended minerals to form the oil-mineral aggregates (OMAs) in turbulent environments. In this work, a flume was used in conjunction with a settling device to investigate the vertical distribution and properties of OMAs formed by different clay minerals. The density and size of OMAs depend on the density and surface properties of the constituent particles, which also affect the vertical distribution of dispersed oil. Density of oil-montmorillonite aggregates increased from 1165 to 1897 kg/m3 within 6 h test. Among the four minerals, montmorillonite displayed the highest affinity with dispersed oil and the most significant modification of oil-water interfacial tension. Oil dispersion efficiency was significantly greater and reached 39.3% in the presence of montmorillonite at 300 mg/L compared with the control group (17.6%). Particle concentration is the most important factor for the capture of oil and participation of particles during the OMA formation, while the zeta potential and hydrophobicity have nonsignificant effect on the two processes. Cation exchange capacity has a moderate effect on the sunken oil formation, which is also the second main factor governing the particle participation. Particle size plays a second leading role in governing the sunken oil formation but with a minor contribution of the particle participation.

Effect of the base-out recovery point as the surgical target for acute acquired comitant esotropia.

PURPOSE: To evaluate the treatment efficacy of the preoperative base-out recovery point as the surgical target angle for acute acquired comitant esotropia. METHODS: Prospective study. Twenty-two patients with acute acquired comitant esotropia (AACE) underwent strabismus surgery based on the target angle of the preoperative base-out recovery point. The postoperative deviation, positive fusional vergence, and negative fusional vergence were evaluated and compared with those of 23 normal individuals. RESULTS: The mean follow-up period was 18.68 ± 19.48 months. At the last follow-up, 19 (86.4%) of 22 subjects had orthophoria, whereas 3 (13.6%) had minimal esophoria. The postoperative angle of deviation was significantly smaller than the preoperative angle of deviation at near (P < 0.001) and distance (P < 0.001). Postoperative sensory fusion was significantly better than preoperative fusion at near (P < 0.001) and distance (P < 0.001). The postoperative stereoacuity improved significantly after the surgery at near (P < 0.001) and distance (P < 0.001). Compared with the controls, the convergence and divergence amplitudes in the AACE patients were similar at distance (P > 0.05) but were still narrower at near (P < 0.001). CONCLUSION: Good alignment and binocular balance were obtained with the surgical target angle of the base-out recovery point in AACE.

Evaluation of Ovarian Tumors with Multidetector Computed Tomography and Tumor Markers: Differentiation of Stage I Serous Borderline Tumors and Stage I Serous Malignant Tumors Presenting as Solid-Cystic Mass.

BACKGROUND The aim of this study was to determine multidetector computed tomography (MDCT) features and tumor markers for differentiating stage I serous borderline ovarian tumors (SBOTs) from stage I serous malignant ovarian tumors (SMOTs). MATERIAL AND METHODS In total, 48 patients with stage I SBOTs and 54 patients with stage I SMOTs who underwent MDCT and tumor markers analysis were analyzed. MDCT features included location, shape, margins, texture, papillary projections, vascular abnormalities, size, and attenuation value. Tumor markers included serum cancer antigen 125 (CA125), carbohydrate antigen 19-9 (CA19-9), carcinoembryonic antigen (CEA), and human epididymis protein 4 (HE4). Parameters of clinical characteristic, MDCT features, and tumor markers were compared using a chi-square test and Mann-Whitney U tests. A binary logistic regression analysis was performed to detect predictors for SMOTs. A receiver operating characteristic (ROC) curve analysis was used to assess the potential diagnostic value of the quantitative parameters. Kappa and intraclass correlation coefficients were used to evaluate interobserver reproducibility for MDCT features. RESULTS Median ages between patients with SBOTs and SMOTs were significantly different. Compared with SBOTs, vascular abnormalities were significantly more common in SMOTs. CA125, HE4, the maximum thickness of the wall, the maximum thickness of the septa, and the maximum diameter of the solid portions were significantly higher in patients with SMOTs. A binary logistic regression analysis revealed that age, vascular abnormalities, and the maximum diameter of the solid portion were independent factors of SMOTs. ROC analysis was used to assess the potential diagnostic value for predicting SMOTs. Moderate or good interobserver reproducibility for MDCT features were identified. CONCLUSIONS Age, vascular abnormalities, and the maximum diameter of the solid portion were independent factors for differentiating SBOTs from SMOTs. The combined analysis of age, vascular abnormalities, and the maximum diameter of the solid portion may allow better differentiation between SBOTs and SMOTs.

Factors influencing the self-reported sense of deviation in adults with successful surgical outcomes for strabismus.

BACKGROUND: To determine whether a sense of deviation remains in adults with successful motor alignment who fulfil diplopia criteria after surgery and to examine the factors associated with this judgement. METHODS: This was a retrospective study. Adult patients defined as having a successful outcome based on more than 1 year of post-operative follow-up visits were included in the study. The sense of deviation was determined at the last visit. Pre- and post-operative deviation and characteristics including age, gender, education level, occupation, diagnosis, size of deviation, extraocular movement (EOM), binocular function, and health-related quality of life (HRQOL) were recorded. RESULTS: In total, 22 (24%) of the 91 adults with successful surgical outcomes reported a sense of deviation. No significant differences were noted between subjects with and without a sense of deviation regarding patient demographics, pre- and post-operative deviation, changes in deviation, sensory fusion or EOM. Subjects with a sense of deviation had an increased prevalence of and larger post-operative vertical deviation, poorer stereo function, and lower HRQOL scores than those with no sense of deviation. The presence of post-operative vertical deviation was associated with a sense of deviation. CONCLUSIONS: Approximately one-fourth (24%) of adults defined as having successful surgical outcomes who still had a sense of deviation exhibited worse stereo function, higher vertical deviation size and lower HRQOL scores. The presence of 3 to 5 prism dioptres(pd) of vertical deviation would be the main factor associated with a sense of deviation post-operatively.

Prevalence of the thoracic scoliosis in children and adolescents candidates for strabismus surgery: results from a 1935-patient cross-sectional study in China.

PURPOSE: No study so far has paid attention to strabismus-related spinal imbalance. This study aimed to determine the epidemiology of thoracic scoliosis in children and adolescents with strabismus and investigate the association of two diseases. METHODS AND DESIGN: A cross-sectional study. Study group consists of 1935 consecutive candidates for strabismus surgery (4-18 years); Control group consists of the age- and sex-matched patients with respiratory diseases. All subjects underwent a screening program based on chest plain radiographs using the Cobb method. Their demographic information, clinical variables and results of Cobb angle were recorded and analyzed. RESULTS: A significantly higher prevalence of thoracic scoliosis (289/1935, 14.94% versus 58/1935, 3.00%) was found in study group compared with control group. Among strabismic patients, the coronal thoracic scoliosis curve mainly distributed in right and in main thoracic (198/289) and in the curves 10°-19° (224/289); Age range 7-9 years (103/1935), female (179/1935) and concomitant exotropia patients (159/851) were more likely to have thoracic scoliosis. According to the logistic regression, thoracic scoliosis had no significant association with age, BMI, duration of illness and onset age (p > 0.05). However, gender, BCVA, type of strabismus and degree of strabismus showed a significant relationship with the prevalence of thoracic scoliosis (p < 0.05). CONCLUSIONS: With a pooled prevalence of 14.94%, strabismus patients showed a great higher risk of developing thoracic scoliosis. Screening for scoliosis in strabismus patients can be helpful to discover a high prevalence of potential coronal scoliosis. More attention should be paid to ophthalmological problems in patients with scoliosis. These slides can be retrieved under Electronic Supplementary Material.

Synthesis of Ni-Co Hydroxide Nanosheets Constructed Hollow Cubes for Electrochemical Glucose Determination.

Hierarchical Ni-Co double transition metal hydroxide nanosheets have been explored as an effective strategy for the design of nonenzymatic glucose sensors. Ni-Co hydroxide nanosheets constructed hollow cubes were successfully synthesized by using Cu2O cubes as templates and subsequently etched by Na2S2O3 to achieve a hollow cubic structure. The molar ratio between Ni and Co was tuned by varying the precursor ratio of NiCl2 and CoCl2. It was observed by transmission electron microscopy (TEM) that the increasing Ni precursor resulted in particle morphology, and the increasing ratio of the Co precursor resulted in more lamellar morphology. The sample with the composition of Ni0.7Co0.3(OH)2 displayed the best performance for glucose sensing with high selectivity (1541 µA mM-1 cm-2), low detection limit (3.42 µM with S/N = 3), and reasonable selectivity. Similar strategies could be applied for the design of other electrode materials with high efficiency for nonenzymatic glucose determination.

IER5 is involved in DNA Double-Strand Breaks Repair in Association with PAPR1 in Hela Cells.

The immediate early response gene 5 (IER5) is a radiation response gene induced in a dose-independent manner, and has been suggested to be a molecular biomarker for biodosimetry purposes upon radiation exposure. Here, we investigated the function of IER5 in DNA damage response and repair. We found that interference on IER5 expression significantly decreased the efficiency of repair of DNA double-strand breaks induced by ionizing radiations in Hela cells. We found that IER5 participates in the non-homologous end-joining pathway of DNA breaks repair. Additionally, we identified a number of potential IER5-interacting proteins through mass spectrometry-based protein assays. The interaction of IER5 protein with poly(ADP-Ribose) polymerase 1 (PARP1) and Ku70 was further confirmed by immunoprecipitation assays. We also found that Olaparib, a PARP1 inhibitor, affected the stability of IER5. These results indicate that targeting of IER5 may be a novel DNA damage response-related strategy to use during cervical cancer radiotherapy or chemotherapy.

MACULAR MICROSTRUCTURAL FEATURES IN CHILDREN WITH TILTED DISK SYNDROME EVALUATED BY SPECTRAL DOMAIN OPTICAL COHERENCE TOMOGRAPHY.

PURPOSE: To assess macular microstructure in eyes with tilted disk syndrome (TDS) and determine the relationship between TDS foveal morphology and visual function. METHODS: Twenty-six TDS eyes from 19 children (aged 5∼15 years) with a spherical equivalent refraction (SER) of -3.1 ± 1.3 diopter (D) and 28 control eyes from 14 children (aged 7∼12 years) with a SER of -3.0 ± 0.7 D were recruited. Horizontal and vertical optical coherence tomography scans through the fovea produced images that were segmented into eight intraretinal layers. Thicknesses of the total retina and each layer were measured at the foveal center and 12 other macular locations: 500 µm, 1,000 µm, and 1,500 µm along the horizontal and vertical meridians. The relationships between TDS best correct visual acuity (BCVA) and the presence of photoreceptor inner/outer segment (IS/OS) junction line, IS/OS foveal bulge, and cone outer segment tip (COST) line were evaluated. RESULTS: The thickness of TDS central fovea, 218.94 ± 22.20 µm, was not significantly different from controls. The total retinal thickness in TDS eyes was thinner than controls at all peripheral locations (P < 0.05) except at 500 µm and 1,000 µm superiorly, and 1,500 µm temporally. Tilted disk syndrome intraretinal layer thicknesses in the nasal and inferior regions varied significantly from controls (P < 0.05). Only 80.7% and 23.1% of TDS eyes had a normal foveal bulge and continuous COST line, respectively, compared with 100% and 96.4% of controls. The BCVA of TDS eyes was similar whether or not the foveal bulge or COST line was abnormal. CONCLUSION: Differences in intraretinal layer thickness may be correlated with defective vision.

Effect of Illumination on Ocular Status Modifications Induced by Short-Term 3D TV Viewing.

Objectives. This study aimed to compare changes in ocular status after 3D TV viewing under three modes of illumination and thereby identify optimal illumination for 3D TV viewing. Methods. The following measures of ocular status were assessed: the accommodative response, accommodative microfluctuation, accommodative facility, relative accommodation, gradient accommodative convergence/accommodation (AC/A) ratio, phoria, and fusional vergence. The observers watched 3D television for 90 minutes through 3D shutter glasses under three illumination modes: A, complete darkness; B, back illumination (50 lx); and C, front illumination (130 lx). The ocular status of the observers was assessed both before and after the viewing. Results. After 3D TV viewing, the accommodative response and accommodative microfluctuation were significantly changed under illumination Modes A and B. The near positive fusional vergence decreased significantly after the 90-minute 3D viewing session under each illumination mode, and this effect was not significantly different among the three modes. Conclusions. Short-term 3D viewing modified the ocular status of adults. The least amount of such change occurred with front illumination, suggesting that this type of illumination is an appropriate mode for 3D shutter TV viewing.

Comparison of Near Addition Value Prescription Methods for Myopic Children.

PURPOSE: To compare personalized near addition values for myopic children that induce a reasonable phoria (Ph) (meeting Sheard's criterion) and induce a null lag of accommodation at near and to evaluate changes in these metrics after lens adaptation. METHODS: Fifty-three myopic children participated in this study. Accommodative response, Ph, and fusional amplitudes (FAs) were measured at 33 cm through multiple addition lenses (0D, +1.00D, +1.50D, +2.00D, +2.50D, +3.00D). The adaptation effect on measured parameters was evaluated after 6 min of near work with each addition. The FA/Ph ratios were calculated for each addition and fitted using a rational function to obtain the optimal addition value satisfying Sheard's criterion (FA/Ph ≥ 2). Lag of accommodation change in association with addition value was assessed using linear regressions to obtain the addition values inducing a null lag. RESULTS: Lag of accommodation (r = -0.987, p < 0.001) and Ph (r = -0.999, p < 0.001) decreased linearly with addition value. The 6-min adaptation induced a small but significant increase in accommodative lag and an exophoric shift (p < 0.05). Three FA/Ph patterns with respect to addition lenses were observed based on the near Ph: orthophoria/exophoria, low esophoria, and large esophoria. Addition values based on Sheard's criterion (mean ± SD, +2.16 ± 0.79D) were significantly lower than those based on null lag (+2.83 ± 0.44D, t = 19.86, p < 0.001). The FA/Ph ratio was less than 2.0 in 75.5% of subjects with additions determined through null accommodative lag. Additions determined through FA/Ph ≥ 2 induced a lag of accommodation of 0.38 ± 0.42D. CONCLUSIONS: Personalized near addition values using Sheard's criterion were lower than those obtained through null lag of accommodation. These values should allow a better binocular balance especially for exophoric children.