Emerald Ash Borer Management and Research: Decades of Damage and Still Expanding.

Since the discovery of the ash tree (Fraxinus spp.) killer emerald ash borer (EAB; Agrilus planipennis) in the United States in 2002 and Moscow, Russia in 2003, substantial detection and management efforts have been applied to contain and monitor its spread and mitigate impacts. Despite these efforts, the pest continues to spread within North America. It has spread to European Russia and Ukraine and is causing sporadic outbreaks in its native range in China. The dynamics of EAB's range expansion events appear to be linked to the lack of resistant ash trees in invaded ranges, facilitated by the abundance of native or planted North American susceptible ash species. We review recently gained knowledge of the range expansion of EAB; its ecological, economic, and social impacts; and past management efforts with their successes and limitations. We also highlight advances in biological control, mechanisms of ash resistance, and new detection and management approaches under development, with the aim of guiding more effective management.

Distinct metabolites affect the phloem fungal communities in ash trees (Fraxinus spp.) native and nonnative to the highly invasive emerald ash borer (AGRILUS PLANIPENNIS).

Emerald ash borer (EAB, Agrilus planipennis) is an invasive killer of ash trees (Fraxinus spp.) in North America and Europe. Ash species co-evolved with EAB in their native range in Asia are mostly resistant, although the precise mechanism(s) remain unclear. Very little is also known about EAB or ash tree microbiomes. We performed the first joint comparison of phloem mycobiome and metabolites between a native and a nonnative ash species, infested and uninfested with EAB, in conjunction with investigation of larval mycobiome. Phloem mycobiome communities differed between the tree species, but both were unaffected by EAB infestation. Several indicator taxa in the larval gut shared a similarly high relative abundance only with the native host trees. Widely targeted metabolomics revealed 24 distinct metabolites in native trees and 53 metabolites in nonnative trees, respectively, that differed in relative content between infested and uninfested trees only in one species. Interestingly, four metabolites shared a strong relationship with the phloem mycobiomes, majority of which affected only the native trees. Collectively, our results demonstrate a complex interplay between host tree chemistry and mycobiome, and suggest the shared relationships between the mycobiomes of the native host tree and EAB may reflect their shared co-evolution.

Seasonal dynamics of cell-to-cell transport in angiosperm wood.

This study describes the seasonal changes in cell-to-cell transport in three selected angiosperm tree species, Acer pseudoplatanus (maple), Fraxinus excelsior (ash), and Populus tremula × tremuloides (poplar), with an emphasis on the living wood component, xylem parenchyma cells (XPCs). We performed anatomical studies, dye loading through the vascular system, measurements of non-structural carbohydrate content, immunocytochemistry, inhibitory assays and quantitative real-time PCR to analyse the transport mechanisms and seasonal variations in wood. The abundance of membrane dye in wood varied seasonally along with seasonally changing tree phenology, cambial activity, and non-structural carbohydrate content. Moreover, dyes internalized in vessel-associated cells and 'trapped' in the endomembrane system are transported farther between other XPCs via plasmodesmata. Finally, various transport mechanisms based on clathrin-mediated and clathrin-independent endocytosis, and membrane transporters, operate in wood, and their involvement is species and/or season dependent. Our study highlights the importance of XPCs in seasonally changing cell-to-cell transport in both ring-porous (ash) and diffuse-porous (maple, poplar) tree species, and demonstrates the involvement of both endocytosis and plasmodesmata in intercellular communication in angiosperm wood.

Seasonal variation of vessel pits in sapwood: microscopical analyses of the morphology and chemical components of pit membrane encrustations in Fraxinus mandshurica.

BACKGROUND AND AIMS: Pit pairs and their filter-like partition, i.e. pit membranes, play important roles as water pathways, barriers and regulators in the water-conducting system of angiosperms. In Fraxinus species, the intervessel and vessel-parenchyma pit membranes in sapwood are normally encrusted during winter. Although these encrustations inevitably influence the performance of pits, their properties and functions remain unclear. This study aimed to reveal the morphological and chemical characteristics of encrustations in F. mandshurica in order to deepen understanding of the seasonal encrustation of pit membranes. METHODS: Seasonal and positional variations in the presence and morphology of encrustations were examined by field-emission scanning electron microscopy (FE-SEM). Cryo-FE-SEM for freeze-fixed greenwood samples was conducted to clarify whether encrustations were present in living trees. Chemical components were examined by histochemical staining using light and electron microscopies, immunofluorescence labelling and ultraviolet microspectroscopy. KEY RESULTS: Encrustations began to deposit in fall before leaf senescence and disappeared in spring before bud flushing. They infiltrated within the pit membranes, which suggested that they severely limit the permeation of pits. The encrustations differed in morphology among positions: they entirely filled the pit chambers in latewood, while they covered the pit membranes in earlywood. The encrustations were similarly observed in the samples that were freeze-fixed immediately after collection, indicating that they are present in living trees. The encrustations contained polysaccharides, including xyloglucan and homogalacturonan, and phenolic compounds, possibly including flavonoids and coumarins. These chemical components were also detected in droplets found in the latewood vessels with the encrustations, suggesting that the materials constituting encrustations were supplied through the vessel lumens. CONCLUSIONS: Encrustations undoubtedly cover the pit membranes in living F. mandshurica trees in winter and their morphology and chemical composition indicate that they are impermeable, have positional differences in function and are characterised by elaborate deposition/removal processes.

Integrative analysis of green ash phloem transcripts and proteins during an emerald ash borer infestation.

BACKGROUND: Emerald ash borer (Agrilus planipennis; EAB) is an Asian insect species that has been invasive to North America for 20 years. During this time, the emerald ash borer has killed tens of millions of American ash (Fraxinus spp) trees. Understanding the inherent defenses of susceptible American ash trees will provide information to breed new resistant varieties of ash trees. RESULTS: We have performed RNA-seq on naturally infested green ash (F. pennsylvanica) trees at low, medium and high levels of increasing EAB infestation and proteomics on low and high levels of EAB infestation. Most significant transcript changes we detected occurred between the comparison of medium and high levels of EAB infestation, indicating that the tree is not responding to EAB until it is highly infested. Our integrative analysis of the RNA-Seq and proteomics data identified 14 proteins and 4 transcripts that contribute most to the difference between highly infested and low infested trees. CONCLUSIONS: The putative functions of these transcripts and proteins suggests roles of phenylpropanoid biosynthesis and oxidation, chitinase activity, pectinesterase activity, strigolactone signaling, and protein turnover.

A glimmer of hope - ash genotypes with increased resistance to ash dieback pathogen show cross-resistance to emerald ash borer.

Plants rely on cross-resistance traits to defend against multiple, phylogenetically distinct enemies. These traits are often the result of long co-evolutionary histories. Biological invasions can force naïve plants to cope with novel, coincident pests, and pathogens. For example, European ash (Fraxinus excelsior) is substantially threatened by the emerald ash borer (EAB), Agrilus planipennis, a wood-boring beetle, and the ash dieback (ADB) pathogen, Hymenoscyphus fraxineus. Yet, plant cross-resistance traits against novel enemies are poorly explored and it is unknown whether naïve ash trees can defend against novel enemy complexes via cross-resistance mechanisms. To gain mechanistic insights, we quantified EAB performance on grafted replicates of ash genotypes varying in ADB resistance and characterized ash phloem chemistry with targeted and untargeted metabolomics. Emerald ash borer performed better on ADB-susceptible than on ADB-resistant genotypes. Moreover, changes in EAB performance aligned with differences in phloem chemical profiles between ADB-susceptible and ADB-resistant genotypes. We show that intraspecific variation in phloem chemistry in European ash can confer increased cross-resistance to invasive antagonists from different taxonomic kingdoms. Our study suggests that promotion of ADB-resistant ash genotypes may simultaneously help to control the ADB disease and reduce EAB-caused ash losses, which may be critical for the long-term stability of this keystone tree species.

Antioxidant and Pulmonary Protective Potential of Fraxinus xanthoxyloides Bark Extract against CCl4 -Induced Toxicity in Rats.

Fraxinus xanthoxyloides is a perennial shrub belonging to family Oleaceae, traditionally used for malaria, jaundice, pneumonia, inflammation, and rheumatism. Our study is aimed to assess the total phenolics (TPC), flavonoids (TFC), terpenoids contents (TTC) and antioxidant profiling of F. xanthoxyloides methanol bark extract (FXBM) and its fractions, hexane, chloroform, ethyl acetate and aqueous, along with high-performance liquid chromatography with diode-array detection (HPLC-DAD). Further, the antioxidant and pulmonary protective potential was explored against carbon tetrachloride (CCl4 )-induced CCl4-induced pulmonary tissue damage in rats. The highest TPC, TFC and TTC were found in FXBM (133.29±4.19 mg/g), ethyl acetate fraction (279.55±10.35 mg/g), and chloroform fraction (0.79±0.06 mg/g), respectively. The most potent antioxidant capacity was depicted by FXBM (29.21±2.40 µg/mg) and ethyl acetate fraction (91.16±5.51 µg/mg). The HPLC-DAD analysis revealed the predominance of gallic, chlorogenic, vanillic and ferulic acid in FXBM. The administration of CCl4 induced oxidative stress, suppressed antioxidant enzymes' activities including catalase, peroxidase, superoxide dismutase, glutathione peroxidase, glutathione-S-transferase, and glutathione reductase. Further, it increased thiobarbituric acid reactive substances (TBARS) and H2 O2 levels, induced DNA injuries and reduced the total protein and glutathione content in lung tissues. The treatment of rats with FXBM restored these biochemical parameters to the normal level. Moreover, the histopathological studies of lung tissues demonstrated that FXBM protected rats' lung tissues from oxidative damage restoring normal lung functions. Thus, F. xanthoxyloides bark extract is recommended as adjuvant therapy as protective agent for patients with lung disorders.

First report of leaf spot caused by Curvularia muehlenbeckiae on Fraxinus rhynchophylla Hance in China.

Fraxinus rhynchophylla Hance, is a deciduous trees cultivated on a commercial scale focused on medicinal and wood production. In September 2021, leaf spot was observed on F. rhynchophylla in Heilongjiang Province (127.34°E, 45.19°N), China. These symptoms were observed on 100% F. rhynchophylla plants and the incidence of diseased leaves per plant reached 70% in fields measuring 90 ha. Disease symptoms were small yellow flecks initially, and then turned to gray necrotic spot. Ten diseased leaves were collected randomly from 5 plants and surface disinfested. Tissue samples (2 × 2 mm) were cut at the disease-health junction of the leaves, surface sterilized in 75% ethanol for 30 s, submerged in a 7% NaOCl solution for 3 mins, and rinsed three times with sterile water. Leaf segments were placed onto potato dextrose agar (PDA) and incubated at 26℃ for 5 days. After isolation and purification of monospore, the colonies of the all isolates were inky black, with aerial fluffy mycelium, and concentric whorls on PDA. The conidiophore is septate, single-branched, brown, smooth and 35 - 313 × 2 - 5 µm in size (n = 50), while the conidia are brown, bow-shaped, mostly four cells, with three septa and 12 - 385 × 5 - 20 µm in size (n = 150). The morphological characters matched those of Curvularia muehlenbeckiae (Madrid et al. 2014). DNA was extracted from isolates HQLa and HQLb and used for PCR amplification of RNA polymerase II gene (RPB2) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene sequences using the primer fRPB2-SF/fRPB2-7Cr (Schoch et al. 2009), gpd1/gpd2 (Berbee et al. 1999), respectively. The RPB2 (OM984674, OM984675) and GAPDH (OM984672, OM984673) were deposited in GenBank. The phylogenetic tree was constructed by combining other published sequences of RPB2 and GAPDH genes using the maximum likelihood method, and the results showed that the obtained isolates clustered into the same clear branch as C. muehlenbeckiae CBS 144.63 (HG779180, HG779108), with 100% bootstrap support. Combining morphological characteristics and phylogenetic analysis of the fungus, the obtained isolates were identified as C. Muehlenbeckiae. To fulfill the Koch's postulates, pathogenicity tests were carried out on newly grown leaves of F. rhynchophylla. Conidia of the selected isolates grown on PDA plates were flooded with sterile distilled water. Spore suspension was adjusted to 105 spores/mL with the hemocytometer. Three leaves of each plant were disinfected with 1% NaOCl for 2 min, washed with sterilized distilled water three times, and dried with sterile paper towels. Three plants were randomly selected for inoculation under field conditions and each leaf was sprayed with 2 mL of the spore suspension for a total of nine leaves, then the plants were bagged and moistened for 48 h. However, control leaves were sprayed with distilled water. Symptoms were observed nine days after inoculation. No symptoms were observed on control leaves. The same fungus was successfully re-isolated from the lesions. The experiment was replicated three times with the same results and C. muehlenbeckiae identification was confirmed by morphological observations and RPB2 and GAPDH sequencing, indicating that the fungus is the causal pathogen of leaf spot disease on F. rhynchophylla. This is the first report of C. muehlenbeckiae determined as fungal pathogens on F. rhynchophylla plant in China. The results of the study laid the foundation for the future occurrence and epidemiological pattern of the disease and scientific control.

The Related Mechanisms Predicted through Network-Based Pharmacological Analysis and the Anti-Inflammatory Effects of Fraxinus rhynchophylla Hance Bark on Contact Dermatitis in Mice.

Fraxinus rhynchophylla Hance bark has been used to treat patients with inflammatory or purulent skin diseases in China, Japan, and Korea. This study was undertaken to determine the mechanism responsible for the effects of F. rhynchophylla and whether it has a therapeutic effect in mice with contact dermatitis (CD). In this study, the active compounds in F. rhynchophylla, their targets, and target gene information for inflammatory dermatosis were investigated using network-based pharmacological analysis. Docking analysis was conducted using AutoDock Vina. In addition, the therapeutic effect of an ethanolic extract of F. rhynchophylla (EEFR) on skin lesions and its inhibitory effects on histopathological abnormalities, inflammatory cytokines, and chemokines were evaluated. Finally, its inhibitory effects on the nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signalling pathways were observed in RAW 264.7 cells. In our results, seven active compounds were identified in F. rhynchophylla, and six were associated with seven genes associated with inflammatory dermatosis and exhibited a strong binding affinity (<-6 kcal/mol) to prostaglandin G/H synthase 2 (PTGS2). In a murine 1-fluoro-2,4-dinitrobenzene (DNFB) model, topical EEFR ameliorated the surface symptoms of CD and histopathological abnormalities. EEFR also reduced the levels of tumour necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-6, and monocyte chemotactic protein (MCP)-1 in inflamed tissues and inhibited PTGS2, the nuclear translocation of NF-κB (p65), and the activation of c-Jun N-terminal kinases (JNK) in RAW 264.7 cells. In conclusion, the bark of F. rhynchophylla has potential use as a therapeutic or cosmetic agent, and the mechanism responsible for its effects involves the suppression of inflammatory mediators, nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor (IκB)-α degradation, the nuclear translocation of NF-κB, and JNK phosphorylation.

Bio-Guided Isolation of Compounds from Fraxinus excelsior Leaves with Anti-Inflammatory Activity.

Inflammation is the first physiological defence mechanism against external and internal stimuli. The prolonged or inappropriate response of the immune system may lead to the persistent inflammatory response that can potentially become a basis for chronic diseases e.g., asthma, type II diabetes or cancer. An important role in the alleviation of inflammatory processes, as an adjunct to traditional pharmacological therapy, is attributed to phytotherapy, especially to raw materials with a long tradition of use, e.g., ash leaves. Despite their long-term use in phytotherapy, the specific mechanisms of action have not been confirmed in a sufficient number of biological or clinical studies. The aim of the study is a detailed phytochemical analysis of infusion and its fractions, isolation of pure compounds from the leaves of Fraxinus excelsior and evaluation of their effect on the secretion of anti-inflammatory cytokines (TNF-α, IL-6) and IL-10 receptor expression in an in vitro model of monocyte/macrophage cells isolated from peripheral blood. Methods: Phytochemical analysis was carried out by the UHPLC-DAD-ESI-MS/MS method. Monocytes/macrophages were isolated from human peripheral blood using density gradient centrifugation on Pancoll. After 24 h incubation with tested fractions/subfractions and pure compounds, cells or their supernatants were studied, respectively, on IL-10 receptor expression by flow cytometry and IL-6, TNF-α, IL-1ß secretion by the ELISA test. Results were presented with respect to Lipopolysaccharide (LPS) control and positive control with dexamethasone. Results: The infusion, 20% and 50% methanolic fractions and their subfractions, as well as their dominating compounds, e.g., ligstroside, formoside and oleoacteoside isolated from the leaves, show the ability to increase the IL-10 receptor expression on the surface of monocyte/macrophage cells, stimulated by LPS, and to decrease the secretion of pro-inflammatory cytokines, e.g., TNF-α, IL-6.

Genome-wide analysis and molecular dissection of the SPL gene family in Fraxinus mandshurica.

BACKGROUND: SQUAMOSA promoter binding protein-like (SPL) is a unique family of transcription factors in plants, which is engaged in regulating plant growth and development, physiological and biochemical processes. Fraxinus mandshurica is an excellent timber species with a wide range of uses in northeastern China and enjoys a high reputation in the international market. SPL family analysis has been reported in some plants while SPL family analysis of Fraxinus mandshurica has not been reported. RESULTS: We used phylogeny, conserved motifs, gene structure, secondary structure prediction, miR156 binding sites, promoter cis elements and GO annotation to systematically analyze the FmSPLs family. This was followed by expression analysis by subcellular localization, expression patterns at various tissue sites, abiotic stress and hormone induction. Because FmSPL2 is highly expressed in flowers it was selected to describe the SPL gene family of Fraxinus mandshurica by ectopic expression. Among them, 10 FmSPL genes that were highly expressed at different loci were selected for expression analysis under abiotic stress (NaCl and Cold) and hormone induction (IAA and ABA). These 10 FmSPL genes showed corresponding trends in response to both abiotic stress and hormone induction. We showed that overexpression of FmSPL2 in transgenic Nicotiana tabacum L. resulted in taller plants, shorter root length, increased root number, rounded leaves, and earlier flowering time. CONCLUSIONS: We identified 36 SPL genes, which were classified into seven subfamilies based on sequence analysis. FmSPL2 was selected for subsequent heterologous expression by analysis of expression patterns in various tissues and under abiotic stress and hormone induction, and significant phenotypic changes were observed in the transgenic Nicotiana tabacum L. These results provide insight into the evolutionary origin and biological significance of plant SPL. The aim of this study was to lay the foundation for the genetic improvement of Fraxinus mandshurica and the subsequent functional analysis of FmSPL2.

Potential impacts of emerald ash borer and adaptation strategies on wildlife communities in black ash wetlands.

Black ash wetlands cover approximately 1.2 million ha of wetland forest in the western Great Lakes region, providing critical habitat for wildlife. The future of these wetlands is critically threatened by a variety of factors, including emerald ash borer (Agrilus planipennis; emerald ash borer [EAB]), which has been eliminating native populations of otherwise healthy ash throughout the Great Lakes region since it was discovered in 2002. To quantify the potential impacts of tree mortality from EAB on wildlife communities, we measured seasonal bird, mammal, and amphibian diversity in black ash wetlands using a dual approach: (1) documenting bird and amphibian species across 27 mature reference black ash wetlands in northern Minnesota, USA and (2) assessing how bird, mammal, and amphibian communities respond to experimental manipulations of black ash forests that emulate mortality and management strategies related to the potential impact of EAB. In total, 85 wildlife species were recorded for the entire study including 57 bird species, 5 amphibian species, and 23 mammal species. Results from the reference sites show that hydrologic regime, percentage of ash canopy cover, and understory cover were important habitat characteristics for bird and amphibian communities. Results from the experimental sites show there may be short-term increases in species richness for mammal and bird communities associated with changes in forest structure due to ash mortality; however, anticipated changes resulting from EAB-caused mortality, particularly the conversion of these sites to non-forested wetlands, will lead to significant shifts in bird and mammal community composition. Loss of ash may cause declines in forest-dependent species and increases in open-canopy and wetland-associated species. Additionally, whereas increased ponding extent and longer hydroperiods may be beneficial for some amphibian species, the loss of the forest canopy will result in an overall decrease in bird diversity and reduce forest connectivity for all species. Our results indicate the potential for significant large-scale impacts of black ash mortality on forest-associated wildlife. Management strategies that focus on establishing alternative trees species to maintain long-term forest cover and structural complexity in these wetlands will help to maintain and conserve wildlife diversity.

Emerald ash borer intensifies harvest regimes on private land.

Invasive forest insects have significant direct impacts on forest ecosystems and they are also generating new risks, uncertainties, and opportunities for forest landowners. The growing prevalence and inexorable spread of invasive insects across the United States, combined with the fact that the majority of the nation's forests are controlled by thousands of autonomous private landowners, raises an important question: To what extent will private landowners alter their harvest practices in response to insect invasions? Using a quasi-experimental design, we conducted a causal analysis to investigate the influence of the highly impactful emerald ash borer (EAB) on (1) annual probability of harvest; (2) intensity of harvest; and (3) diameter of harvested trees, for both ash and non-ash species on private land throughout the Midwest and mid-Atlantic regions of the United States. We found that EAB detection had a negative impact on annual harvest probability and a positive impact on harvest intensity, resulting in a net increase in harvested biomass. Furthermore, our estimates suggest that EAB detection will influence private landowners to harvest greater quantities of ash, relative to non-ash species. We also found that harvested trees in EAB-infested areas had smaller diameters, on average, compared with those unaffected by EAB. These results can help policymakers, forest managers, and extension programs to anticipate and better advise landowners and managers about their options and the associated outcomes for forests.

Heterologous expression of a Fraxinus velutina SnRK2 gene in Arabidopsis increases salt tolerance by modifying root development and ion homeostasis.

KEY MESSAGE: FvSnRK2182 is involved in regulating the growth and stress response. SnRK2 family members are positive regulators of downstream signals in the abscisic acid (ABA) signaling pathway, playing key roles in the plant responses to abiotic stresses. Fraxinus velutina Torr. is a candidate phytoremediator of saline-alkali areas, and is a valuable research subject because of its adaptability in saline soil. We identified a SnRK2 gene in F. velutina (named FvSnRK2182), which was significantly upregulated under salt stress. A bioinformatics analysis showed that FvSnRK2182 has a Ser/Thr kinase domain typical of the SnRK2 subfamily. Compared with wild-type (WT) Arabidopsis, its heterologous expression in Arabidopsis resulted in higher auxin content during seed germination and seedling growth, leading to longer primary roots and more lateral roots. The transgenic lines were better able to tolerate treatments with NaCl (100 mM) and/or ABA (0.2 and 0.5 µM), producing a greater biomass than the WT plants. Under NaCl treatment, the shoots of the transgenic lines had lower Na+ contents and higher K+ contents than the WT plants, and the genes encoding the ion transport-related proteins SOS1, HKT1, NHX1, and AKT1 were significantly upregulated. In addition, the expression of the genes functioning downstream of SnRK2 in the ABA signaling pathway (Rboh, AREB4, ABF2, and ABF3) were significantly upregulated in transgenic lines under NaCl stress. These results showed that expressing FvSnRK2182 in Arabidopsis significantly increased their resistance to ABA and salt stress by regulating root development and maintaining ion homeostasis, which suggests that FvSnRK2182 may be involved in regulating the growth and stress response of F. velutina.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

Effect of an herbal formulation containing Peganum harmala L. and Fraxinus excelsior L. on oxidative stress, memory impairment and withdrawal syndrome induced by morphine.

Background: Traditional Persian medicine has introduced effective remedies in opioid dependence care. One of the most widely used remedies is an herbal formulation containing Peganum harmala L. and Fraxinus excelsior L. (HF). This study investigated the effects of HF to attenuate the withdrawal signs and rewarding effects in morphine-dependent rats.Methods: Forty-nine male Wistar rats were randomly divided into seven groups. The control and vehicle groups received normal saline and sodium carboxymethyl cellulose, respectively. The morphine group received morphine for one week. The single and daily dose of HF groups received morphine similar to the morphine group, and HF (1.4 and 2.8 g/kg) once a day in the daily dose group and only on the last day of the experiment in the single dose of HF group. Finally, the withdrawal signs as well biochemical tests were evaluated. The behavioral parameters were assessed by conditioned place preference (CPP), elevated plus-maze and Y-maze tests. The antioxidant activity of HF was evaluated by measurement of serum contents of malondialdehyde, stable nitric oxide metabolites and total antioxidant capacity (TAC). Moreover, the protein expression of c-fos was assessed by western blotting.Results: Daily treatment with HF significantly reduced the score of CPP behavioral test, all of the withdrawal signs, TAC and the c-fos protein level.Conclusions: The results indicated that HF might be a promising complementary treatment in reducing morphine-induced physical and psychological dependence probably through modulation of c-fos protein expression.

Effects of Ascorbic Acid on Physiological Characteristics during Somatic Embryogenesis of Fraxinus mandshurica.

Fraxinus mandshurica is one of the precious tree species in northeast China and has important economic and ecological value. Ascorbic acid (ASA) is a strong antioxidant that can significantly improve plant photosynthetic efficiency and stress resistance and participate widely in plant growth and development. In this study, we investigated the development process of mature zygotic embryos of F. mandshurica under different concentrations of ASA and found that 100 mg·L-1 exogenous ASA was the optimal concentration and that the induction rate of somatic embryos (SEs) was the highest at 72.89%, which was 7.13 times higher than that of the control group. The polyphenol content, peroxidase (POD) activity, nitric oxide (NO) content, nitrate reductase (NR) activity, total ascorbic acid (T-ASA) content, ASA content, ASA/Dehydroascorbic acid (DHA) ratio, GSH/GSSG ratio, and ascorbate peroxidase (APX) activity were significantly increased under the application of exogenous ASA in explants, whereas the polyphenol oxidase (PPO) activity, phenylalanine ammonia-lyase (PAL) activity, superoxide dismutase (SOD) activity, and catalase (CAT) activity, malondialdehyde (MDA) content and nitric oxide synthase (NOS) activity were decreased. At the same time, the content of T-ASA and ASA, T-GSH and GSSG, and PAL and SOD had the same change pattern in the control group and the treatment group. These results suggested that high or low concentrations of ASA could not promote the somatic embryogenesis of F. mandshurica and that exogenous ASA had significant effects on the physiology of F. mandshurica explants. ASA was also highly related to somatic embryogenesis and the explant browning of F. mandshurica. Our results could provide a reference for further study on the browning mechanism of F. mandshurica explants and lay the foundation for optimizing the condition of somatic embryogenesis in F. mandshurica.

Application of somatic embryogenesis for development of emerald ash borer-resistant white ash and green ash varietals.

Emerald ash borer (Agrilus planipennis; EAB) has devastated populations of ash (Fraxinus spp.) trees in dozens of U.S. states and Canada over the past few decades. The continued survival of scattered ash trees known as "lingering ash" in heavily infested natural stands, however, offers evidence of genetic resistance or tolerance to EAB. These surviving or "lingering" ash individuals may form the basis for reforestation programs in EAB-impacted areas, and clonal mass-propagation of these genotypes can help accelerate these efforts. Between 2013 and 2018, we initiated embryogenic cultures by culturing immature zygotic embryos from open-pollinated (OP) seeds collected from several surviving white ash and green ash trees in Michigan and Pennsylvania. In addition, in 2018, we initiated cultures from crosses made between lingering green ash parents from the USDA Forest Service ash breeding program in Ohio. Somatic embryos were produced by growing cultures in liquid suspension, followed by fractionation and plating on semisolid medium to produce developmentally synchronous populations of somatic embryos. Somatic embryo germination and conversion were enhanced by a combination of pre-germination cold treatment and inclusion of activated charcoal and gibberellic acid in the germination medium. Ash somatic seedlings derived from OP explants grew rapidly following transfer to potting mix and somatic seedlings representing nine ash clones were acclimatized, grown in the greenhouse and planted in a preliminary field test, along with EAB-resistant Manchurian ash (F. mandshurica) and EAB-susceptible control seedlings. Somatic seedlings have now been produced from cultures that originated from seeds derived from the progeny of lingering green ash parents and an ex vitro germination protocol has shown some promise for accelerating early somatic seedling growth. Results of this research could provide the basis for scaled-up production of EAB-resistant ash varieties for seed orchard production for forest restoration and cultivar development for urban tree restoration.

Comparative analyses of the Hymenoscyphus fraxineus and Hymenoscyphus albidus genomes reveals potentially adaptive differences in secondary metabolite and transposable element repertoires.

BACKGROUND: The dieback epidemic decimating common ash (Fraxinus excelsior) in Europe is caused by the invasive fungus Hymenoscyphus fraxineus. In this study we analyzed the genomes of H. fraxineus and H. albidus, its native but, now essentially displaced, non-pathogenic sister species, and compared them with several other members of Helotiales. The focus of the analyses was to identify signals in the genome that may explain the rapid establishment of H. fraxineus and displacement of H. albidus. RESULTS: The genomes of H. fraxineus and H. albidus showed a high level of synteny and identity. The assembly of H. fraxineus is 13 Mb longer than that of H. albidus', most of this difference can be attributed to higher dispersed repeat content (i.e. transposable elements [TEs]) in H. fraxineus. In general, TE families in H. fraxineus showed more signals of repeat-induced point mutations (RIP) than in H. albidus, especially in Long-terminal repeat (LTR)/Copia and LTR/Gypsy elements. Comparing gene family expansions and 1:1 orthologs, relatively few genes show signs of positive selection between species. However, several of those did appeared to be associated with secondary metabolite genes families, including gene families containing two of the genes in the H. fraxineus-specific, hymenosetin biosynthetic gene cluster (BGC). CONCLUSION: The genomes of H. fraxineus and H. albidus show a high degree of synteny, and are rich in both TEs and BGCs, but the genomic signatures also indicated that H. albidus may be less well equipped to adapt and maintain its ecological niche in a rapidly changing environment.

Forest above-ground volume assessments with terrestrial laser scanning: a ground-truth validation experiment in temperate, managed forests.

BACKGROUND AND AIMS: Quantifying the Earth's forest above-ground biomass (AGB) is indispensable for effective climate action and developing forest policy. Yet, current allometric scaling models (ASMs) to estimate AGB suffer several drawbacks related to model selection and uncertainties about calibration data traceability. Terrestrial laser scanning (TLS) offers a promising non-destructive alternative. Tree volume is reconstructed from TLS point clouds with quantitative structure models (QSMs) and converted to AGB with wood basic density. Earlier studies have found overall TLS-derived forest volume estimates to be accurate, but highlighted problems for reconstructing finer branches. Our objective was to evaluate TLS for estimating tree volumes by comparison with reference volumes and volumes from ASMs. METHODS: We quantified the woody volume of 65 trees in Belgium (from 77 to 2800 L; Pinus sylvestris, Fagus sylvatica, Larix decidua, and Fraxinus excelsior) with QSMs and destructive reference measurements. We tested a volume expansion factor (VEF) approach by multiplying the solid and merchantable volume from QSMs by literature VEF values. KEY RESULTS: Stem volume was reliably estimated with TLS. Total volume was overestimated by +21 % using original QSMs, by +9 % and -12 % using two sets of VEF-augmented QSMs, and by -7.3 % using best-available ASMs. The most accurate method differed per site, and the prediction errors for each method varied considerably between sites. CONCLUSIONS: VEF-augmented QSMs were only slightly better than original QSMs for estimating tree volume for common species in temperate forests. Despite satisfying estimates with ASMs, the model choice was a large source of uncertainty, and species-specific models did not always exist. Therefore, we advocate for further improving tree volume reconstructions with QSMs, especially for fine branches, instead of collecting more ground-truth data to calibrate VEF and allometric models. Promising developments such as improved co-registration and smarter filtering approaches are ongoing to further constrain volumetric errors in TLS-derived estimates.