Genomic insight on Klebsiella variicola isolated from wastewater treatment plant has uncovered a novel bacteriophage.

Klebsiella variicola is considered an emerging pathogen, which may colonize a variety of hosts, including environmental sources. Klebsiella variicola investigated in this study was obtained from an influent wastewater treatment plant in the North-West Province, South Africa. Whole genome sequencing was conducted to unravel the genetic diversity and antibiotic resistance patterns of K. variicola. Whole genome core SNP phylogeny was employed on publicly available 170 genomes. Furthermore, capsule types and antibiotic resistance genes, particularly beta-lactamase and carbapenems genes were investigated from the compared genomes. A 38 099 bp bacteriophage was uncovered alongside with K. variicola genome. Whole genome sequencing revealed that the extended beta-lactamase blaLEN (75.3%) of the beta-lactamase is dominant among compared K. variicola strains. The identified IncF plasmid AA035 confers resistance genes of metal and heat element subtypes, i.e., silver, copper, and tellurium. The capsule type KL107-D1 is a predominant capsule type present in 88.2% of the compared K. variicola genomes. The phage was determined to be integrase-deficient consisting of a fosB gene associated with fosfomycin resistance and clusters with the Wbeta genus Bacillus phage group. In silico analysis showed that the phage genome interacts with B. cereus as opposed to K. variicola strain T2. The phage has anti-repressor proteins involved in the lysis-lysogeny decision. This phage will enhance our understanding of its impact on bacterial dissemination and how it may affect disease development and antibiotic resistance mechanisms in wastewater treatment plants. This study highlights the need for ongoing genomic epidemiological surveillance of environmental K. variicola isolates.

Coexistence of blaIMP-4 and blaSFO-1 in an IncHI5B plasmid harbored by tigecycline-non-susceptible Klebsiella variicola strain.

BACKGROUND: Klebsiella variicola is considered a newly emerging human pathogen. Clinical isolates of carbapenemase and broad-spectrum ß-lactamase-producing K. variicola remain relatively uncommon. A strain of K. variicola 4253 was isolated from a clinical sample, and was identified to carry the blaIMP-4 and blaSFO-1 genes. This study aims to discern its antibiotic resistance phenotype and genomic characteristics. METHODS: Species identification was conducted using MALDI-TOF/MS. PCR identification confirmed the presence of the blaIMP-4 and blaSFO-1 genes. Antibiotic resistance phenotype and genomic characteristics were detected by antimicrobial susceptibility testing and whole-genome sequencing. Plasmid characterization was carried out through S1-PFGE, conjugation experiments, Southern blot, and comparative genomic analysis. RESULTS: K. variicola 4253 belonged to ST347, and demonstrated resistance to broad-spectrum ß-lactamase drugs and tigecycline while being insensitive to imipenem and meropenem. The blaIMP-4 and blaSFO-1 genes harbored on the plasmid p4253-imp. The replicon type of p4253-imp was identified as IncHI5B, representing a multidrug-resistant plasmid capable of horizontal transfer and mediating the dissemination of drug resistance. The blaIMP-4 gene was located on the In809-like integrative element (Intl1-blaIMP-4-aacA4-catB3), which circulates in Acinetobacter and Enterobacteriaceae. CONCLUSIONS: This study reports the presence of a strain of K. variicola, which is insensitive to tigecycline, carrying a plasmid harboring blaIMP-4 and blaSFO-1. It is highly likely that the strain acquired this plasmid through horizontal transfer. The blaIMP-4 array (Intl1-blaIMP-4-aacA4-catB3) is also mobile in Acinetobacter and Enterobacteriaceae. So it is essential to enhance clinical awareness and conduct epidemiological surveillance on multidrug-resistant K. variicola, conjugative plasmids carrying blaIMP-4, and the In809 integrative element.

Native CRISPR-Cas-based programmable multiplex gene repression in Klebsiella variicola.

Klebsiella variicola is a Gram-negative bacterium that is frequently isolated from a wide variety of natural niches. It is a ubiquitous opportunistic pathogen that can cause diverse infections in plants, animals, and humans. It also has significant biotechnological potential. However, due to the lack of efficient genetic tools, the molecular basis contributing to the pathogenesis and beneficial activities of K. variicola remains poorly understood. In this study, we found and characterized a native type I-E CRISPR-Cas system in a recently isolated K. variicola strain KV-1. The system cannot cleave target DNA sequences due to the inactivation of the Cas3 nuclease by a transposable element but retains the activity of the crRNA-guided Cascade binding to the target DNA sequence. A targeting plasmid carrying a mini-CRISPR to encode a crRNA was designed and introduced into the KV-1 strain, which successfully repurposed the native type I-E CRISPR-Cas system to inhibit the expression of the target gene efficiently and specifically. Moreover, by creating a mini-CRISPR to encode multiple crRNAs, multiplex gene repression was achieved by providing a single targeting plasmid. This work provides the first native CRISPR-Cas-based tool for programmable multiplex gene repression in K. variicola, which will facilitate studying the pathogenic mechanism of K. variicola and enable metabolic engineering to produce valuable bioproducts.

First Report of Bulb Rot Disease of Banana Caused by Klebsiella variicola in China.

Banana (Musa spp.) is an economically important fruit and food crop globally as well as in China. In March 2023, a bulb rot disease was observed on more than 20% of cultivated dwarf bananas in a plantation in Wuming County of Guangxi Province, a major hub of banana production in China. Infected plants showed crackles at the basal part of stem and were relatively dwarf, while yellowing of the leaves was not observed. When the rhizomes were cut open, water-soaked lesions with a yellow or black margin can be seen in the bulb. In severe infections, the internal tissue became dry or wet rot, and there was typical dark-brown cavity formation in the bulb. The rot was limited to the bulb. To isolate the causal agent, dissected diseased tissues (5×5 mm) were surface sterilized with 75% ethanol (30 s) and 2% NaClO (3 min), followed by three rinses with sterile water. The sterilized sections were soaked in 2 mL of sterile water and shaken for 5 min in a vortex oscillator. The suspension was streaked on Luria-Bertani (LB) agar medium, and incubated at 28℃ for 24 h. Single colonies were re-streaked three times to obtain purified isolation. Twelve pure bacterial cultures with similar morphology were isolated from three plants taken from the field. The bacterial colonies were yellowish white, mucoid, round, and raised with translucent surfaces on the LB agar plate. Three strains Gxkv1, Gxkv2 and Gxkv3 were selected for further analyses. The 16S rDNA gene (GenBank Accession OR461756, PP094726 and PP109349) were amplified using primer pair 27F/1492R (Frank et al. 2008). Comparing 16S sequences against GenBank showed 99.86%-100% sequence identity to Klebsiella variicola strain (MZ475068) for the three isolates Gxkv1 (1,398/1,398 bp), Gxkv2 (1,398/1,396 bp) and Gxkv3 (1,398/1,398 bp). A multilocus phylogenetic analysis was conducted by neighbor-joining method (1,000 bootstrap values) based on three housekeeping gene sequences of gyrA (GenBank Accession No. OR515493, PP105747, PP105748), rpoB (OR515494, PP105751, PP105752 ) and infB (OR515495, PP105749, PP105750) genes which were amplified by gyrA-A/gyrA-C, CM31b/CM7 and infB867F/infB1819R primer sets, respectively (Rosenblueth et al. 2004). The results of phylogenetic analysis showed the three strains belong to the K. variicola clade. A pathogenicity test was conducted on six healthy 3-month-old dwarf banana plants by spraying 10 mL of bacterial suspensions of Gxkv1 (108 CFU/mL) into the rhizome which wounded with a sterilized needle; another six healthy control plants were sprayed with 10 mL of sterile water. Following inoculation, the plants were placed in a greenhouse at 28-32°C. After 30 days, all inoculated plants showed symptoms similar to those observed in the field, while the control plants remained healthy. Bacteria were successfully reisolated from the symptomatic tissues and identified to be K. variicola by PCR mentioned above. K. variicola has been reported to cause rhizome rot of banana in India (Loganathan et al. 2021), and to cause plantain soft rot in Haiti (Fulton et al. 2021). Besides, previous reports from China only showed K. variicola causing banana sheath rot (Fan et al. 2015, Sun et al. 2023). To our knowledge, this is the first report of bulb rot disease of banana caused by K. variicola in Guangxi Province, China. This finding will provide important information for studying the epidemiology and management of this pathogen.

First Report of bacterial wilt disease of banana caused by Klebsiella variicola in Malaysia.

In Malaysia, bananas (Musa spp.) are the second most cultivated fruit and the fourth most cultivated fruit in terms of export revenue. In October 2018, about 5.0 out of 6.6 hectares of a banana plantation located in Teluk Intan, Malaysia, was impacted by an outbreak of banana disease. The onset of bacterial wilt symptoms is characterized by initial leaf wilting, followed by the subsequent withering of the entire plant during later stages, fruit stalk and fruit pulp discoloration, fruit rotting, and pseudostem necrosis. The diseased banana's symptomatic pseudostems and fruit pulps were surface-sterilised in 70% ethanol for 30 s, followed by 2% NaClO for 3 min, rinsed three times in sterilised water, and cut into small pieces approximately 5 mm2 in size. The tissues were macerated in a sterilised 0.85% NaCl solution for 5 min, and the resulting suspension was streaked onto nutrient agar, followed by incubation at 28°C for 2 days. After incubation, bacterial colonies with five unique morphological characteristics were observed. Two colonies of each unique morphological type were randomly chosen and subjected to preliminary bacterial identification by 16S rRNA gene sequencing. Based on BLASTn analysis, the five unique morphological types of bacteria were preliminarily identified as Enterobacter cloacae, Citrobacter farmeri, Klebsiella variicola, Kosakonia radicincitans, and Phytobacter ursingii. Previous reports identified K. variicola and K. radicincitans as banana pathogens, but Malaysia has yet to report the former. The amplified partial 16S rDNA sequences of both K. variicola isolates (designated as UTAR-BC1 and UTAR-BC2; GenBank accession numbers: PP531448 and PP531460, respectively), which were chosen to be the focus of this study, exhibited complete similarity to each other and were 100% identical (1426/1426 identity and 1420/1420 identity, respectively) to K. variicola (CP026013.1). To verify the identity of the bacterial isolate, three housekeeping genes, namely, infB(PP538994), rpoB (PP538995), and gyrB (PP538996) of UTAR-BC1, were amplified, sequenced, and subjected to multilocus phylogenetic analysis via the neighbour-joining method (1,000 bootstrap values). Phylogenetic analysis revealed that UTAR-BC1 belongs to the K. variicola clade. A pathogenicity assay of UTAR-BC1 was conducted on 4-month-old healthy banana plantlets (cv. Nangka) using the pseudostem injection method (Tripathi et al., 2008). First, UTAR-BC1 was grown overnight in nutrient broth and then adjusted to 108 CFU/ml in a sterile 10 mM MgCl2 solution. A total volume of 100 µL of the bacterial suspension was injected into the pseudostem of five healthy banana plantlets via a syringe with a needle. Control plants were mock-inoculated with a sterile 10 mM MgCl2 solution. The experiments were replicated thrice and inoculated plants were maintained at room temperature with natural sunlight and humidity, which resembled the field conditions. Two months after inoculation, all of the UTAR-BC1 inoculated spots of banana plantlets showed severe necrosis, while the banana leaves showed symptoms of wilted appearance, whereas the control plants remained symptomless. The reisolated pathogen from 90% of the symptomatic pseudostems and leaf blades shares the same morphological and molecular features as UTAR-BC1, thus fulfilling Koch's postulates. Previously, K. variicola has been reported to be a banana pathogen causing rhizome rot in India (Loganathan et al., 2021), plantain soft rot in Haiti (Fulton et al. 2020), and sheath rot and bulb rot in China (Sun et al., 2023; Jiang et al., 2024). To the best of our knowledge, this is the first report of bacterial wilt disease in bananas attributed to K. variicola in Malaysia. This finding will facilitate the surveillance of K. variicola as an emerging pathogen in banana plants in this region, thereby safeguarding the country's food security and promoting socio-economic growth.

First Report of Klebsiella variicola Causing Tomato Pith Necrosis in Yunnan Province, China.

Tomato (Solanum lycopersicum L.) is a key vegetable crop in China. In August 2023, an outbreak of bacterial pith necrosis in tomato occurred in Lufeng County, Yunnan Province, China, affecting over 40% of the tomato plants in a greenhouse. The stems of infected plants developed a waterlogged soft rot and the disease progressed, the lower leaves and lateral branches of infected plants gradually wilted and died. A longitudinal cut of the stem revealed hollow pith with brown vascular tissue. To isolate the pathogen, the plant surface was disinfested with 75% ethanol. Then, a piece of infected tissue from the base of the stem was excised and immersed in sterile water for 2 min. A small amount of liquid was streaked onto TTC (2,3,5-triphenyltetrazolium chloride) agar medium using an inoculation loop, and plates were incubated at 28℃ for 24 h. Colonies on the TTC plate were white, indicating that the pathogen was not Ralstonia solanacearum. Colonies grown on LB (Luria-Bertani) agar medium were randomly selected and subjected to preliminary pathogenicity tests. Based on the results, a colony named Kv4 was selected and purified through six subcultures in LB agar medium. Biochemical tests showed the strain utilized D-sorbitol, raffinose and citrate but not adonitol, and was positive for methyl red, D-glucose (acid), urea hydrolysis, lysine decarboxylase, and motility, and negative for phenylalanine deaminase, H2S production, indole production, and ornithine decarboxylase. These characteristics align with Klebsiella species (Garrity et al. 2007). To determine the species of strain Kv4, partial sequences of the 16S rDNA, phoE, leuS, and rpoB genes were amplified (Barrios-Camacho et al. 2019) and sequenced. Through BLASTn analysis, strain Kv4 sequences of 16S rDNA (OR888750) had 99.47% identity (1488/1496 bp), phoE (OR899599) had 98.69% (605/613 bp) identity, leuS (OR899598) had 99.07% identity (959/968 bp), and rpoB (OR899597) had 97.69% (633/648 bp) identity with Klebsiella variicola strain FF0907. Using the ClustalW algorithm in MEGA11 for nucleotide sequence alignment, phylogenetic trees were constructed with 16S and phoE, leuS, and rpoB via the neighbor-joining method, confirming strain Kv4 as K. variicola. To test pathogenicity, the roots of 25 'Moneymaker' tomato plants with four to five true leaves were wounded, then each plant inoculated with a 15 mL bacterial suspension (OD600=0.6) of strain Kv4, while the control plants received sterile water. Plants were incubated at 28℃ with a 16 h photoperiod. Experiments were done twice. At 15 days after inoculation (DAI), all plants inoculated with Kv4 showed yellowing, unevenly distributed small black necrotic spots on the leaf surface, and purple-brown soft rot at the stem base. By 18 DAI, there was a gradual transformation of the stem bases from green to purplish brown. At 21 DAI, 60% of the inoculated plants displayed brownish soft rot at the stem base. In contrast, the control plants remained symptom-free. The pathogen was re-isolated from the stem and identified as K. variicola via sequence analysis of 16S, phoE, leuS, and rpoB. In recent years, several new bacterial pith necrosis diseases were reported in tomato (Guo et al. 2023; Ivic et al. 2023). This is the first study documenting K. variicola causing bacterial pith necrosis in tomato. Once considered a benign plant endophyte, Sun et al. (2023) reported K. variicola causing banana sheath rot in Guangdong and Guangxi Provinces, China. Malik et al. (2023) reported that K. variicola caused leaf streak in sorghum in India. This report of bacterial pith necrosis in tomato caused by K. variicola strain Kv4 underscores the escalating threat posed by emerging pathogens to agricultural production. The emergence of K. variicola as a tomato pathogen complicates plant disease management strategies.

Plasmids of the incompatibility group FIBK occur in Klebsiella variicola from diverse ecological niches.

Plasmids play a fundamental role in the evolution of bacteria by allowing them to adapt to different environments and acquire, through horizontal transfer, genes that confer resistance to different classes of antibiotics. Using the available in vitro and in silico plasmid typing systems, we analyzed a set of isolates and public genomes of K. variicola to study its plasmid diversity. The resistome, the plasmid multilocus sequence typing (pMLST), and molecular epidemiology using the MLST system were also studied. A high frequency of IncF plasmids from human isolates but lower frequency from plant isolates were found in our strain collection. In silico detection revealed 297 incompatibility (Inc) groups, but the IncFIBK (216/297) predominated in plasmids from human and environmental samples, followed by IncFIIK (89/297) and IncFIA/FIA(HI1) (75/297). These Inc groups were associated with clinically important ESBL (CTX-M-15), carbapenemases (KPC-2 and NDM-1), and colistin-resistant genes which were associated with major sequence types (ST): ST60, ST20, and ST10. In silico MOB typing showed 76% (311/404) of the genomes contained one or more of the six relaxase families with MOBF being most abundant. We identified untypeable plasmids carrying blaKPC-2, blaIMP-1, and blaSHV-187 but for which a relaxase was found; this may suggest that novel plasmid structures could be emerging in this bacterial species. The plasmid content in K. variicola has limited diversity, predominantly composed of IncFIBK plasmids dispersed in different STs. Plasmid detection using the replicon and MOB typing scheme provide a broader context of the plasmids in K. variicola. This study showed that whole-sequence-based typing provides current insights of the prevalence of plasmid types and their association with antimicrobial resistant genes in K. variicola obtained from humans and environmental niches.

A case report of fatal COVID-19 complicated by rapidly progressive sepsis caused by Klebsiella variicola.

BACKGROUND: There is a growing interest in Klebsiella variicola as a causative pathogen in humans, though its clinical features and the impact of co-infection or secondary infection with COVID-19 remain unknown. CASE PRESENTATION: A 71-year-old man presented with fever, altered mental status and generalized weakness and was admitted to ICU due to severe COVID-19 pneumonia. He was newly diagnosed with type II diabetes mellitus upon admission. On hospital day 3, his respiratory status deteriorated, requiring invasive mechanical ventilation. On hospital day 10, superimposed bacterial pneumonia was suspected and subsequently, broad-spectrum antibiotics were administered for the associated bloodstream infection. On hospital day 13, despite administration of active antibiotics and appropriate source control, he decompensated and died. The causative organism isolated from blood cultures was initially reported as K. pneumoniae, but it was identified as K. variicola by a genetic analysis. A representative isolate (FUJ01370) had a novel multilocus sequence typing allelic profile (gapA-infB-mdh-pgi-phoE-rpoB-tonB: 16-24-21-27-52-17-152), to which sequence type 5794 was assigned (GenBank assembly accession: GCA_019042755.1). CONCLUSIONS: We report a fatal case of respiratory and bloodstream infection due to K. variicola complicating severe COVID-19. Co-infection or secondary infection of K. variicola in COVID-19 is likely under-recognized and can be fulminant as in this case.

Bacillus velezensis (strains A6 & P42) as a potential biocontrol agent against Klebsiella variicola, a new causal agent of soft rot disease in carrot.

Bacterial soft rot is one of the most devastating diseases and a major constraint encountered during carrot farming. Biological agents are the best eco-friendly alternatives to agrochemicals to manage soft rot disease to ensure environmental sustainability. In this study, about eight isolates of bacterial pathogen causing soft rot in carrots were collected from Karnataka, India. Based on the 16S rRNA sequencing the pathogen isolates causing soft rot of carrot were identified as Klebsiella variicola. The morphological characteristics of K. variicola was investigated under scanning electron microscopy. The pathogenicity assay showed that all eight isolates were pathogenic to the carrot. An in vitro and in planta assay of two novel strains of Bacillus velezensis (A6 and P42) against K. variicola indicated that both strains had strong antagonistic activity against all the pathogen strains. Furthermore, the volatile bioactive compounds produced by A6 and P42 strains were analyzed in GC-MS, which revealed the presence of 10 and 6 bioactive compounds in their culture filtrate, respectively, with antibacterial and antifungal properties. The present study suggests that both A6 and P42 strains of B. velezensis were antagonistic to K. variicola and can be used as biocontrol agents to manage soft rot diseases of carrot under field conditions.

Analysis of the features of 105 confirmed CRISPR loci in 487 Klebsiella variicola.

Klebsiella variicola, an emerging human pathogen, poses a threat to public health. The horizontal gene transfer (HGT) of plasmids is an important driver of the emergence of multiple antibiotic-resistant K. variicola. Clustered regularly interspersed short palindromic repeats (CRISPR) coupled with CRISPR-associated genes (CRISPR/Cas) constitute an adaptive immune system in bacteria, and can provide acquired immunity against HGT. However, the information about the CRISPR/Cas system in K. variicola is still limited. In this study, 487 genomes of K. variicola obtained from the National Center for Biotechnology Information database were used to analyze the characteristics of CRISPR/Cas systems. Approximately 21.56% of genomes (105/487) harbor at least one confirmed CRISPR array. Three types of CRISPR/Cas systems, namely the type I-E, I-E*, and IV-A systems, were identified among 105 strains. Spacer origin analysis further revealed that approximately one-third of spacers significantly match plasmids or phages, which demonstrates the implication of CRISPR/Cas systems in controlling HGT. Moreover, spacers in K. variicola tend to target mobile genetic elements from K. pneumoniae. This finding provides new evidence of the interaction of K. variicola and K. pneumoniae during their evolution. Collectively, our results provide valuable insights into the role of CRISPR/Cas systems in K. variicola.

Pathogen Profile of Klebsiella variicola, the Causative Agent of Banana Sheath Rot.

Banana (Musa spp.) is an important fruit and food crop worldwide. In recent years, banana sheath rot has become a major problem in banana cultivation, causing plant death and substantial economic losses. Nevertheless, the pathogen profile of this disease has not been fully characterized. Klebsiella variicola is a versatile bacterium capable of colonizing different hosts, such as plants, humans, insects, and animals, and is recognized as an emerging pathogen in various hosts. In this study, we obtained 12 bacterial isolates from 12 different banana samples showing banana sheath rot in Guangdong and Guangxi Provinces, China. Phylogenetic analysis based on 16S rRNA sequences confirmed that all 12 isolates were K. variicola strains. We sequenced the genomes of these strains, performed comparative genomic analysis with other sequenced K. variicola strains, and found a lack of consistency in accessory gene content among these K. variicola strains. However, prediction based on the pan-genome of K. variicola revealed 22 unique virulence factors carried by the 12 pathogenic K. variicola isolates. Microbiome and microbial interaction network analysis of endophytes between the healthy tissues of diseased plants and healthy plants of two cultivars showed that Methanobacterium negatively interacts with Klebsiella in banana plants and that Herbaspirillum might indirectly inhibit Methanobacterium to promote Klebsiella growth. These results suggest that banana sheath rot is caused by the imbalance of plant endophytes and opportunistic pathogenic bacteria, providing an important basis for research and control of this disease.[Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

blaKPC-2-Encoding IncP-6 Plasmids in Citrobacter freundii and Klebsiella variicola Strains from Hospital Sewage in Japan.

Klebsiella pneumoniae carbapenemase (KPC) producers are an emerging threat to global health, and the hospital water environment is considered an important reservoir of these life-threatening bacteria. We characterized plasmids of KPC-2-producing Citrobacter freundii and Klebsiella variicola isolates recovered from hospital sewage in Japan. Antimicrobial susceptibility testing, whole-genome sequencing analysis, bacterial conjugation, and transformation experiments were performed for both KPC-2 producers. The blaKPC-2 gene was located on the Tn3 transposon-related region from an IncP-6 replicon plasmid that could not be transferred via conjugation. Compared to the blaKPC-2-encoding plasmid of the C. freundii isolate, alignment analysis of plasmids with blaKPC-2 showed that the blaKPC-2-encoding plasmid of the K. variicola isolate was a novel IncP-6/IncF-like hybrid plasmid containing a 75,218-bp insertion sequence composed of IncF-like plasmid conjugative transfer proteins. Carbapenem-resistant transformants harboring blaKPC-2 were obtained for both isolates. However, no IncF-like insertion region was found in the K. variicola donor plasmid of the transformant, suggesting that this IncF-like region is not readily functional for plasmid conjugative transfer and is maintained depending on the host cells. The findings on the KPC-2 producers and novel genetic content emphasize the key role of hospital sewage as a potential reservoir of pathogens and its linked dissemination of blaKPC-2 through the hospital water environment. Our results indicate that continuous monitoring for environmental emergence of antimicrobial-resistant bacteria might be needed to control the spread of these infectious bacteria. Moreover, it will help elucidate both the evolution and transmission pathways of these bacteria harboring antimicrobial resistance. IMPORTANCE Antimicrobial resistance is a significant problem for global health, and the hospital environment has been recognized as a reservoir of antimicrobial resistance. Here, we provide insight into the genomic features of blaKPC-2-harboring isolates of Citrobacter freundii and Klebsiella variicola obtained from hospital sewage in Japan. The findings of carbapenem-resistant bacteria containing this novel genetic context emphasize that hospital sewage could act as a potential reservoir of pathogens and cause the subsequent spread of blaKPC-2 via horizontal gene transfer in the hospital water environment. This indicates that serial monitoring for environmental bacteria possessing antimicrobial resistance may help us control the spread of infection and also lead to elucidating the evolution and transmission pathways of these bacteria.

Multidrug-Resistant Klebsiella variicola Isolated in the Urine of Healthy Bovine Heifers, a Potential Risk as an Emerging Human Pathogen.

Klebsiella variicola, a member of Klebsiella pneumoniae complex, is found to infect plants, insects, and animals and is considered an emerging pathogen in humans. While antibiotic resistance is often prevalent among K. variicola isolates from humans, this has not been thoroughly investigated in isolates from nonhuman sources. Prior evidence suggests that K. variicola can be transmitted between agricultural products as well as between animals, and the use of antibiotics in agriculture has increased antibiotic resistance in other emerging pathogens. Furthermore, in animals that contain K. variicola as a normal member of the rumen microbiota, the same bacteria can also cause infections, such as clinical mastitis in dairy cows. Here, we describe K. variicola UFMG-H9 and UFMG-H10, both isolated from the urine of healthy Gyr heifers. These two genomes represent the first isolates from the urine of cattle and exhibit greater similarity with strains from the human urinary tract than isolates from bovine fecal or milk samples. Unique to the UFMG-H9 genome is the presence of flagellar genes, the first such observation for K. variicola. Neither of the sampled animals had symptoms associated with K. variicola infection, even though genes associated with virulence and antibiotic resistance were identified in both strains. Both strains were resistant to amoxicillin, erythromycin, and vancomycin, and UFMG-H10 is resistant to fosfomycin. The observed resistances emphasize the concern regarding the emergence of this species as a human pathogen given its circulation in healthy livestock animals. IMPORTANCE Klebsiella variicola is an opportunistic pathogen in humans. It also has been associated with bovine mastitis, which can have significant economic effects. While numerous isolates have been sequenced from human infections, only 12 have been sequenced from cattle (fecal and milk samples) to date. Recently, we discovered the presence of K. variicola in the urine of two healthy heifers, the first identification of K. variicola in the bovine urinary tract and the first confirmed K. variicola isolate encoding for flagella-mediated motility. Here, we present the genome sequences and analysis of these isolates. The bovine urinary genomes are more similar to isolates from the human urinary tract than they are to other isolates from cattle, suggesting niche specialization. The presence of antibiotic resistance genes is concerning, as prior studies have found transmission between animals. These findings are important to understand the circulation of K. variicola in healthy livestock animals.

Antibiotic resistance surveillance of Klebsiella pneumoniae complex is affected by refined MALDI-TOF identification, Swiss data, 2017 to 2022.

BackgroundModern laboratory methods such as next generation sequencing and MALDI-TOF allow identification of novel bacterial species. This can affect surveillance of infections and antimicrobial resistance. From 2017, increasing numbers of medical microbiology laboratories in Switzerland differentiated Klebsiella variicola from Klebsiella pneumoniae complex using updated MALDI-TOF databases, whereas many laboratories still report them as K. pneumoniae or K. pneumoniae complex.AimOur study explored whether separate reporting of K. variicola and the Klebsiella pneumoniae complex affected the ANRESIS surveillance database.MethodsWe analysed antibiotic susceptibility rates and specimen types of K. variicola and non-K. variicola-K. pneumoniae complex isolates reported by Swiss medical laboratories to the ANRESIS database (Swiss Centre for Antibiotic Resistance) from January 2017 to June 2022.ResultsAnalysis of Swiss antimicrobial resistance data revealed increased susceptibility rates of K. variicola compared with species of the K. pneumoniae complex other than K. variicola in all six antibiotic classes tested. This can lead to underestimated resistance rates of K. pneumoniae complex in laboratories that do not specifically identify K. variicola. Furthermore, K. variicola strains were significantly more often reported from blood and primarily sterile specimens than isolates of the K. pneumoniae complex other than K. variicola, indicating increased invasiveness of K. variicola.ConclusionOur data suggest that refined differentiation of the K. pneumoniae complex can improve our understanding of its taxonomy, susceptibility, epidemiology and clinical significance, thus providing more precise information to clinicians and epidemiologists.

Bioremediation of quinclorac injury on tobacco by a rhizosphere bacterium.

The presence of herbicides residues in soil represents a serious problem for agriculture. Quinclorac is a common herbicide applied in rice field, but its residue can cause abnormal growth in successive crop of tobacco in Southern China. Remediation by microorganisms is considered to be an environmentally friendly method to remove such pollutants injury. The aims of this study were to obtain quinclorac remediation isolates and to investigate the possible mechanism(s) of remediation. Six bacterial isolates were obtained from rhizosphere of rice-tobacco rotation fields, and were found to be capable of degrading quinclorac on a mineral salt medium (MSM), with degradation efficiency ranging from 2.1 to 23.7%. Among these isolates, J5 had the highest degradation efficiency, and was identified as Klebsiella variicola based on phylogenetic analyses and a metabolic profile generating by Biolog GEN III system. Bioremediation of quinclorac injury was confirmed using pot assays with tobacco, in which J5 reversed the detrimental effect of quinclorac on leaf area, leaf number, and plant height. The J5 isolate also seemed to promote plant growth, in terms of tobacco seedling growth and seed germination, which were 2.2 times and 1.6 times higher compared to untreated control, respectively. The mechanisms of plant growth promoting (PGP) traits were found to involve nitrogen-fixing, indole-3-acetic acid (IAA) production, and phosphate solubilization ability. In addition, proteomic analysis and relative quantitative PCR revealed an elevated level of 4-hydroxyphenylacetate 3-monooxygenase (HPMO) in quinclorac-treated J5, suggesting that this enzyme may play an important role in quinclorac remediation. This study showed that the J5 isolate could be exploited to not only assist in soil remediation due to quinclorac residue issues but also promote tobacco growth.

First isolation of Klebsiella variicola from a horse pleural effusion.

BACKGROUND: Respiratory diseases are the second most common cause of illnesses in horses, their etiology can be viral, bacterial, immune-mediated, or mechanical (Racklyeft and Love DN, Aust Vet J 78:549-59, 2000; Austin et al., J Am Vet Med Assoc 207:325-328, 1995; Arroyo et al., J Vet Intern Med 31:894-900, 2017). Klebsiella variicola is a Gram-negative bacterium that was initially identified as an endophyte in soil and plants such as bananas, rice, sugar cane and maize but recent studies have identified this microorganism as an emerging pathogen in humans (Rodríguez-Medina et al., Emerg Microbes Infect 8:973-988, 2019; Fontana et al., J Clin Microbiol 57:e00825-18, 2019; Rosenblueth et al., Syst Appl Microbiol 27:27-35, 2004). This paper describes, for the first time to our knowledge, the isolation of K. variicola from pleural effusion in a male adult horse. CASE PRESENTATION: 17-years Italian Saddle Horse with respiratory distress and fever was admitted to the Veterinary Teaching Hospital of the Department of Veterinary Medical Sciences, University of Bologna. At home, the patient had undergone antibiotic therapy without clinical improvement. Vital signs on admission revealed an increased respiratory rate, tachycardia, pyrexia and weight loss. The animal was submitted for collateral examination including thoracic radiology and ultrasound and thoracoscopy that showed bilateral pleural effusion associated with multifocal pulmonary atelectasis. During the thoracoscopic examination, that confirmed the presence of a seropurulent pleural effusion, a sample of pleural fluid was collected and Gram-negative bacteria were isolated and subjected to matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) that allowed the identification of K. variicola. The isolate was sensitive to amikacin, cefazolin, enrofloxacin, marbofloxacin, tetracycline, and trimethoprim-sulfamethoxazole;the horse was treated with Oxytetracycline and amikacin. Despite a general health improvement of the subject, the pleural effusion did not resolve after treatment. CONCLUSIONS: This paper describes, for the first time, the isolation of K. variicola in a horse with respiratory disease. The misidentification between K. variicola and K. pneumoniae has caused unawareness about significant aspects of this bacterial species. In fact, even though in animals the role of this bacterium is not clear, in humans it has been recognized as an emerging pathogen. The use of new methods for bacterial identification will probably lead to the isolation of a greater number of strains which will have to be studied to acquire knowledge that will be useful to clarify the clinical importance and relevance of K. variicola also in animals.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Characterization and phytostimulatory activity of bacteria isolated from tomato (Lycopersicon esculentum Mill.) rhizosphere.

Replacing agrochemicals with plant growth promoting bacteria (PGPB) may offset some of the environmental impacts of food production. The objectives of this study were to (1) isolate and characterize bacterial strains from tomato rhizosphere, including root, shoot and leaf, (2) select and identify the most promising PGPB strains, (3) verify the phytostimulatory activity and mineral uptake potential of selected strains. Bacterial strains isolated from tomato rhizosphere, were screened for phosphorous (P) solubilization, production of indole acetic acid (IAA), amylase activity, antibiotic resistance, and quick test strip (QTS) for biochemical characterization. The tested strains, positive for all five of these assays were selected for molecular identification and subjected to greenhouse growth trails with tomato and mung bean. Two strains were selected and identified as Bacillus cereus (B. cereus) isolated from rhizosphere and Klebsiella variicola (K. variicola) isolated from root endosphere using 16s rRNA sequences. Both strains produced IAA, gibberellic acid (GA3) and kinetin, however B. cereus showed potential GA3 and IAA production as compared to K. variicola. In tomato, only one growth variable (shoot length) was increased over the control by one of the selected bacterial strains (B. cereus). In mung bean, inoculation with either strain B. cereus or K. variicola increased shoot length and dry weight. Moreover, our results showed that the use of PGPB significantly increased plant growth and Fe, Zn, Ca, Mg, Cu, Na and K contents of plants. It seems that evaluated strains had a higher ability in boosting plant growth and higher yield.

Biodegradation of Atrazine by Mixed Bacteria of Klebsiella variicola Strain FH-1 and Arthrobacter sp. NJ-1.

The purpose of this study is to enhance the biodegradability of atrazine with FH-1 and NJ-1 alone by selecting the mixing ratio, optimizing the culture medium and conditions. The results showed that FH-1 and NJ-1 have the best biodegradation effect on atrazine being mixed in a volume ratio of 3:2. In a single factor experiment, sucrose and NH4Cl provided carbon and nitrogen sources for the mixed bacteria. Subsequently, composition of fermentation medium was further optimized using Box-Behnken design of response surface methodology. Based on the results, growth of mixed bacteria and biodegradation of atrazine performed best effects with a biodegradation rate of 85.6% when sucrose and NH4Cl amounts were 35.30 g/L and 10.28 g/L. The optimal medium condition was 10% inoculum of mixed bacteria, with initial atrazine concentration of 50 mg/L, neutral or weakly alkaline pH value, 30°C. The biodegradation rate reached 97.4%, 11.8% higher than the unoptimized condition.

Outbreak of Hypervirulent Multidrug-resistant Klebsiella variicola Causing High Mortality in Neonates in Bangladesh.

We report a clonal outbreak of multidrug-resistant (MDR) Klebsiella variicola (sequence type [ST] 771) in a Bangladeshi neonatal unit from October 2016 to January 2017, associated with high mortality (54.5%). During the outbreak, K. variicola ST771 acquired an MDR plasmid harboring blaNDM-1, linked to high exposure to ceftriaxone and amikacin.