ICTV Virus Taxonomy Profile: Fimoviridae 2024.

Members of the family Fimoviridae are plant viruses with a multipartite negative-sense enveloped RNA genome (-ssRNA), composed of 4-10 segments comprising 12.3-18.5 kb in total, within quasi-spherical virions. Fimoviruses are transmitted to plants by eriophyid mites and induce characteristic cytopathologies in their host plants, including double membrane-bound bodies in the cytoplasm of virus-infected cells. Most fimoviruses infect dicotyledonous plants, and many cause serious disease epidemics. This is a summary of the ICTV Report on the family Fimoviridae, which is available at ictv.global/report/fimoviridae.

The species, density, and intra-plant distribution of mites on red raspberry (Rubus idaeus L.).

The adoption of the European Green Deal will limit acaricide use in high value crops like raspberry, to be replaced by biological control and other alternative strategies. More basic knowledge on mites in such crops is then necessary, like species, density, and their role as vectors of plant diseases. This study had four aims, focusing on raspberry leaves at northern altitude: (1) identify mite species; (2) study mite population densities; (3) investigate mite intra-plant distribution; (4) investigate co-occurrence of phytophagous mites, raspberry leaf blotch disorder and raspberry leaf blotch virus (RLBV). Four sites in south-eastern Norway were sampled five times. Floricanes from different parts of the sites were collected, taking one leaf from each of the upper, middle, and bottom zones of the cane. Mites were extracted with a washing technique and processed for species identification and RLBV detection. Mites and leaves were tested for RLBV by reverse transcription polymerase chain reaction (RT-PCR) with virus-specific primers. Phytophagous mites, Phyllocoptes gracilis, Tetranychus urticae, and Neotetranychus rubi, and predatory mites, Anystis baccarum and Typhlodromus (Typhlodromus) pyri were identified. All phytophagous mites in cultivated raspberry preferred the upper zone of floricanes, while in non-cultivated raspberry, they preferred the middle zone. The presence of phytophagous mites did not lead to raspberry leaf blotch disorder during this study. RLBV was detected in 1.3% of the sampled plants, none of them with leaf blotch symptoms, and in 4.3% of P. gracilis samples, and in some spider mite samples, implying that Tetranychids could also be vectors of RLBV.

Identification of a Second Vector for Rose Rosette Virus.

Rose rosette devastates the ornamentals industry in the United States. The disease, caused by rose rosette emaravirus (RRV), is vectored by the eriophyoid mite Phyllocoptes fructiphilus (Acari: Eriophyoidea). In this communication, we investigate two other Phyllocoptes species, P. adalius and P. arcani, for their vector competency and transmission efficiencies in single and multiple mite transfer experiments. P. arcani was identified as a second vector of RRV, a finding of significance for the epidemiology of the disease, as the second vector may be present in plants where P. fructiphilus is absent.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

First report of perilla mosaic emaravirus infecting Perilla frutescens in South Korea.

Perilla mosaic virus (PerMV; the genus Emaravirus in the family Fimoviridae) has a multiple, negative-sense, single-stranded RNA genome (ICTV, 2018). PerMV has been reported in Japan, where it was transmitted by an eriophyid mite species (Acari: Eriophyidae) to Perilla frutescens (L.) Britton var. crispa (Kubota et al., 2020). In September 2021, typical symptoms of the virus including yellow flecks, mosaic symptoms, and malformation were observed in leaves of P. frutescens in a cultivated field in Iseo-myeon, Wanju, South Korea (Suppl. Fig. 1). Visual estimates indicated that symptom incidence reached 70%, and the top leaves of perilla plants exhibited more severe symptoms and leaf distortion. To identify the virus species accurately, total RNA was extracted from five symptomatic perilla leaves collected using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) then cDNAs were amplified by reverse-transcription polymerase chain reaction (RT-PCR) using two pairs of primers to PerMV specific primer set designed to amplify 412- and 491-bp cDNAs of the nucleocapsid protein gene RNA 3 and movement protein gene RNA 4, respectively (Suppl. Table). Single-infection of PerMV in symptomatic Korean perilla plants was confirmed by high-throughput sequence (HTS) analysis and de novo transcriptome assembly using the Illumina HiSeq 4000 platform (Macrogen Inc., Seoul, Korea). The assembled sequences were aligned with viral reference genomes through searches performed using the BLASTn tool. Seven contigs (597-7,213 bp) revealed 92.09-97.37% nucleotide homology with RNAs of the isolate PerMV_Kochi_Nankoku_2011 (accession numbers LC496090 to LC496099) in the GenBank database. Other viruses including turnip mosaic virus and cucumber green mottle mosaic virus were not identified by HTS analysis (Cho et al., 2021; Park et al., 2020; Song et al., 2022). Seven RNA genomes of PerMV were confirmed by RT-PCR using specific primer sets designed to amplify part of each genome (Suppl. Table 1 and Fig. 2). The complete nucleotide sequences of PerMV (named IS isolate) RNA 1-7 were determined to be 7,177, 2,089, 1,094, 1,302, 1,079, 1,098, and 995 bp in length, respectively; these were deposited in GenBank (LC721296-LC721303). Sap from a symptomatic leaf sample confirmed for single infection was inoculated mechanically onto the leaves of 10 healthy P. frutescens seedlings, which developed the same PerMV symptoms within 3 weeks. These results indicate that PerMV is the causal agent of viral disease in Korean perilla plants cultivated in South Korea. To our knowledge, this is the first report of a perilla mosaic emaravirus infecting to Korean perilla, P. frutescens in South Korea.

Development of a Reverse Genetic System for Studying Rose Rosette Virus in Whole Plants.

Rose rosette virus (RRV) is a negative-sense RNA virus with a seven-segmented genome that is enclosed by a double membrane. We constructed an unconventional minireplicon system encoding the antigenomic (ag)RNA1 (encoding the viral RNA-dependent RNA polymerase [RdRp]), agRNA3 (encoding the nucleocapsid protein [N]), and a modified agRNA5 containing the coding sequence for the iLOV protein in place of the P5 open reading frame (R5-iLOV). iLOV expression from the R5-iLOV template was amplified by activities of the RdRp and N proteins in Nicotiana benthamiana leaves. A mutation was introduced into the RdRp catalytic domain and iLOV expression was eliminated, indicating RNA1-encoded polymerase activity drives iLOV expression from the R5-iLOV template. Fluorescence from the replicon was highest at 3 days postinoculation (dpi) and declined at 7 and 13 dpi. Addition of the tomato bushy stunt virus (TBSV) P19 silencing-suppressor protein prolonged expression until 7 dpi. A full-length infectious clone system was constructed of seven binary plasmids encoding each of the seven genome segments. Agro-delivery of constructs encoding RRV RNAs 1 through 4 or RNAs 1 through 7 to N. benthamiana plants produced systemic infection. Finally, agro-delivery of the full-length RRV infectious clone including all segments produced systemic infection within 60 dpi. This advance opens new opportunities for studying RRV infection biology.

The population structure of Rose rosette virus in the USA.

Rose rosette virus (RRV) (genus Emaravirus) is the causal agent of the homonymous disease, the most destructive malady of roses in the USA. Although the importance of the disease is recognized, little sequence information and no full genomes are available for RRV, a multi-segmented RNA virus. To better understand the population structure of the virus we implemented a Hi-Plex PCR amplicon high-throughput sequencing approach to sequence all 7 segments and to quantify polymorphisms in 91 RRV isolates collected from 16 states in the USA. Analysis revealed insertion/deletion (indel) polymorphisms primarily in the 5' and 3' non-coding, but also within coding regions, including some resulting in changes of protein length. Phylogenetic analysis showed little geographical structuring, suggesting that topography does not have a strong influence on virus evolution. Overall, the virus populations were homogeneous, possibly because of regular movement of plants, the recent emergence of RRV and/or because the virus is under strong purification selection to preserve its integrity and biological functions.

Raspberry leaf blotch emaravirus in Bosnia and Herzegovina: population structure and systemic movement.

Raspberry leaf blotch virus (RLBV) is the putative agent of the homonymous disease and even though Bosnia and Herzegovina is a major producer worldwide there is no report of the virus presence in the country. We studied the virus population structure and assessed its ability to move systemically. RLBV is widespread in production areas and has a homogeneous population structure; leading to the hypothesis that the primary mode of dissemination is propagation material. The ability of the virus to move systemically eliminates propagation of root cuttings as a viable option to obtain RLBV-free plants, leaving RT-PCR screening as the better option to propagate RLBV- free plants in the absence of clean-up facilities or certification programs in the country.

Perilla Mosaic Virus Is a Highly Divergent Emaravirus Transmitted by Shevtchenkella sp. (Acari: Eriophyidae).

Shiso (Perilla frutescens var. crispa) is widely grown as an important vegetable or herb crop in Japan. Beginning around the year 2000, occurrences of severe mosaic symptoms on shiso were documented and gradually spread across Kochi Prefecture, one of four major shiso production areas in Japan. Next generation sequencing and cloning indicated the presence of a previously unknown virus related to the members of the genus Emaravirus, for which we proposed the name Perilla mosaic virus (PerMV). The genome of PerMV consists of 10 RNA segments, each encoding a single protein in the negative-sense orientation. Of these proteins, P1, P2, P3a, P3b, P4, and P5 show amino acid sequence similarities with those of known emaraviruses, whereas no similarities were found in P6a, P6b, P6c, and P7. Characteristics of the RNA segments as well as phylogenetic analysis of P1 to P4 indicate that PerMV is a distinct and highly divergent emaravirus. Electron microscopy observations and protein analyses corresponded to presence of an emaravirus. Transmission experiments demonstrated that an eriophyid mite, Shevtchenkella sp. (family Eriophyidae), transmits PerMV with a minimum 30-min acquisition access period. Only plants belonging to the genus Perilla tested positive for PerMV, and the plant-virus-vector interactions were evaluated. The nucleotide sequences reported here are available in the DDBJ/ENA/GenBank databases under accession numbers LC496090 to LC496099.

Identification and Characterization of a Pear Chlorotic Leaf Spot-Associated Virus, a Novel Emaravirus Associated with a Severe Disease of Pear Trees in China.

Pear chlorotic leaf spot (PCLS) is a recently emerged disease of commercially cultivated sandy pear (Pyrus pyrifolia) trees in central and southern China. By integrating high-throughput sequencing and conventional Sanger sequencing of reverse-transcription (RT)-PCR products, a novel emaravirus infecting pear trees was identified and molecularly characterized. The virus was provisionally named pear chlorotic leaf spot-associated virus (PCLSaV). PCLSaV shows the typical molecular features of members of the genus Emaravirus in the family Fimoviridae. It has a genome composed of at least five negative-sense RNA segments, with each containing a single open reading frame and two complementary 13-nucleotide stretches at the 5' and 3' termini. PCLSaV shows a close phylogenetic relationship with recognized emaraviruses but forms a separate clade. Moreover, double-membrane-bound bodies were observed in PCLSaV-infected tissues and in extracts of PCLSaV-infected leaves. For the first time, our study revealed the profile distribution of viral RNA reads from the RNA-seq libraries of three samples along the RNA1 to RNA5 of an emaravirus. Field surveys combined with specific RT-PCR assays revealed the presence of PCLSaV in almost all PCLS-diseased pear samples, strongly supporting the association of the virus with the PCLS disease. This study revealed the first emaravirus infecting pear trees and its association with a severe pear chlorotic leaf disease.

First report of pear chlorotic leaf spot-associated virus on Japanese and European pears in Japan and its detection from an eriophyid mite.

In May 2018, three leaf samples were collected from Japanese pear trees cv. "Hosui" that exhibited typical chlorotic spot symptoms (Supplementary Figure S1) in a germplasm nursery in Tsukuba, Ibaraki. Total RNA was prepared using the rapid CTAB method (Gambino et al. 2008) for high-throughput sequencing, as described by Kubota et al. (2020). In brief, after removing ribosomal RNAs, a library was constructed by fragmenting RNA, synthesizing cDNA, and polymerase chain reaction (PCR) amplification. Sequencing was performed using NovaSeq 6000 sequencer (Illumina, San Diego, CA, U.S.A.) with paired-end 150 nt reads. De novo assembly was performed using CLC Genomics Workbench 11.0 Software (Qiagen, Hilden, Germany), with a minimum length of 500 bp. A total of 36,017 contigs derived from 33,565,182 reads were obtained and subjected to BLASTX search against the GenBank sequence database as of January 2019. Viruses commonly found in stone fruits, i.e., apple stem pitting virus, apple green crinkle-associated virus, apricot latent virus (foveaviruses), and apple stem grooving virus (a capillovirus), were detected. In addition, five contigs with amino acid sequence homologies to P1-P4 of known emaraviruses and the P7 of High Plains wheat mosaic virus (Tatineni et al. 2014) were detected and designated as PEV-Jp. The complete nucleotide (nt) sequences of the five segments of PEV-Jp were determined by Sanger sequencing of cloned reverse transcription (RT)-PCR amplification products using the primers shown in Supplementary Table S1; the 5'- and 3'-terminal sequences were RACE verified (Takara Bio, Shiga, Japan). In pairwise comparisons, the complete RNA1 to RNA5 of PEV-Jp (LC554756-760) shared 90.7% to 98.7% nt identities with those of PCLSaV-CG1 (MK602177-181), indicating that PEV-Jp is an isolate of PCLSaV. Using newly designed segment-specific primers (Supplementary Table S1), 12 symptomatic Japanese pear trees cv. "Kosui" sampled in 2020 from the same nursery tested positive for PCLSaV by RT-PCR while 12 symptomless trees were negative for the virus. Similar chlorotic spots, sometimes accompany necrotic spots, were observed on European pear (Pyrus communis) cv. "Le Lectier." (Fig. S1F) in Niigata in 2019; PCLSaV was detected by RT-PCR in leaf tissue samples from symptomatic trees (n = 3/3) but not in symptomless trees (n = 0/2). No vector for PCLSaV has been identified (Liu et al. 2020) but acaricide sprays in the early spring are effective for preventing occurrence of chlorotic spots in pear orchards (Nakai et al. 2018). Since the infestations of Eriophyes chibaensis Kadono, an eriophyid mite often observed on the Japanese pear (Fig. S1G to S1I) (Kadono, 1981), has been associated with occurrences of the chlorotic spots (Shimizu et al. 2019), samples of E. chibaensis individuals were collected from PCLSaV-positive Japanese pear cvs. "Akizuki" and "Kosui"and P. communis cv. "Le Lectier." for total nucleic acid isolations via phenol-chloroform extraction, followed by quantitative RT-PCR (Supplementary Table S1). The expected RNA1 and RNA5 specific 150 bp products were detected from mite samples collected from Akizuki (n = 6/12), Kosui (n = 13/18), and Le Lectier (n = 6/8). The results indicate that E. chibaensis can ingest PCLSaV and may be a potential vector for the virus, although additional experiments are needed to demonstrate its vector competency. To our knowledge, this is the first report of PCLSaV in Japan and the first report of its detection in E. chibaensis.

ICTV Virus Taxonomy Profile: Fimoviridae.

Members of the family Fimoviridae, order Bunyavirales are plant viruses with segmented, linear, single-stranded, negative-sense RNA genomes. They are distantly related to orthotospoviruses and orthobunyaviruses of the families Tospoviridae and Peribunyaviridae, respectively. The family Fimoviridae includes the genus Emaravirus, which comprises several species with European mountain ash ringspot-associated emaravirus as the type species. Fimoviruses are transmitted to plants by eriophyid mite vectors and induce similar characteristic cytopathologies in their host plants, including the presence of double membrane-bound bodies in the cytoplasm of the virus-infected cells. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Fimoviridae, which is available at www.ictv.global/report/fimoviridae.

Identification and characterization of two novel genomic RNA segments RNA5 and RNA6 in rose rosette virus infecting roses.

Rose rosette virus (RRV), a negative-strand RNA virus belonging to the genus Emaravirus, has recently been characterized to be the causal agent of rose rosette disease. Roses showing typical symptoms of RRV collected from a rose nursery in Florida were subjected to reverse transcription-PCR (RT-PCR) assay using primers corresponding to the conserved inverted 13 nucleotide long stretches found at the termini of the RRV genomic RNA segments. RT-PCR analysis yielded two novel genomic RNA segments, RNA5 and RNA6, in addition to the previously identified four RNA segments. The RNA5 is 1650 bp long and encodes for a polypeptide of 465 amino acids (54.3 K), while RNA6 is 1400 bp long and encodes for a polypeptide of 233 amino acids (27.05 K). RACE analysis showed that, both the RNA segments posses at their 5' and 3' termini, stretches of conserved inverted complementary13 nucleotides long sequence with two nucleotide mismatches as previously identified in other genomic RNA segments. Northern blot analysis as well as RT-PCR using specific primers showed the presence of the novel genomic RNA segments in infected plants, but absent in the non-infected plants. The GenBank Acc. Nos. for the sequences reported in this paper are KT007556 and KT007557.

In planta expression of specific single chain fragment antibody (scFv) against nucleocapsid protein of fig mosaic virus (FMV).

Fig mosaic virus (FMV) is recognized as the main viral agent associated with the mosaic disease (MD) of fig trees (Ficus carica). Due to its worldwide occurrence, FMV represents the most significant global threat to the production of fig fruit. A disease management strategy against the MD in fig orchards has never been effective; and therefore, expression of recombinant antibody in plant cells could provide an alternative approach to suppress FMV infections. In this study we focused on expressing a specific recombinant antibody, a single-chain variable fragment (scFv), targeting the nucleocapsid protein (NP) of FMV in planta. To accomplish this objective, we inserted the scFv gene into a plant expression vector and conducted transient expression in leaves of Nicotiana tabacum cv. Samson plants. The construct was transiently expressed in tobacco plants by agroinfiltration, and antibody of the anticipated size was detected by immunoblotting. The produced plantibody was then assessed for specificity using ELISA and confirmed by Western blot analysis. In this study, the plantibody developed against FMV could be considered as a potential countermeasure to the infection by conferring resistance to MD.

Field Resistance to Rose Rosette Disease as Determined by Multi-Year Evaluations in Tennessee and Delaware.

Rose rosette disease (RRD) caused by the rose rosette emaravirus (RRV) and transmitted by the eriophyid mite Phyllocoptes fructiphilus (Pf), both native to North America, has caused significant damage to roses over the last several decades. As cultural and chemical control of this disease is difficult and expensive, a field trial was established to systematically screen rose germplasm for potential sources of resistance. One hundred and eight rose accessions representing the diversity of rose germplasm were planted in Tennessee and Delaware, managed to encourage disease development, and evaluated for symptom development and viral presence for three years. All major commercial rose cultivars were susceptible to this viral disease to varying levels. The rose accessions with no or few symptoms were species accessions from the sections Cinnamomeae, Carolinae, Bracteatae, and Systylae or hybrids with these. Among these, some were asymptomatic; they displayed no symptoms but were infected by the virus. Their potential depends on their ability to serve as a source of viruses. The next step is to understand the mechanism of resistance and genetic control of the various sources of resistance identified.

Genetic Diversity among Rose Rosette Virus Isolates: A Roadmap towards Studies of Gene Function and Pathogenicity.

The phylogenetic relationships of ninety-five rose rosette virus (RRV) isolates with full-length genomic sequences were analyzed. These isolates were recovered mostly from commercial roses that are vegetatively propagated rather than grown from seed. First, the genome segments were concatenated, and the maximum likelihood (ML) tree shows that the branches arrange independent of their geographic origination. There were six major groups of isolates, with 54 isolates in group 6 and distributed in two subgroups. An analysis of nucleotide diversity across the concatenated isolates showed lower genetic differences among RNAs encoding the core proteins required for encapsidation than the latter genome segments. Recombination breakpoints were identified near the junctions of several genome segments, suggesting that the genetic exchange of segments contributes to differences among isolates. The ML analysis of individual RNA segments revealed different relationship patterns among isolates, which supports the notion of genome reassortment. We tracked the branch positions of two newly sequenced isolates to highlight how genome segments relate to segments of other isolates. RNA6 has an interesting pattern of single-nucleotide mutations that appear to influence amino acid changes in the protein products derived from ORF6a and ORF6b. The P6a proteins were typically 61 residues, although three isolates encoded P6a proteins truncated to 29 residues, and four proteins extended 76-94 residues. Homologous P5 and P7 proteins appear to be evolving independently. These results suggest greater diversity among RRV isolates than previously recognized.

Molecular Population Genetics of Aspen Mosaic-Associated Virus in Finland and Sweden.

Aspen mosaic-associated virus (AsMaV) is a newly identified Emaravirus, in the family Fimoviridae, Bunyavirales, associated with mosaic symptoms in aspen trees (Populus tremula). Aspen trees are widely distributed in Europe and understanding the population structure of AsMaV may aid in the development of better management strategies. The virus genome consists of five negative-sense single-stranded RNA (-ssRNA) molecules. To investigate the genetic diversity and population parameters of AsMaV, different regions of the genome were amplified and analyzed and full-length sequence of the divergent isolates were cloned and sequenced. The results show that RNA3 or nucleoprotein is a good representative for studying genetic diversity in AsMaV. Developed RT-PCR-RFLP was able to identify areas with a higher number of haplotypes and could be applied for screening the large number of samples. In general, AsMaV has a conserved genome and based on the phylogenetic studies, geographical structuring was observed in AsMaV isolates from Sweden and Finland, which could be attributed to founder effects. The genome of AsMaV is under purifying selection but not distributed uniformly on genomic RNAs. Distant AsMaV isolates displayed amino acid sequence variations compared to other isolates, and bioinformatic analysis predicted potential post-translational modification sites in some viral proteins.

Rose Rosette Disease Resistance Loci Detected in Two Interconnected Tetraploid Garden Rose Populations.

Rose rosette disease (RRD), caused by the Rose rosette emaravirus (RRV), is a major threat to the garden rose industry in the United States. There has been limited work on the genetics of host plant resistance to RRV. Two interconnected tetraploid garden rose F1 biparental mapping populations were created to develop high-quality tetraploid rose linkage maps that allowed the discovery of RRD resistance quantitative trait loci (QTLs) on linkage groups (LGs) 5, 6, and 7. These QTLs individually accounted for around 18-40% of the phenotypic variance. The locus with the greatest effect on partial resistance was found in LG 5. Most individuals with the LG 5 QTL were in the simplex configuration; however, two individuals were duplex (likely due to double reduction). Identification of resistant individuals and regions of interest can help the development of diagnostic markers for marker-assisted selection in a breeding program.

Identification of QTLs for Reduced Susceptibility to Rose Rosette Disease in Diploid Roses.

Resistance to rose rosette disease (RRD), a fatal disease of roses (Rosa spp.), is a high priority for rose breeding. As RRD resistance is time-consuming to phenotype, the identification of genetic markers for resistance could expedite breeding efforts. However, little is known about the genetics of RRD resistance. Therefore, we performed a quantitative trait locus (QTL) analysis on a set of inter-related diploid rose populations phenotyped for RRD resistance and identified four QTLs. Two QTLs were found in multiple years. The most consistent QTL is qRRV_TX2WSE_ch5, which explains approximately 20% and 40% of the phenotypic variation in virus quantity and severity of RRD symptoms, respectively. The second, a QTL on chromosome 1, qRRD_TX2WSE_ch1, accounts for approximately 16% of the phenotypic variation for severity. Finally, a third QTL on chromosome 3 was identified only in the multiyear analysis, and a fourth on chromosome 6 was identified in data from one year only. In addition, haplotypes associated with significant changes in virus quantity and severity were identified for qRRV_TX2WSE_ch5 and qRRD_TX2WSE_ch1. This research represents the first report of genetic determinants of resistance to RRD. In addition, marker trait associations discovered here will enable better parental selection when breeding for RRD resistance and pave the way for marker-assisted selection for RRD resistance.

Mixed infection of an emaravirus, a crinivirus, and a begomovirus in Pueraria lobata (Willd) Ohwi.

Pueraria lobata (Willd) (Pueraria montana var. lobata (Willd.) Maesen & S. M. Almeida ex Sanjappa & Predeep) is an important herbal medicine used in many countries. In P. lobata plants showing symptoms of mosaic, yellow spots, and mottling, mixed infection of new viruses provisionally named Pueraria lobata-associated emaravirus (PloAEV, genus Emaravirus), Pueraria lobata-associated crinivirus (PloACV, genus Crinivirus), and isolate CQ of the previously reported kudzu mosaic virus (KuMV-CQ, genus Begomovirus) was confirmed through high-throughput sequencing. PloAEV has five RNA segments, encoding a putative RNA-dependent RNA polymerase, glycoprotein precursor, nucleocapsid protein, movement protein, and P5, respectively. PloACV has two RNA segments, encoding 11 putative proteins. Only PloAEV could be mechanically transmitted from mixed infected symptomatic kudzu to Nicotiana benthamiana plants. All three viruses were detected in 35 symptomatic samples collected from five different growing areas, whereas no viruses were detected in 21 non-symptomatic plants, suggesting a high association between these three viruses. Thus, this study provides new knowledge on the diversity and molecular characteristics of viruses in P. lobata plants affected by the viral disease.