TRIM44 facilitates ovarian cancer proliferation, migration, and invasion by inhibiting FRK.

Ovarian cancer (OC) is the leading cause of gynecologic cancer-related death in the world. Accumulating evidence indicated the important role of TRIM44 in cancer development. However, how TRIM44 displays in OC and the underlying mechanism remained unclear. TRIM44 and FRK expression in OC tissues and cell lines were investigated by western blot and RT-qPCR. Histotype of tissue samples and patients' data were analyzed. Kaplan-Meier Curve was performed to validate the effect of TRIM44. Colony formation assay, MTT assay, Transwell assay, and wound-healing assay were applied to elucidate the function of TRIM44 in OC cells. CHIP assay was used to explore the association between TRIM44 and FRK. Finally, we performed SKOV3 xenografts in Balb/c nude mice to further confirm the involvement of TRIM44 in OC development. We found TRIM44 highly expressed while FRK displayed low expression in OC cell lines and tissues. Moreover, analysis of histotype of tissues and patients' data and Kaplan-Meier Curve implied the important role of TRIM44 and FRK in tumor progression. Further in vitro study suggested that knocking down TRIM44 inhibited OC cells proliferation, migration, and invasion. Besides, FRK was identified as the target gene of TRIM44 in OC, and TRIM44 promoted OC cells proliferation, migration, and invasion by inhibiting FRK. Finally, in vivo animal experiment further confirmed the promotive effect of TRIM44 on OC progression. Our findings demonstrated that TRIM44 facilitated OC proliferation, migration, and invasion by inhibiting FRK, providing new insights for theoretical research and therapy of OC.

TGFBR2 Regulates Hedgehog Pathway and Cervical Cancer Cell Proliferation and Migration by Mediating SMAD4.

TGFBR2 serves as an initial regulator of the TGF-ß signaling pathway, and loss or reduction of its expression can lead to uncontrolled cell growth. This study was conducted to further explore the mechanism of TGFBR2/SMAD4 on the migration and proliferation of CC cells. Here, TGFBR2 and SMAD4 expressions in CC cells and control cells were measured. The expression patterns of TGFBR2 and SMAD4 in CC cells were verified in the TCGA database. After CC cells were transfected with pcDNA3.1-TGFBR2 or pcDNA3.1-SMAD4, or cotransfected with pcDNA3.1-TGFBR2 and si-SMAD4, Co-IP was utilized for identification of the interaction between TGFBR2 and SMAD4, CCK-8 assay for the assessment of CC cell proliferation, and flow cytometry for the performance of cell cycles. After that, the migration ability of CC cells was examined by cell scratch assay. The expression levels of Hedgehog signaling pathway-related proteins (GLI1 and PTCH) were assayed by Western blot. Lowly expressed TGFBR2 and SMAD4 in CC cells were displayed by the TCGA database. Overexpression of TGFBR2 restrained CC cell migration and proliferation abilities, while the coeffect of TGFBR2 overexpression and SMAD4 knockdown reversed these trends. Besides, highly expressed PTCH and lowly expressed GLI1 were found in CC cells with overexpression of TGFBR2 or SMAD4. The Hedgehog signaling inhibitor (GANT58) can substantially hinder the development of CC cells. Cells in pcDNA3.1-TGFBR2 + si-SMAD4 + GANT58 group had suppressed abilities of cell proliferation and migration than those in pcDNA3.1-TGFBR2 + si-SMAD4 group. Hedgehog pathway agonist (SAG) reversed the inhibitory effect of pcDNA3.1-TGFBR2 or pcDNA3.1-SMAD4 on CC cell biological function. Collectively, TGFBR2 restrains the migration and proliferation abilities of CC cells via mediating SMAD4 to partially block the Hedgehog signaling pathway.

Cre/loxP approach-mediated downregulation of Pik3c3 inhibits the hypertrophic growth of renal proximal tubule cells.

Nephron loss stimulates residual functioning nephrons to undergo compensatory growth. Excessive nephron growth may be a maladaptive response that sets the stage for progressive nephron damage, leading to kidney failure. To date, however, the mechanism of nephron growth remains incompletely understood. Our previous study revealed that class III phosphatidylinositol-3-kinase (Pik3c3) is activated in the remaining kidney after unilateral nephrectomy (UNX)-induced nephron loss, but previous studies failed to generate a Pik3c3 gene knockout animal model. Global Pik3c3 deletion results in embryonic lethality. Given that renal proximal tubule cells make up the bulk of the kidney and undergo the most prominent hypertrophic growth after UNX, in this study we used Cre-loxP-based approaches to demonstrate for the first time that tamoxifen-inducible SLC34a1 promoter-driven CreERT2 recombinase-mediated downregulation of Pik3c3 expression in renal proximal tubule cells alone is sufficient to inhibit UNX- or amino acid-induced hypertrophic nephron growth. Furthermore, our mechanistic studies unveiled that the SLC34a1-CreERT2 recombinase-mediated Pik3c3 downregulation inhibited UNX- or amino acid-stimulated lysosomal localization and signaling activation of mechanistic target of rapamycin complex 1 (mTORC1) in the renal proximal tubules. Moreover, our additional cell culture experiments using RNAi confirmed that knocking down Pik3c3 expression inhibited amino acid-stimulated mTORC1 signaling and blunted cellular growth in primary cultures of renal proximal tubule cells. Together, both our in vivo and in vitro experimental results indicate that Pik3c3 is a major mechanistic mediator responsible for sensing amino acid availability and initiating hypertrophic growth of renal proximal tubule cells by activation of the mTORC1-S6K1-rpS6 signaling pathway.

MiR-494 Inhibits Epithelial Ovarian Cancer Growth by Targeting c-Myc.

BACKGROUND Epithelial ovarian cancer (EOC) is the most lethal malignant gynecological cancer. MicroRNAs (miRNAs) play important roles in the pathogenesis of ovarian cancer. The role of miR-494 in EOC has not been fully investigated. MATERIAL AND METHODS MiR-494 levels in ovarian cancer tissues and cells were tested by qRT-PCR. Cells were transfected with miR-494 mimics or miR-494 ASO by Lipofectamine. Bioinformatics algorithms from TargetScanHuman were used to predict the target genes of miR-494. The c-Myc protein level was assayed by Western blot. The interaction between miR-494 and c-Myc was confirmed by dual luciferase assays. RESULTS MiR-494 showed low levels in EOC tissues and cells. Overexpression of miR-494 inhibited cell growth and migration of EOC cells and vice versa. c-Myc is the targeted gene of miR-494. CONCLUSIONS MiR-494 has an anti-tumor role in EOC via c-Myc.

Effects of Levothyroxine Therapy on Pregnancy and Neonatal Outcomes in Subclinical Hypothyroidism.

Purpose: To assess the effects of levothyroxine (LT4) therapy on pregnancy and neonatal outcomes in pregnant women with subclinical hypothyroidism (SCH) who had different thyroid peroxidase antibody (TPOAb) status. Methods: The data of pregnant women from the Chengdu Hospital of Integrated Traditional Chinese and Western Medicine between January 2017 and August 2019 were collected. SCH was defined as 11.88 < free thyroxine (FT4) < 20.06pmol/L in conjunction with thyroid-stimulating hormone (TSH) >4.00 mU/L. Some clinical characteristics have been collected, including body mass index (BMI) before pregnancy, number of pregnancies, number of miscarriages (spontaneous abortion), parity, family history of diabetes, history of smoking, history of drinking, TSH, FT4, and TPOAb levels. The prevalence of pregnancy and neonatal outcomes in the LT4 and non-LT4 groups, and in the LT4 and euthyroid control groups were compared, respectively. Univariate and multivariate logistic regression analyses were used to assess the effects of LT4 therapy on pregnancy and neonatal outcomes in SCH pregnant women with TPOAb. Results: A total of 985 subjects were enrolled and divided into LT4 group with 478 patients, non-LT4 group with 156 patients and euthyroid control group with 351 patients. The prevalence of amniotic fluid abnormalities and premature delivery in the LT4 group was lower than that in the non-LT4 group in participants with TPOAb-positive (TPOAb+). After adjusting age, BMI prior to pregnancy, number of pregnancies, number of miscarriages, parity, TSH and FT4 level, the SCH pregnant women with TPOAb+ in the LT4 group had a lower risk of amniotic fluid abnormalities and premature delivery than that in the non-LT4 group. Conclusion: LT4 therapy could reduce the risk of premature delivery and amniotic fluid abnormalities in the SCH pregnant women with TPOAb+. However, more randomized trials are required to confirm this association before the unequivocal advocacy of LT4 therapy in pregnant women with SCH.

Ovarian protection and safety of gonadotropin-releasing hormone agonist after cervical cancer surgery: systematic review and meta-analysis.

Background: This meta-analysis was performed using Stata (15.0), and sought to systematically evaluate the domestic application value of the gonadotropin-releasing hormone agonist (GNRH-a) after cervical cancer, and explore its protective effect on the ovaries during chemotherapy. In many studies, the effectiveness and safety of GNRH-a are not consistent, and there is great controversy. Therefore, it is very important to systematically evaluate the protection and safety of GNRH-a after cervical cancer surgery. Methods: PubMed, Cochrane Library, and Web of Science databases were systematically searched to retrieve articles on domestic trials examining the use of GNRH-a treatment in cervical cancer patients, published from January 2014 to January 2021, which were reviewed according to the inclusion and exclusion criteria of this study. The meta-analysis of the included study data was conducted using Stata 15.0. Results: In total, 10 articles were included in the meta-analysis, comprising 579 ovarian-reserved cervical cancer subjects, all of whom received 4-6 standardized courses of PC (Paclitaxel + Cisplatin) chemotherapy. The following statistically significant differences were found: bovine follicle stimulating hormone [odds ratio (OR) =1.82, 95% confidence interval (CI): 1.38-2.38; P<0.0001], bovine estrogen 2 (OR =2.39, 95% CI: 1.69-3.37; P<0.00001), anti-Mullerian hormone (OR =2.39, 95% CI: 1.71-3.34; P<0.00001), and bovine antral follicle count (OR =2.11, 95% CI: 1.49-2.99; P<0.0001); but there is no statistically significant difference incidence of coincidences (OR =0.80, 95% CI: 0.49-1.31; P=0.38). Conclusions: The use of GNRH-a in cervical cancer patients receiving the PC chemotherapy regimen plays a significant role in protecting ovarian function.

The diagnostic accuracy of TCT + HPV-DNA for cervical cancer: systematic review and meta-analysis.

Background: This study sought to systematically analyze the clinical diagnostic value of tumor markers combined with ThinPrep cytologic test (TCT) and human papillomavirus (HPV) deoxyribonucleic acid (DNA) detection for cervical cancer and pre-cancerous lesions. However, there is a lot of controversy in the field of TCT + HPV-DNA. Many people have mixed opinions on the accuracy of TCT + HPV-DNA, and there is no unified opinion. Therefore, it is necessary to further confirm the significance of this combined detection method in the early diagnosis of cervical cancer by applying meta method. Methods: The Cochrane Library, PubMed, Web of Science, Embase, Chinese Biomedical Literature Database (CBM) databases were searched to retrieve studies. To assess the methodological quality of each study and potential risk of bias, QUADAS-2 Guidelines were used to evaluate the quality of all articles that met the inclusion criteria and data extraction of the included articles were performed, and a meta-analysis was performed of the included studies using Review Manager 5.2 software. Results: A total of 5 studies were included in the study, and a total of 2,778 patients were included in the study, and there was no significant publication bias observed. The meta-analysis showed that there was a statistical difference in terms of the accuracy of the tumor markers combined with TCT in the detection of cervical cancer. The results were as follows: the pooled sensitivity (SEN) was 0.86 (95% CI: 0.75-0.93); the combined specificity (SPE) was 0.79 (95% CI: 0.57-0.92); the diagnostic performance of combined with thin-layer liquid-based cytology and HPV DNA detection in the diagnosis accuracy of cervical cancer by summary receiver operating characteristic (SROC) curve analysis, result showed excellent diagnostic accuracy, with a combined area under the curve (AUC) of 0.90 (95% CI: 0.87-0.92). Discussion: Tumor markers are important for the early diagnosis of cervical cancer. Combining the tumor markers with TCT and HPV DNA detection effectively improved the detection rate.

Interleukin 17 induces up-regulation of chemokine and cytokine expression via activation of the nuclear factor κB and extracellular signal-regulated kinase 1/2 pathways in gynecologic cancer cell lines.

OBJECTIVES: Previous studies have revealed that interleukin 17 (IL-17) contributes to pathological processes in many solid tumors. However, the roles of IL-17 in gynecologic cancer still remain elusive, hindering the deep understanding of gynecologic tumorigenesis. METHODS: In the present study, to delineate the functional roles of IL-17 in gynecologic cancer, IL-17 stimulation was introduced in cell lines of 3 gynecologic cancers, and IL-17-induced expression of chemokines and cytokines and possible signaling pathways were investigated. RESULTS: Our results showed that in HEC-1-B (human endometrial cancer) cells, IL-17 stimulation induced mRNA level increases of CCL2, CCL5, CCL20, CXCL2, and IL-8. Similar treatment in HeLa cells caused increases in the mRNA levels of CCL2, CXCL2, IL-6, and IL-8, and in SKOV3 cells, mRNA levels of CCL2, CCL20, CXCL1, CXCL2, IL-6, and IL-8 increased. The increases in mRNA levels induced by IL-17 were dose- and time-dependent. Furthermore, with the addition of the NF-κB (nuclear factor κ-light-chain-enhancer of activated B) and extracellular signal-regulated kinase inhibitors pyrrolidine dithiocarbamate and PD98059, the IL-17-induced CCL2 mRNA level was significantly compromised. IL-17 stimulation also activated phosphorylation of IκBα and extracellular signal-regulated kinase 1/2 in a time-dependent manner. CONCLUSION: These results demonstrated that IL-17 may regulate chemokines and cytokines in gynecologic cancers.

Effectiveness of vitamin D supplementation on lipid profile in polycystic ovary syndrome women: a meta-analysis of randomized controlled trials.

BACKGROUND: Vitamin D deficiency (VDD) is prevalent in polycystic ovary syndrome (PCOS) and the relationship between dyslipidemia and vitamin D status is close. This meta-analysis was to evaluate the effect of vitamin D (alone or with co-supplementation) on lipid profile in PCOS patients. METHODS: Medline, the Cochrane Library, PubMed, and Web of Science were searched, and randomized controlled trials (RCTs) published prior to January, 2020 were identified. The pooled estimates of standardized mean deviation (SMD) with 95% confidence intervals (CI) were calculated using a fixed effect model or random effect model. RESULTS: A total of 954 identified studies were retrieved, and 11 RCTs involving 677 participants were ultimately included in the meta-analysis. The pooled results suggested an association between vitamin D supplementation and a reduction in total cholesterol (TC) concentrations (SMD: -0.36 mg/dL, 95% CI: -0.54 to -0.18 mg/dL, P<0.0001), triglycerides (TG) (SMD: -0.50 mg/dL, 95% CI: -0.68 to -0.32 mg/dL, P<0.00001), low-density lipoprotein cholesterol (LDL-C) (SMD: -0.28 mg/dL, 95% CI: -0.45 to -0.11 mg/dL, P=0.001), and very low-density lipoprotein cholesterol (VLDL-C) (SMD: -0.54 mg/dL, 95% CI: -0.74 to -0.35 mg/dL, P<0.00001), but no effect on high-density lipoprotein cholesterol (HDL-C) (SMD: 0.01 mg/dL, 95% CI: -0.16 to 0.18 mg/dL, P=0.89) was found. Subgroup analyses showed that the dosage of vitamin D used, the duration of intervention and the type of vitamin D supplementation (alone or with co-supplementation) might influence the effect of vitamin D on the lipid profile. CONCLUSIONS: This meta-analysis demonstrated that PCOS patients with the therapy of vitamin D had a statistical improvement in TC, TG, LDL-C, and VLDL-C, but did not affect HDL-C concentrations.

LncRNA NEAT1 promotes proliferation of ovarian cancer cells and angiogenesis of co-incubated human umbilical vein endothelial cells by regulating FGF9 through sponging miR-365: An experimental study.

OBJECTIVE: To uncover the function of lncRNA NEAT1 in ovarian cancer (OC) cells and its mechanism. METHODS: The expression patterns of lncRNA NEAT1 and FGF9 in human OC cells and human ovarian epithelial cells was determined. OC cells were transfected with sh-NEAT1, pcDNA3.1-NEAT1, miR-365 mimic, miR-365 inhibitor or pcDNA3.1-NEAT1 + sh-NEAT1 before cell proliferation rate and cell clone formation rate were measured. After the transfected OC cells were co-cultivated with human umbilical vein endothelial cells (HUVECs), Matrigel angiogenesis assay tested angiogenesis of HUVECs; qRT-PCR and Western blot tested the expressions of vascular endothelial growth factor (VEGF), angiogenin 1 (Ang-1) and matrix metalloproteinase 2 (MMP2). Dual-luciferase reporter assay determined the targeted binding of NEAT1 and FGF9 to miR-365. RESULTS: LncRNA NEAT1 and FGF9 are over-expressed in OC cells. Knockdown of NEAT1 or FGF9, or over-expression of miR-365 results in decreased proliferation rate and cell clones as well as inhibited angiogenesis and down-regulated expressions of VEGF, Ang-1 and MMP2. Over-expression of NEAT1 or knockdown of miR-365 can reverse the effect caused by FGF9 knockdown. NEAT1 can down-regulate the expression of miR-365 while up-regulating that of FGF9. Dual-luciferase reporter assay determined that NEAT1 competes with FGF9 for binding to miR-365. CONCLUSION: LncRNA NEAT1 up-regulates FGF9 by sponging miR-365, thus promoting OC cell proliferation and angiogenesis of HUVECs.

Efficacy of omega-3 polyunsaturated fatty acids on hormones, oxidative stress, and inflammatory parameters among polycystic ovary syndrome: a systematic review and meta-analysis.

BACKGROUND: There is a close relationship between hormones, oxidative stress, and inflammatory factors and polycystic ovary syndrome (PCOS). This meta-analysis was conducted to evaluate the changes in hormones, oxidative stress, and inflammatory factors of PCOS patients who were supplemented with omega-3 polyunsaturated fatty acids (n-3 PUFAs). METHODS: The databases of PubMed, Cochrane Library, Embase, and Web of Science were searched from inception to February 2021. We have included all randomized controlled trials (RCTs) that reported the n-3 PUFA treatment in PCOS. Weighted mean differences (WMD) and 95% confidence interval (CI) were calculated, and either the fixed effects model or random effects model was used. RESULTS: 314 studies were initially identified, and 10 RCTs with 610 patients were finally included in the current study. Results suggested that PCOS patients with n-3 PUFAs supplementation may have a reduction in C-reactive protein (CRP; -8.97 mg/dL; 95% CI: -17.66 to -0.28 mg/dL; P=0.04; I2=99%); serum malondialdehyde (MDA; -0.40 mg/dL; 95% CI: -0.56 to -0.25 mg/dL; P<0.00001; I2=42); luteinizing hormone (LH; -1.33 mg/dL; 95% CI: -2.63 to -0.04 mg/dL; P=0.04; I2=0%); serum total testosterone (TT; -0.11 mg/dL; 95% CI: -0.18 to -0.04 mg/dL; P=0.02; I2=73%); and an increase in total antioxidant capacity (TAC; 72.24 mg/dL; 95% CI: 22.32 to 122.16 mg/dL; P=0.005; I2=50%) and serum sex hormone binding globulin (SHBG; 0.68 mg/dL; 95% CI: 0.06 to 1.31 mg/dL; P=0.03; I2=0%).However, no effect on glutathione (GSH; -12.63 mg/dL; 95% CI: -50.34 to 25.07 mg/dL; P=0.51; I2=56%), dehydroepiandrosterone sulfate (DHEAS; -0.01 mg/dL; 95% CI: -1.53 to 1.50 mg/dL; P=0.99; I2=78%), free androgen index (FAI; 0.00 mg/dL; 95% CI: -0.03 to 0.03 mg/dL; P=0.99; I2=0%), or follicle-stimulating hormone (FSH; 0.37 mg/dL; 95% CI: -0.55 to 1.29 mg/dL; P=0.43; I2=61) was found. CONCLUSIONS: This meta-analysis showed that supplementation of n-3 PUFAs in PCOS women can significantly improve CRP, MDA, LH, TT, TAC, and SHBG, but did not affect the concentrations of GSH, DHEAS, FAI, or FSH.

Isoalantolactone inhibits pancreatic cancer proliferation by regulation of PI3K and Wnt signal pathway.

BACKGROUND/AIMS: Isoalantolactone (IATL) is one of multiple isomeric sesquiterpene lactones and is isolated from inula helenium. IATL has multiple functions such as antibacterial, antihelminthic and antiproliferative activities. IATL also inhibits pancreatic cancer proliferation and induces apoptosis by increasing ROS production. However, the detailed mechanism of IATL-mediated pancreatic cancer apoptosis remains largely unknown. METHODS: In current study, pancreatic carcinoma cell lines (PANC-1, AsPC-1, BxPC-3) and a mouse xenograft model were used to determine the mechanism of IATL-mediated toxic effects. RESULTS: IATL (20µM) inhibited pancreatic adenocarcinoma cell lines proliferation in a time-dependent way; while scratch assay showed that IATL significantly inhibited PANC-1 scratch closure (P<0.05); Invasion assays indicated that IATL significantly attenuated pancreatic adenocarcinoma cell lines invasion on matrigel. Signal analysis showed that IATL inhibited pancreatic adenocarcinoma cell proliferation by blocking EGF-PI3K-Skp2-Akt signal axis. Moreover, IATL induced pancreatic adenocarcinoma cell apoptosis by increasing cytosolic Caspase3 and Box expression. This apoptosis was mediated by inhibition of canonical wnt signal pathway. Finally, xenograft studies showed that IATL also significantly inhibited pancreatic adenocarcinoma cell proliferation and induced pancreatic adenocarcinoma cell apoptosis in vivo. CONCLUSIONS: IATL inhibits pancreatic cancer proliferation and induces apoptosis on cellular and in vivo models. Signal pathway studies reveal that EGF-PI3K-Skp2-Akt signal axis and canonical wnt pathway are involved in IATL-mediated cellular proliferation inhibition and apoptosis. These studies indicate that IATL may provide a future potential therapy for pancreatic cancer.

The antitumor effect of miR-448 in epithelial ovarian cancer.

BACKGROUND: Ovarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood. METHODS: The miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays. RESULTS: In this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2. CONCLUSIONS: Our study suggests that miR-448 has an inhibitory role in OC.

The suppressive role of miR-362-3p in epithelial ovarian cancer.

Ovarian cancer is a common cancer worldwide. Epithelial ovarian cancer (EOC) is the most common subtype of ovarian cancer. This study was designed to explore the function of miR-362-3p in EOC. QRT-PCR analysis was used to test miR-362-3p levels in EOC tissues and cell lines. Cell viability was tested via MTT assay. Transwell systems were applied to assay cell migration. The target gene of miR-362-3p was evaluated using dual luciferase reporter assays. The MyD88 protein in EOC cells was tested via western blot. Our data showed that miR-362-3p was expressed at low levels in EOC tissues and cells. miR-362-3p inhibited cell proliferation and migration, bound the 3'-untranslated region (UTR) of MyD88, and inhibited MyD88 expression. MyD88 was inversely correlated with miR-362-3p in EOC, and MyD88 overexpression partly reduced the anti-proliferative effect of miR-362-3p in EOC cells. In conclusion, our data showed that miR-362-3p has an anti-proliferative effect on EOC.

The outcomes and quality of life of young patients undergoing adjuvant radiotherapy versus non-radiotherapy following surgery treating early FIGO stage cervical squamous cell cancer in southwestern China.

BACKGROUND: The incidence of cervical cancer in young women is rising, and squamous cell carcinoma makes up a great percentage of the histological types. The presence of aggressive pathologic risk factors following patients' primary surgery may warrant the use of adjuvant radiotherapy. It is important to weigh up the risks and benefits of using adjuvant radiotherapy for each young patient so as to maximize their prognosis while minimizing the treatment-related morbidity. METHODS: A retrospective study was performed. It consisted of 97 patients under 35 years old who were diagnosed with cervical squamous cell carcinoma and underwent treatment at West China Second University Hospital between December 2009 and January 2014. Five-year follow-up, prognostic risks, long-term radiation toxicity, female sexual function, and quality of life were investigated. RESULTS: Adjuvant radiotherapy did improve the prognosis of young patients with lymph node metastases. However, there were few significant differences in progress-free survival and overall survival for the young patients without lymph node metastases following adjuvant radiotherapy. Besides, young patients who took radiotherapy exhibited greater intestinal dysfunction, more severe lower extremities edema, greater sexual dysfunction, and worse long-term quality of life. CONCLUSION: Young patients with early-stage cervical squamous cell carcinoma without lymph node metastases who have undergone the primary surgery should be counseled in detail before the decision to use adjuvant radiotherapy can be made. The counseling should emphasize not only the benefit that local recurrence rates can be reduced, but also the risks that treatment-related side effects could increase and lower QoL could occur.

LncRNA PVT1 epigenetically stabilizes and post-transcriptionally regulates FOXM1 by acting as a microRNA sponge and thus promotes malignant behaviors of ovarian cancer cells.

Accumulating evidence demonstrates that long noncoding RNAs (lncRNAs) may be involved in the regulation of cancer biology. PVT1, which is overexpressed in tumor samples, acts as an oncogenic promoter in several kinds of cancers, including ovarian cancer. However, the mechanisms of its regulation of malignant behaviors in ovarian cancer remain largely unknown. In this study, the expression of PVT1 in several ovarian cancer cell lines was analyzed by qRT-PCR. The effect of PVT1 on malignant behaviors, including cell proliferation, migration and invasion, was analyzed. The posttranscriptional regulation of FOXM1 by PVT1 was analyzed by western blotting. The results illustrated that PVT1 acted as a sponge and bound miR-370 on two binding sites. The expression of PVT1 positively regulated malignant behaviors in ovarian cancer cells, including cell proliferation, migration and invasion, which could be reversed by the introduction of miR-370 mimics. Sponged miR-370 failed to posttranscriptionally regulate FOXM1, which resulted in the promotion of malignant behavior. PVT1 was also found to bind to FOXM1 directly and stabilize the FOXM1 protein. The promoting effect of PVT1 on malignant behaviors and chemoresistance to cisplatin could be reversed by knockdown of FOXM1 and introduction of miR-370 mimics. Together, these results suggest that lncRNA PVT1 promotes malignant behavior and induces chemoresistance in ovarian cancer by epigenetic and posttranscriptional regulation of FOXM1.

Prostate cancer cells with stem cell characteristics reconstitute the original human tumor in vivo.

Cancer may arise from a cancer stem/progenitor cell that shares characteristics with its normal counterpart. We report the reconstitution of the original human prostate cancer specimen from epithelial cell lines (termed HPET for human prostate epithelial/hTERT) derived from this sample. These tumors can be described in terms of Gleason score, a classification not applied to any of the transgenic mouse models currently developed to mimic human disease. Immunohistochemical and Western blot analyses indicate that they do not express androgen receptor or p63, similar to that reported for prostate stem cells. These cell lines also express embryonic stem markers (Oct4, Nanog, and Sox2) as well as early progenitor cell markers (CD44 and Nestin) in vitro. Clonally derived HPET cells reconstitute the original human tumor in vivo and differentiate into the three prostate epithelial cell lineages, indicating that they arise from a common stem/progenitor cell. Serial transplantation experiments reconstitute the tumors, suggesting that a fraction of parental or clonally derived HPET cells have self-renewal potential. Thus, this model may enhance our understanding of human tumor development and provide a mechanism for studying cancer stem/progenitor cells in differentiation, tumorigenesis, preclinical testing, and the development of drug resistance.

DJ-1 binds androgen receptor directly and mediates its activity in hormonally treated prostate cancer cells.

The oncogene DJ-1 has been associated with multiple cancers, including prostate cancer, where it can be stabilized by androgens and antiandrogens. However, little data exist on the expression pattern and function of DJ-1 in prostate cancer. To address the function of DJ-1 in prostate, a yeast two-hybrid screen was done to identify novel DJ-1 binding proteins. The androgen receptor (AR) was identified and confirmed as a DJ-1 binding partner. This is the first evidence that DJ-1 directly interacts with AR. We also show that modulation of DJ-1 expression regulated AR transcriptional activity. Importantly, both the subcellular localization of DJ-1 and the interaction with AR are regulated by androgens and antiandrogens. Additionally, immunohistochemical staining on two human prostate cancer tissue arrays was done providing the first large-scale expression analysis of DJ-1 in prostate. DJ-1 expression did not change with Gleason pattern but increased after androgen deprivation therapy, indicating that it may be involved in the development of androgen independence. These data provide a novel mechanism where DJ-1-mediated regulation of AR may promote the progression of prostate cancer to androgen independence.

Apple consumption is associated with a distinctive microbiota, proteomics and metabolomics profile in the gut of Dawley Sprague rats fed a high-fat diet.

Apples contain bioactive compounds with the potential to alleviate clinical signs associated with obesity, a phenomenon likely related to the composition and function of the gut microbiota. The aim of this study was to investigate the effect of apple supplementation on the fecal microbiota and gut metabolites of Dawley Sprague rats fed a high-fat (HF group) or a low-fat (LF group) diet. The fecal microbiota was examined using 16S marker sequencing targeting the V4 region in a MiSeq instrument (Illumina). With the exception of Blautia, which was higher in supplemented rats compared to controls within the LF group, significant differences in fecal microbiota between supplemented rats and controls were only found in the HF group. This suggests that the effect of apple supplementation on the gut microbiota is strongly dependent on the composition of the diet, a phenomenon with potential consequences for obese human patients. Principal Coordinate Analysis of unweighted UniFrac distances revealed a clear strong separation of bacterial communities based on diet (HF and LF, P = 0.001, R = 0.69, ANOSIM test) and based on apple supplementation within the HF group, albeit less strongly (P = 0.006, R = 0.27, ANOSIM test). No differences were found for fecal SCFAs but proteomics and metabolomics analyses showed differential expression of both proteins and metabolites between supplemented rats and controls in the HF group. The results of this study can guide future explorations of the effect of apple supplementation on human health.

Effects of different dietary fatty acids on the fatty acid compositions and the expression of lipid metabolic-related genes in mammary tumor tissues of rats.

In this study, the effects of dietary fatty acids on the fatty acid compositions and lipid metabolic-related genes expression in N-methyl-N-nitrosourea (MNU)-induced rat mammary carcinogenesis were evaluated. The 50-day-old female Sprague-Dawley rats were intervened by different dietary fats (15% wt/wt), including saturated fatty acid (SFA), monounsaturated fatty acid (MUFA), n-6 polyunsaturated fatty acid (PUFA), n-3 PUFA, 1:1 n-6/n-3, 5:1 n-6/n-3, 10:1 n-6/n-3, and 1:2:1 S/M/P (1:1 n-6/n-3), alone or in combination with MNU. There was no mammary tumor occurrence in the control and MNU-treated n-3 PUFA groups after 18 wk. n-3 PUFA diet retarded the weight growth of rats. 1:1 n-6/n-3 diet significantly reduced the MNU-induced tumor incidence and tumor multiplicity compared with SFA, MUFA, n-6 PUFA, 5:1 n-6/n-3, 10:1 n-6/n-3 and 1:2:1 S/M/P diets (42.86% vs. 83.33%-92.31%, 0.79 vs. 2.62-2.85, P < 0.01). Additionally, 1:1 n-6/n-3 diet substantially increased cis-5,8,11,14,17-eicosapentaenoic acid and cis-4,7,10,13,16,19-docosahexaenoic acid levels, whereas it decreased C20:4 level and the mRNA expressions of fatty acid synthase, Cyclooxygenase-2 (COX-2), and 5-lipoxygenase (5-LOX) in mammary tissues (P < 0.05). These results suggest that 1:1 n-6/n-3 in the diet is effective in the prevention of mammary tumor development by increasing the n-3 PUFA content and reducing the expression of lipid metabolic-related genes.