Single nucleotide polymorphism SNP19140160 A > C is a potential breeding locus for fast-growth largemouth bass (Micropterus salmoides).

BACKGROUND: Largemouth bass (Micropterus salmoides) has significant economic value as a high-yielding fish species in China's freshwater aquaculture industry. Determining the major genes related to growth traits and identifying molecular markers associated with these traits serve as the foundation for breeding strategies involving gene pyramiding. In this study, we screened restriction-site associated DNA sequencing (RAD-seq) data to identify single nucleotide polymorphism (SNP) loci potentially associated with extreme growth differences between fast-growth and slow-growth groups in the F1 generation of a largemouth bass population. RESULTS: We subsequently identified associations between these loci and specific candidate genes related to four key growth traits (body weight, body length, body height, and body thickness) based on SNP genotyping. In total, 4,196,486 high-quality SNPs were distributed across 23 chromosomes. Using a population-specific genotype frequency threshold of 0.7, we identified 30 potential SNPs associated with growth traits. Among the 30 SNPs, SNP19140160, SNP9639603, SNP9639605, and SNP23355498 showed significant associations; three of them (SNP9639603, SNP9639605, and SNP23355498) were significantly associated with one trait, body length, in the F1 generation, and one (SNP19140160) was significantly linked with four traits (body weight, height, length, and thickness) in the F1 generation. The markers SNP19140160 and SNP23355498 were located near two growth candidate genes, fam174b and ppip5k1b, respectively, and these candidate genes were closely linked with growth, development, and feeding. The average body weight of the group with four dominant genotypes at these SNP loci in the F1 generation population (703.86 g) was 19.63% higher than that of the group without dominant genotypes at these loci (588.36 g). CONCLUSIONS: Thus, these four markers could be used to construct a population with dominant genotypes at loci related to fast growth. These findings demonstrate how markers can be used to identify genes related to fast growth, and will be useful for molecular marker-assisted selection in the breeding of high-quality largemouth bass.

Single nucleotide polymorphisms in the MRFs gene family associated with growth in Nile tilapia.

BACKGROUND: Muscle occupies most of the fish body, promoting the proliferation of fish muscle fibers can facilitate rapid growth and increase the body weight of fish. Some studiesSeveral previous suggest that Myogenic regulatory factors (MRFs) play an important role in the growth of fish. OBJECTIVE: To investigate the association between the polymorphism of MRFs gene family and growth traits in Nile tilapia (Oreochromis niloticus), get more molecular markers for growth. METHODS: Amplified the Nile tilapia MRFs family gene, including Myogenic determination 1 (Myod1), Myogenic determination 2 (Myod2), Myogenin (Myog), Myogenic factor 5 (Myf5), and Myogenic factor 6 (Myf6), single nucleotide polymorphism (SNP) were screened by Sanger sequencing. RESULTS: A total of 16 SNP loci were screened, including six for Myf5, six for Myf6, one for Myog, one for Myod1 and two for Myod2. The growth traits were analyzed in relation to these 16 SNP loci, and the results indicated significant associations between all 16 SNP loci and the growth traits (P < 0.05). The linkage disequilibrium analysis revealed that D1 and D2 diplotypes of Myf5 gene, E1, E2, E3 and E4 of Myf6 gene, and F1 diplotype of Myod2 gene were significantly associated with superior growth traits. CONCLUSION: There were 6, 6, 1, 1 and 2 growth-related molecular markers in Myf5, Myf6, Myog, Myod1 and Myod2 genes, respectively, which could be applied to the breeding of Nile tilapia.

Genome-wide association study of growth traits and validation of key mutations (MSTN c.C861T) associated with the muscle mass of meat pigeons.

Selective breeding of meat pigeons is primarily based on growth traits, especially muscle mass (MM). Identification of functional genes and molecular markers of growth and slaughter traits through a genome-wide association study (GWAS) will help to elucidate the underlying molecular mechanisms and provide a theoretical basis for the selective breeding of meat pigeons. The phenotypic data of body weight (BW) and body size (BS) of 556 meat pigeons at 52 and 80 weeks of age were collected. In total, 160 434 high-quality single nucleotide polymorphism sites were obtained by restriction site-associated DNA sequencing. The GWAS analysis revealed that MSTN, IGF2BP3 and NCAPG/LCORL were important candidate genes affecting the growth traits of meat pigeons. IGF2BP3 and NCAPG/LCORL were highly correlated to BW and BS, which are related to overall growth and development, while MSTN was associated with pectoral thickness and BW. Phenotypic association validation with the use of two meat pigeon populations found that the MSTN mutation c.C861T determines the MM. These results provide new insights into the genetic mechanisms underlying phenotypic variations of growth traits and MM in commercial meat pigeons. The identified markers and genes provide a theoretical basis for the selective breeding of meat pigeons.

Association analysis of the sorting nexin 29 (SNX29) gene copy number variations with growth traits in Diannan small-ear (DSE) pigs.

SNX29 is a potential functional gene associated with meat production traits. Previous studies have shown that SNX29 copy number variation (CNV) could be implicated with phenotype in goats. However, in Diannan small-ear (DSE) pigs, the genetic impact of SNX29 CNV on growth traits remains unclear. Therefore, this study investigated the associations between SNX29 CNVs (CNV10810 and CNV10811) and growth traits in 415 DSE pigs. The results revealed that the CNV10810 mutation was significantly associated with backfat thickness in DSE pigs at 12 and 15 months old (P < 0.05), while the CNV10811 mutation had significant effects on various growth traits at 6 and 12 months old, particularly for body weight, body height, back height and backfat thickness (P < 0.05 or P < 0.001). In conclusion, our results confirm that SNX29 CNV plays a role in regulating growth and development in pigs, thus suggesting its potential application for pig breeding programmes.

Resequencing of global Lotus corniculatus accessions reveals population distribution and genetic loci, associated with cyanogenic glycosides accumulation and growth traits.

BACKGROUND: Lotus corniculatus is a widely distributed perennial legume whose great adaptability to different environments and resistance to barrenness make it an excellent forage and ecological restoration plant. However, its molecular genetics and genomic relationships among populations are yet to be uncovered. RESULT: Here we report on a genomic variation map from worldwide 272 L. corniculatus accessions by genome resequencing. Our analysis suggests that L. corniculatus accessions have high genetic diversity and could be further divided into three subgroups, with the genetic diversity centers were located in Transcaucasia. Several candidate genes and SNP site associated with CNglcs content and growth traits were identified by genome-wide associated study (GWAS). A non-synonymous in LjMTR was responsible for the decreased expression of CNglcs synthesis genes and LjZCD was verified to positively regulate CNglcs synthesis gene CYP79D3. The LjZCB and an SNP in LjZCA promoter were confirmed to be involved in plant growth. CONCLUSION: This study provided a large number of genomic resources and described genetic relationship and population structure among different accessions. Moreover, we attempt to provide insights into the molecular studies and breeding of CNglcs and growth traits in L. corniculatus.

Transcriptome analysis revealed the existence of family-specific regulation of growth traits in grass carp.

The grass carp (Ctenopharyngodon idella) is the world's most prolific freshwater fish. Little is known, however, about the functional genes and genetic regulatory networks that govern its growth traits. We created three grass carp families in this study by using two grass carp parents with fast-growing offspring and two grass carp parents with slow-growing offspring, namely the fast-growing × fast-growing family (FF), the slow-growing × slow-growing family (SS), and the fast-growing × slow-growing family (FS). Under the satiation and starvation feeding modes, the average body weight of these families' offspring exhibited a consistent ordering (FF > FS > SS). The transcriptomes of grass carp whole brain and hepatopancreas were then acquired for each family, and it was discovered that the number of differentially expressed genes (DEGs) in the different organs demonstrated family specificity. DEGs were mostly identified in the hepatopancreas of FF and the whole brain of SS, but they were more evenly distributed in FS. There were 14 DEGs that were found in all three families, including three that were negatively correlated in hepatopancreas (ahsg2, lect2) or in brain (drd5), and 11 that were positively connected in hepatopancreas (sycn, pabpc4, zgc:112294, cel, endou, ela2, prss3, zbtb41, ela3) or in brain (fabp7, endod1). The deletion of ahsg2 boosted the growth rate only in certain zebrafish, suggesting that the growth-promoting effects of ahsg2 varies among individuals. Furthermore, we examined the SNP in each family and conducted preliminary research on the probable genetic pathways of family-specific control of growth traits. The family specificity of the growth regulation mechanism of grass carp at the transcriptional level was revealed for the first time in this study, and it was discovered that growth differences among individuals in the FF family were primarily due to differences in nutrient metabolism, whereas growth differences among individuals in the SS family may be primarily due to differences in foraging ability caused by differences in brain development. This research adds to our understanding of the genetic regulatory mechanism of grass carp growth.

Bayesian estimates of genetic parameters for growth traits in Harnali sheep.

The objective of the study was to estimate genetic parameters of the growth traits under Bayesian inference in Harnali sheep. The information of pedigree and targeted traits of 2404 Harnali animals born to 159 sires and 695 dams was collected for the period from 1998 to 2021. The growth traits included weight at birth (BWT), 3 (WWT), 6 (6WT) and 12 (YWT) months of age. The genetic evaluation was carried out using six univariate animal models comprising direct and maternal effects using THRGIBBS1F90 and POSTGIBBSF90 programs. The fixed factors adjusted in the analysis were period of birth, sex of lamb and dam's weight at lambing. Bayesian estimates of direct heritability under best model for BWT, WWT, 6WT and YWT traits were 0.16 ± 0.04, 0.10 ± 0.04, 0.18 ± 0.04, and 0.05 ± 0.03, respectively. The significant maternal influences observed for BWT and WWT traits with 9% and 8% contribution to total phenotypic variances, respectively. Additionally, maternal permanent environmental influences were observed to BWT (4%) and YWT trait (3%). The genetic and phenotypic correlations among studied traits were high and positive. The genetic changes were positive and significant for WWT only. It was concluded that the weight at 6 months of age can be continued as selection criterion for further genetic improvement through selection. Also, maternal effects should be considered in breeding programme for enhancing early growth performance in Harnali sheep.

Polymorphism of growth hormone (GH) gene and its association with performance and body conformation of Harnali sheep.

The present study was carried out to study the polymorphism in the GH gene and its association with various performance and body conformation traits, viz., birth weight (B-WT), weaning weight (W-WT), six-month body weight (6 M-WT), one-year body weight (Y-WT), annual greasy fleece weight (AGFW), body length (BL), body height (BH), heart girth (HG) and paunch girth (PG) in 138 Harnali sheep. PCR-RFLP was performed to identify polymorphism in the targeted region of the GH gene. The PCR product of 422 bp size of the GH gene was amplified encompassing partial exon 2 and inton 3 in Harnali sheep. The PCR product was digested with HaeIII restriction enzyme for the detection of Single nucleotide polymorphism (SNP). The digested products revealed the presence of two genotypes, i.e. AA and AB in the studied population. A > G mutation (A781G) was observed in our resource population. The AA genotype was found to be the predominant genotype (0.62). Chi square value revealed that resource population was not under Hardy-Weinberg equilibrium with respect to target locus. Period of birth was found to have significant effect on W-WT, Y-WT, BL, BH and PG. Sex of animal was found to have significant (P < 0.05) effect on W-WT and highly significant (P < 0.01) effect on 6 M-WT, Y-WT and AGFW in Harnali sheep. The effect of genotype was found to be significant (P < 0.05) on annual greasy fleece weight. AB genotype was found to be associated with higher annual greasy fleece weight and can be used as a potential candidate marker in selection criteria for improving greasy fleece weight in Harnali sheep.

Comprehensive analysis of differences in the physiochemical composition of foremilk and hindmilk of grazing indigenous and crossbred dairy goats; implications for growth, milk production and industry.

This study was conducted on 90 grazing Hair, Alpine × Hair F1 (AHF1), and Saanen × Hair F1 (SHF1) crossbred goats in three farms located around the Taurus Mountains in Konya, Türkiye. The study investigated variation in milk production, physico-chemical traits of milk fractions (foremilk, hindmilk and total milk), and growth traits. Genotype, parity, offspring sex, birth type, and flock factors significantly influenced milk production and quality traits of milk fractions (P < 0.05 to P < 0.01). Does with male/single offspring produced less milk, but with higher nutrient density (P < 0.05). Hindmilk was 272%, 31% and 61% richer in fat, total solids and energy content than foremilk, respectively (P < 0.001). However, the protein, lactose and solids-non-fat content of hindmilk was on average 7% lower than that of foremilk (P < 0.001). Physico-chemical quality traits of foremilk, hindmilk and total milk had a strong negative correlation with daily milk yield (P < 0.05 to P < 0.001). Live weight and average daily gains (ADG) of kids were influenced by maternal parity, flock, offspring sex and birth type (P < 0.05). The overall Kleiber ratios (KR) from birth to 2 months, birth to 3 months, birth to 6 months and 3 to 6 months of age were 21.0 ± 0.22, 17.1 ± 0.11, 10.5 ± 0.06 and 8.5 ± 0.21 g/kg of metabolic weight, respectively. It was concluded that these findings are critical for milk sampling protocols, offspring growth strategies, product development and precision livestock management.

Single nucleotide polymorphisms of growth hormone gene in cattle and their association with growth traits: a systematic review.

Growth traits in livestock animals are quantitative parameters, which are often controlled by many genes including growth hormone (GH) gene. However, the evidence of effect of GH gene on growth traits of cattle is poorly understood. Hence, the objective of the study was to systematically investigate the literature on single nucleotide polymorphisms (SNPs) of GH gene and their association with growth traits in cattle from four databases Google Scholar, PubMed, ScienceDirect, and Web of Science. The results indicated that fifteen (n = 15) articles with 27% of them from Indonesia qualified to be used in this study after screening. The results revealed five SNPs (1047T > C, 1180 C > T, 86,273,136 A/G, 3338 A > G and 4251 C > T) occurred across multiple investigated breeds with no common identified SNPs. Six articles observed a significant difference (p < 0.05) between growth traits and genotypes of identified SNPs. The findings showed that 7 articles (47%) investigated body weight (BW) with 6 (40%) of them found non-significant and 1 (7%) found a significant association with genotypes of the identified SNPs (3338 A > G). While 7 articles (47%) investigated weaning weight (WW) with 5 (33%) of them revealed a non-significant and 2 (13%) found a significant association with genotypes of identified SNPs (3338 A > G and 4251 C > T). This study shows that there is a lack of evidence on effect of growth hormone gene on growth traits in cattle. However, more studies are recommended for further validation of the identified SNPs and effect of growth hormone gene on growth traits in cattle.

Comparison of genomic prediction methods for early growth traits of Inner Mongolia cashmere goats based on multi trait models.

Inner Mongolia cashmere goat is an excellent livestock breed formed through long-term natural selection and artificial breeding, and is currently a world-class dual-purpose breed producing cashmere and meat. Multi trait animal model is considered to significantly improve the accuracy of genetic evaluation in livestock and poultry, enabling indirect selection between traits. In this study, the pedigree, genotype, environment, and phenotypic records of early growth traits of Inner Mongolia cashmere goats were used to build multi trait animal model., Then three methods including ABLUP, GBLUP, and ssGBLUP wereused to estimate the genetic parameters and genomic breeding values of early growth traits (birth weight, weaning weight, average daily weight gain before weaning, and yearling weight). The accuracy and reliability of genomic estimated breeding value are further evaluated using the five fold cross validation method. The results showed that the heritability of birth weight estimated by three methods was 0.13-0.15, the heritability of weaning weight was 0.13-0.20, heritability of daily weight gain before weaning was 0.11-0.14, and the heritability of yearling weight was 0.09-0.14, all of which belonged to moderate to low heritability. There is a strong positive genetic correlation between weaning weight and daily weight gain before weaning, daily weight gain before weaning and yearling weight, with correlation coefficients of 0.77-0.79 and 0.56-0.67, respectively. The same pattern was found in phenotype correlation among traits. The accuracy of the estimated breeding values by ABLUP, GBLUP, and ssGBLUP methods for birth weight is 0.5047, 0.6694, and 0.7156, respectively; the weaning weight is 0.6207, 0.6456, and 0.7254, respectively; the daily weight gain before weaning was 0.6110, 0.6855, and 0.7357 respectively; and the yearling weight was 0.6209, 0.7155, and 0.7756, respectively. In summary, the early growth traits of Inner Mongolia cashmere goats belong to moderate to low heritability, and the speed of genetic improvement is relatively slow. The genetic improvement of other growth traits can be achieved through the selection of weaning weight. The ssGBLUP method has the highest accuracy and reliability in estimating genomic breeding value of early growth traits in Inner Mongolia cashmere goats, and is significantly higher than that from ABLUP method, indicating that it is the best method for genomic breeding of early growth weight in Inner Mongolia cashmere goats.

Impacts of kinetin implementation on leaves, floral and root-related traits during seed production in hybrid rice under water deficiency.

BACKGROUND: Water deficit is one of the most significant abiotic factors affecting rice and agricultural production worldwide. In hybrid rice, cytoplasmic male sterility (CMS) is an important technique for creating high-yielding crop based on heterosis. The phytohormone kinetin (Kin) regulates cell division in plant during the early stages of grain formation, as well as flow assimilation and osmotic regulation under water stress. The present study performed to estimate the effects of irrigation intervals (irrigation each six days (I6), nine days (I9), twelve days (I12) and fifteen days (I15) against continuous flooding (CF, each three days)) and kinetin exogenously application (control, 15 mg L-1 and 30 mg L-1) on hybrid rice (L1, IR69625A; L2, G46A and R, Giza 178 R) seed production. RESULTS: Leaves traits (Chlorophyll content (CHC), relative water content (RWC), stomatal conductance (SC), Leaf temperature (LT) and transpiration rate (TR)), floral traits such as style length (SL) and total stigma length (TSL), in addition to root traits (i.e., root length (RL), root volume (RV), root: shoot ratio (RSR), root thickness (RT), root xylem vessels number (RXVN) and root xylem vessel area (RXVA) were evaluated and a significant enhancement in most traits was observed. Applying 30 mg L-1 kinetin significantly and positively enhanced all growth, floral and roots traits (RV and RXVA recorded the most increased values by 14.8% and 23.9%, respectively) under prolonging irrigation intervals, in comparison to non-treated plants. CONCLUSIONS: Subsequently, spraying kinetin exogenously on foliar could be an alternative method to reduce the harmful influences of water deficiency during seed production in hybrid rice.

Novel single nucleotide polymorphisms of insulin-like growth factor-binding protein 7 (IGFBP7) gene significantly associated with growth traits in striped catfish (Pangasianodon hypophthalmus Sauvage, 1878).

Breeding program to improve economically important growth traits in striped catfish (Pangasianodon hypophthalmus) requires effective molecular markers. This study was conducted to identify single nucleotide polymorphisms (SNPs) of Insulin-like Growth Factor-Binding Protein 7 (IGFBP7) gene which plays multiple roles in regulating growth, energy metabolism and development. The association between SNPs in IGFBP7 gene and growth traits in striped catfish was analyzed in order to uncover the SNPs that have potential to be valuable markers for improving growth traits. Firstly, fragments of IGFBP7 gene from ten fast-growing fish and ten slow-growing fish were sequenced in order to discover SNPs. After filtering the detected SNPs, an intronic SNP (2060A > G) and two non-synonymous SNPs (344 T > C and 4559C > A) causing Leu78Pro and Leu189Met in protein, respectively, were subjected to further validated by individual genotyping in 70 fast-growing fish and 70 slow-growing fish using single base extension method. Our results showed that two SNPs (2060A > G and 4559 C > A (p. Leu189Met)) were significantly associated with the growth in P. hypophthalmus (p < 0.001), thus being candidate SNP markers for the growth traits of this fish. Moreover, linkage disequilibrium and association analysis with growth traits of haplotypes generated from the 3 filtered SNPs (344 T > C, 2060 A > G and 4559 C > A) were examined. These revealed that the non-coding SNP locus (2060A > G) had higher genetic diversity at which the G allele was predominant over the A allele in the fast-growing fish. Furthermore, the results of qPCR showed that expression of IGFBP7 gene with genotype GG (at locus 2060) in fast-growing group was significantly higher than that with genotype AA in slow-growing group (p < 0.05). Our study provides insights into the genetic variants of IGFBP7 gene and useful data source for development molecular marker for growth traits in breeding of the striped catfish.

Association analysis of indels in the VISFATIN gene with five cattle breeds and their growth traits.

VISFATIN is an adipose cytokine that has been proved to correlate with growth and development traits. In a previous study from our lab, two insertion/deletions (indels; including a 35-bp insertion at its intron 4 and a 6-bp deletion in intron 5) were identified within the VISFATIN gene. To validate these indels and evaluate their association with growth traits in Chinese cattle, a total of 413 samples from four Chinese indigenous breeds and 217 samples from Chinese breeds were detected. Three genotypes (WW, WI and II) at intron 4 were detected based on the 35-bp insertion (allele I) or deletion (allele W) and showed moderate polymorphism in all samples. Two genotypes (WW and WD) at intron 5 were detected based on the 6-bp deletion (allele D) or insertion (allele W) in Xianan (XN) cattle and Jinnan (JN) cattle population but showed poor polymorphisms. Association analysis illustrated that the indel at intron 4 is significantly associated with chest girth, rump length and body weight in Ji'an (JA) cattle and the indel at intron 5 can cause a significant difference in rump length in JN cattle. To our knowledge, it is the first time it has been shown that indels within the VISFATIN gene are associated with growth traits in the two Chinese indigenous cattle breeds. These findings suggest that the VISFATIN gene can be used as a molecular marker for JN and JA cattle breeding.

Genome-wide association studies and haplotype sharing analysis targeting the growth traits in Yandang partridge chickens.

The body size of a chicken is an economically important trait as it directly influences the benefits of the poultry industry, but the relevant genetic mechanisms have not yet been elucidated. In this study, we measured eight growth traits for 94 Yandang partridge chickens, then undertook genome-wide association studies (GWAS) for those traits in using a linear mixed model based on 10× whole genomic sequencing data to better understand the knowledge of the genetic architecture of growth traits. Ninety-four individuals and 7647883 SNPs remained after quality control and removal of the sex chromosomes, and these data were used to carry out a GWAS analysis. The result showed that only one significant single-nucleotide polymorphisms (SNP) locates at 14852873 bp on SSC13 surpassed the genome-wide significance level for Keel length (KL). Through linkage disequilibrium analysis and haplotype sharing analysis, we identified one haplotype underlying the SSC13 significantly associated with KL, which could be selected as a potential candidate haplotype that is used in molecular breeding of Yandang partridge chicken. On the other hand, we have learned from a method called bootstrap testing to verify the reliability of GWAS with small experimental samples, which users can access at https://github.com/xuwenwu24/Bootstrap-test.

Detection of single nucleotide polymorphism in HTR4 and its relationship with growth traits in sheep.

In this study, a single nucleotide polymorphism of HTR4 (hydroxytryptamine receptor 4) was detected using DNA sequencing and KASPar (Kompetitive Allele-Specific PCR) technique with the aim of analyzing its effect on growth traits in 1102 sheep. A synonymous mutation g.101220 C > T located on the fifth intron of the ovis HTR4 gene was detected, and association analysis showed that this mutation was significantly associated with growth traits in sheep (p ＜.05), with TT genotypes having significantly lower body weight, height, length and chest circumference than TC and CC genotypes. It showed that the polymorphism of this locus was significantly associated with growth traits in sheep. In addition, qRT-PCR results showed that HTR4 was expressed in different tissues of sheep. It is highly expressed in the liver, spleen and duodenum. As important metabolic, immune and digestive absorption organs in animals, the above tissues can regulate the excitability of intestinal smooth muscle by participating in the body metabolism and nutrient metabolism of sheep, so that sheep can show better growth characteristics. In conclusion, the polymorphic locus identified in HTR4 gene can be used as candidate molecular marker in sheep breeding.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

CNV analysis of VAMP7 gene reveals variation associated with growth traits in Chinese cattle.

Copy number variant (CNV), a common genetic polymorphism, is closely related to the phenotypic variation traits of organisms. Vesicle-associated membrane protein 7 gene (VAMP7) codes a protein, which is a member of the SNARE proteins family and plays an important role in the process of intracellular vesicle transport. In this study, a total of four cattle breeds (Yunling cattle, Xianan cattle, Pinan cattle, Jiaxian red cattle) were used to investigate the copy numbers, and we found an association relationship between CNV of VAMP7 gene and growth traits of cattle by SPSS 20.0 software. The results showed that the CNV type of VAMP7 gene in four cattle breeds had the same distribution, Duplication type occupies a dominant position among the four varieties. In Yunling cattle, the Duplication type of VAMP7 is significantly related to the height at the hip cross (p < 0.05), Individuals with Duplication type commonly have less performance on growth and development, which indicates that the Duplication type of the VAMP7 gene may have a negative effect on cattle growth. Individuals with the other two CNV types may become the breeding direction of the VAMP7 gene. This study provided a new perspective and basic material for the molecular genetics of the CNV of the VAMP7 gene, and also promoted the breeding progress of Chinese local cattle.

Copy number variation of bovine S100A7 as a positional candidate affected body measurements.

Beef production is closely related to the national economy and the attention has been paid to the improvement of beef cattle by molecular markers associated. Copy number variations (CNVs) recently have been gained many researches and recognized as an important source of genetic variation. Extensive studies have indicated that CNVs have effects on a large range of economic traits by a wide range of gene copy number alteration. S100A7 is a member of S100 family which is a famous family of Ca2+-binding proteins. S100A7 plays a crucial role in many important phenotypes (progress) including inflammatory diseases, psoriasis, obesity, etc. The aim of our study was to explore the phenotypic effects of CNV located in the S100A7 gene of bovine chromosome 3. We detected S100A7 CNV by qPCR in different cattle breeds, including Qinchuan cattle, Yunling cattle, Xianan cattle and a crossbred group Pinan. The copy number was identified as gain, normal and loss type, our results showed that the gain type was the main type in three types of S100A7 CNV of the whole tested breeds. After CNV detection, association analysis between S100A7 CNV and growth traits was carried out in four cattle breeds. We found significant effects of the CNV on cattle growth traits with differently preferred CNV types such as gain type with better chest depth (p = 0.043) in QC, loss type with better body length (p = 0.008) and rump width (p = 0.014) in YL, normal with better chest girth (p = 0.001), gain with better waist width (p = 0.001) and rump width (p = 0.044) in PN. These results suggested that the S100A7 CNV could affect the phenotypic traits and be used as a promising genetic marker for cattle molecular breeding.

Investigation of the association between goat DNMT3B gene polymorphism and growth traits.

The DNA methyltransferase 3 beta (DNMT3B) gene is key for DNA methylation and has been well recognized in regulating growth and development. A previous observation indicated that an 11-bp indel of DNMT3B affected the reproductive traits in goats, yet the effect of this polymorphism on body measurement traits in goats has not been reported. This study aims to investigate the associations between DNMT3B gene polymorphism and goat growth traits. We investigated this 11-bp indel in 2184 goats and three genotypes have been found in Shaanbei white cashmere goat (SBWC): insertion/insertion (II), deletion/deletion (DD) and insertion/deletion (ID). Only ID and DD genotypes were detected in Nubian goats and Guizhou heima goat (GZHM). The allele frequencies analyzed revealed that the 'D' allele frequencies were higher in all three goat breeds. Further association analysis demonstrated that this indel is markedly associated with the cannon circumference (CC) and cannon circumference index (CCI) of SBWC and cannon circumference (CC) of Nubian goats (p < .05). The CC and CCI are essential indicators to measure the growth status of goats. In summary, our study sheds some light on the potential impact of the 11-bp indel polymorphism of the DNMT3B gene on improving the growth traits in goats.