Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 10 de 10
Filtrar
1.
J Transl Med ; 21(1): 710, 2023 10 10.
Artigo em Inglês | MEDLINE | ID: mdl-37817249

RESUMO

BACKGROUND: Chimeric antigen receptor NK (CAR-NK) cell therapy is one of the most promising immunotherapies. Although it has shown a significant therapeutic effect in hematologic malignancies, few successes have been obtained in solid tumors including esophageal squamous cell carcinoma (ESCC). The major reasons are lack of specific cell surface antigens and complex tumor microenvironment. Here we identify CD22, a well-known tumor surface marker in hematologic malignancies, is expressed in ESCC, possibly serving as a potential target of CAR-NK cell therapy. METHODS: The expression of 13 tumor cell surface antigens used clinically was analyzed in patients from The Cancer Genome Atlas (TCGA) database. Also, mRNA expression were detected in 2 ESCC cell lines and 2 patients samples by qCPR. Then according to Venn diagram, CD22 was selected for further investigation. Following this, the expression of CD22 by immunofluorescence (IF) in ESCC cell lines and by immunohistochemistry (IHC) in 87 cases of human ESCC samples was detected respectively. On the basis of H-score results, the correlation between CD22 expression and clinical parameters was analyzed. As a proof, the efficacy of CD22-targeted CAR-NK cells against ESCC cell lines was performed by a real-time cell analyzer (RTCA) platform. RESULTS: KYSE-140 and KYSE-150 cell lines displayed surface expression of CD22. IHC showed an 80.46% (70/87) positive rate in ESCC patient samples. Among these, cell membranous expression of CD22 was observed in 27.59% (24/87) patient samples. Through chi-square test, expression of CD22 in ESCC was associated with lymph node metastasis while it was no related to the depth of tumor invasion and clinical stage. Engineered CD22-targeted CAR-NK cells exhibited inhibitory growth capability against ESCC cell lines (p < 0.0001). CONCLUSIONS: CD22 is a potential tumor surface antigen capable of being targeted by CAR-NK cells in ESCC. And potential therapeutics for ESCC may be developed based on immune cells expressing anti-CD22 CAR. The study also indicates that CD22 CAR-NK cells could be used in other cancers and more in vivo experiments are needed.


Assuntos
Carcinoma de Células Escamosas , Neoplasias Esofágicas , Carcinoma de Células Escamosas do Esôfago , Neoplasias Hematológicas , Humanos , Carcinoma de Células Escamosas do Esôfago/terapia , Neoplasias Esofágicas/genética , Carcinoma de Células Escamosas/patologia , Biomarcadores Tumorais/genética , Células Matadoras Naturais , Antígenos de Superfície/metabolismo , Terapia Baseada em Transplante de Células e Tecidos , Linhagem Celular Tumoral , Microambiente Tumoral , Lectina 2 Semelhante a Ig de Ligação ao Ácido Siálico/metabolismo
2.
Int J Mol Sci ; 24(3)2023 Jan 21.
Artigo em Inglês | MEDLINE | ID: mdl-36768478

RESUMO

Triple-negative breast cancer (TNBC) accounts for 15-20% of all breast cancer cases. Due to the lack of expression of well-known molecular targets [estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2)], there is a need for more alternative treatment approaches in TNBC. Chimeric antigen receptor (CAR)-T cell-based immunotherapy treatment is one of the latest treatment technologies with outstanding therapeutic advances in the past decade, especially in the treatment of hematologic malignancies, but the therapeutic effects of CAR-T cells against solid tumors have not yet shown significant clinical benefits. Identification of highly specific CAR-T targets in solid tumors is also crucial for its successful treatment. CD22 is reported to be a multifunctional receptor that is mainly expressed on the surface of mature B-cells (lymphocytes) and is also highly expressed in most B-cell malignancies. This study aimed to investigate the expression of CD22 in TNBC. Bioinformatic analysis was performed to evaluate the expression of CD22 in breast carcinoma and normal tissues. RNA-seq data of normal and breast carcinoma patients were downloaded from The Cancer Genome Atlas (TCGA), and differential gene expression was performed using R language. Additionally, online bioinformatics web tools (GEPIA and TNM plot) were used to evaluate the expression of CD22 in breast carcinoma and normal tissues. Western blot (WB) analysis and immunofluorescence (IF) were performed to characterize the expression of CD22 in TNBC cell lines. Immunohistochemical (IHC) staining was performed on tumor specimens from 97 TNBC patients for CD22 expression. Moreover, statistical analysis was performed to analyze the association of clinical pathological parameters with CD22 expression. Correlation analysis between overall survival data of TNBC patients and CD22 expression was also performed. Differential gene expression analysis of TCGA data revealed that CD22 is among the upregulated differentially expressed genes (DEGs) with high expression in breast cancer, as compared to normal breast tissues. WB and IF analysis revealed high expression of CD22 in TNBC cell lines. IHC results also showed that approximately 62.89% (61/97) of TNBC specimens were stained positive for CD22. Cell membrane expression of CD22 was evident in 23.71% (23/97) of TNBC specimens, and 39.18% (38/97) of TNBC specimens showed cytoplasmic/membrane expression, while 37.11% (36/97) specimens were negative for CD22. Furthermore, significant associations were found between the size of tumors in TNBC patients and CD22 expression, which unveils its potential as a prognostic biomarker. No significant correlation was found between the overall survival of TNBC patients and CD22 expression. In conclusion, we demonstrated for the first time that CD22 is highly expressed in TNBC. Based on our findings, we anticipated that CD22 could be used as a prognostic biomarker in TNBC, and it might be a potential CAR-T target in TNBC for whom few therapeutic options exist. However, more large-scale studies and clinical trials will ensure its potential usefulness as a CAR-T target in TNBC.


Assuntos
Receptores de Antígenos Quiméricos , Neoplasias de Mama Triplo Negativas , Humanos , Neoplasias de Mama Triplo Negativas/terapia , Neoplasias de Mama Triplo Negativas/tratamento farmacológico , Receptores de Antígenos Quiméricos/uso terapêutico , Prognóstico , Imunoterapia Adotiva/métodos , Biologia Computacional , Lectina 2 Semelhante a Ig de Ligação ao Ácido Siálico/genética
3.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artigo em Inglês | MEDLINE | ID: mdl-31870337

RESUMO

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.


Assuntos
Duplicação Gênica , Heterozigoto , Proteínas de Homeodomínio/genética , Mutação , Sindactilia/genética , Fatores de Transcrição/genética , Criança , China , Éxons , Feminino , Humanos , Masculino , Linhagem
4.
Genes (Basel) ; 13(5)2022 04 27.
Artigo em Inglês | MEDLINE | ID: mdl-35627156

RESUMO

A comprehensive summary of recent knowledge in syndactyly (SD) is important for understanding the genetic etiology of SD and disease management. Thus, this review article provides background information on SD, as well as insights into phenotypic and genetic heterogeneity, newly identified gene mutations in various SD types, the role of HOXD13 in limb deformities, and recently introduced modern surgical techniques for SD. This article also proposes a procedure for genetic analysis to obtain a clearer genotype-phenotype correlation for SD in the future. We briefly describe the classification of non-syndromic SD based on variable phenotypes to explain different phenotypic features and mutations in the various genes responsible for the pathogenesis of different types of SD. We describe how different types of mutation in HOXD13 cause various types of SD, and how a mutation in HOXD13 could affect its interaction with other genes, which may be one of the reasons behind the differential phenotypes and incomplete penetrance. Furthermore, we also discuss some recently introduced modern surgical techniques, such as free skin grafting, improved flap techniques, and dermal fat grafting in combination with the Z-method incision, which have been successfully practiced clinically with no post-operative complications.


Assuntos
Proteínas de Homeodomínio , Sindactilia , Genes Homeobox , Proteínas de Homeodomínio/genética , Humanos , Linhagem , Sindactilia/genética , Sindactilia/patologia , Sindactilia/cirurgia , Fatores de Transcrição/genética
5.
Biosci Rep ; 40(3)2020 03 27.
Artigo em Inglês | MEDLINE | ID: mdl-32124929

RESUMO

BACKGROUND: Prenatal intake of folic acid is important for prevention of NSCL/P (nonsyndromic cleft lip with or without cleft palate). Associated genes in folate pathway are major enzymes of folic acid metabolism that is crucial for preventing birth defects. The present meta-analysis aims to investigate the association between four SNPs in folate pathway genes and the risk of NSCL/P. METHODS: Comprehensive bioinformatics analysis was used to predict the functional pathogenicity of genetic variation. The PubMed, Embase database and Google Scholar were searched by two researchers. Stata 11.0 software was used to analyze the results. Subgroup analysis was carried out to assess the influence of genetic background. Sensitivity analysis, regression analysis and publication analysis were also conducted to enhance the strength of our results. RESULTS: It is estimated that the probability of two missense mutation rs1801133 in MTHFR and rs1801394 in MTRR are more likely to be damaging by bioinformatics analysis. A significant association between rs1801133 and risk of NSCL/P in two genetic models: TT genotype vs CC genotype (OR = 1.333 95%CI = 1.062-1.674, P = 0.013), and recessive model (OR = 1.325 95%CI = 1.075-1.634, P = 0.008). A significant protective association between rs1801394 GG genotype and NSCL/P in Asian (GG vs AA, OR = 0.520 95%CI = 0.321-0.841, P = 0.008) was observed. Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically significant. CONCLUSIONS: The present study identified that rs1801133 in MTHFR is associated with the risk of NSCL/P, and rs1801394 GG genotype in MTRR play a protective role in Asian. Further, larger studies should be performed to confirm these findings.


Assuntos
Encéfalo/anormalidades , Fenda Labial/genética , Fissura Palatina/genética , Ferredoxina-NADP Redutase/genética , Metilenotetra-Hidrofolato Redutase (NADPH2)/genética , Povo Asiático/genética , Encéfalo/metabolismo , Estudos de Casos e Controles , China , Fenda Labial/metabolismo , Fissura Palatina/metabolismo , Ferredoxina-NADP Redutase/metabolismo , Ácido Fólico/genética , Ácido Fólico/metabolismo , Frequência do Gene/genética , Predisposição Genética para Doença , Homocistinúria/genética , Humanos , Metilenotetra-Hidrofolato Redutase (NADPH2)/deficiência , Metilenotetra-Hidrofolato Redutase (NADPH2)/metabolismo , Espasticidade Muscular/genética , Polimorfismo de Nucleotídeo Único , Transtornos Psicóticos/genética , Fatores de Risco
6.
Biomed Pharmacother ; 128: 110244, 2020 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-32464306

RESUMO

Emodin is a promising anti-cancer reagent. To improve the physicochemical and anti-cancer property, we modified its structure and get a derivative called emodin succinyl ester (ESE). Here, we investigated the effect of ESE on the suppression of hepatocellular carcinoma (HCC) and the underlying mechanism. Our results showed that ESE strongly inhibited HCC cell proliferation and migration in vitro. Further study revealed that ESE treatment decreased transcription level and protein expression of androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2), two key factors interacting to promote aggressive HCC development. Conversely, overexpression of AR attenuated the inhibitory effect of ESE on EZH2 expression, and vice versa. Importantly, overexpression of AR or EZH2 could counteract ESE-suppressed cell proliferation and migration. The association of ESE-targeted AR and EZH2 with the suppression of tumorigenicity was further confirmed in xenograft and diethylnitrosamine (DEN)-induced HCC mouse models. These findings validate the therapeutic effect of ESE on HCC aggression by targeting the interaction of AR and EZH2, suggesting ESE may be a potent drug in the clinical treatment of HCC.


Assuntos
Antineoplásicos Fitogênicos/farmacologia , Carcinoma Hepatocelular/tratamento farmacológico , Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Emodina/farmacologia , Proteína Potenciadora do Homólogo 2 de Zeste/metabolismo , Neoplasias Hepáticas/tratamento farmacológico , Receptores Androgênicos/metabolismo , Animais , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Carcinoma Hepatocelular/patologia , Linhagem Celular Tumoral , Emodina/análogos & derivados , Proteína Potenciadora do Homólogo 2 de Zeste/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , Neoplasias Hepáticas/patologia , Camundongos Endogâmicos BALB C , Camundongos Endogâmicos C57BL , Camundongos Nus , Invasividade Neoplásica , Receptores Androgênicos/genética , Transdução de Sinais , Ensaios Antitumorais Modelo de Xenoenxerto
7.
Biosci Rep ; 40(6)2020 06 26.
Artigo em Inglês | MEDLINE | ID: mdl-32432717

RESUMO

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3-4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

8.
Dis Markers ; 2020: 6292818, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32626542

RESUMO

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.


Assuntos
Subfamília B de Transportador de Cassetes de Ligação de ATP/deficiência , Colestase Intra-Hepática/genética , Sequenciamento do Exoma/métodos , Mutação de Sentido Incorreto , Subfamília B de Transportador de Cassetes de Ligação de ATP/genética , Subfamília B de Transportador de Cassetes de Ligação de ATP/metabolismo , Adolescente , Regulação para Baixo/efeitos dos fármacos , Feminino , Células Hep G2 , Homozigoto , Humanos , Leupeptinas/farmacologia , Linhagem
9.
Dis Markers ; 2020: 8360841, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32076465

RESUMO

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a "pathogenic" variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS.


Assuntos
Neoplasias Colorretais Hereditárias sem Polipose/genética , Sequenciamento do Exoma/métodos , Proteína 1 Homóloga a MutL/genética , Proteína 1 Homóloga a MutL/metabolismo , Mutação de Sentido Incorreto , Adulto , China , Neoplasias Colorretais Hereditárias sem Polipose/metabolismo , Regulação para Baixo , Feminino , Estudos de Associação Genética , Predisposição Genética para Doença , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Pessoa de Meia-Idade , Endonuclease PMS2 de Reparo de Erro de Pareamento/metabolismo , Linhagem
10.
Heliyon ; 5(12): e03019, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31886431

RESUMO

Non syndromic orofacial clefts specifically non-syndromic cleft lip/palate are one of the most common craniofacial malformation among birth defects in human having multifactorial etiology with an incidence of 1:700/1000. On the basis of association with other congenital malformations or their presence as isolated anomaly, OFC can be classified as syndromic (30%) and nonsyndromic (70%) respectively. The major cause of disease demonstrates complex interplay between genetic and environmental factors. The pathogenic mechanism of underlying factors have been provided by different genetic studies on large-scale with significant recent advances in genotyping technologies usually based on linkage or genome wide association studies (GWAS). On the basis of recent studies, new tools to identify causative genes involved in NSCL/P reported approximately more than 30 genetic risk loci that are responsible for pathogenesis of facial deformation. Despite these findings, it is still uncertain that how much of variance in NSCL/P predisposing factors can be explain by identified risk loci, as they all together accounts for only 20%-25% of NSCL/P heritability. So there is need of further findings about the problem of rare low frequency coding variants and other missing responsive factors or genetic modifiers. This review will described those potential genes and loci reported in different studies whose involvement in pathogenesis of nonsyndromic OFC has wide scientific evidence.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA