Assembly and comparative analysis of the complete mitochondrial genome of white towel gourd (Luffa cylindrica).

Mitochondria play an important role in the energy production of plant cells through independent genetic systems. This study has aimed to assemble and annotate the functions of the mitochondrial (mt) genome of Luffa cylindrica. The mt genome of L. cylindrica contained two chromosomes with lengths of 380,879 bp and 67,982 bp, respectively. Seventy-seven genes including 39 protein-coding genes, 34 tRNA genes, 3 rRNA genes, and 1 pseudogene, were identified. About 90.63% of the codons ended with A or U bases, and 98.63% of monomers contained A/T, which contributed to the high A/T content (55.91%) of the complete mt genome. Six genes (ATP8, CCMFC, NAD4, RPL10, RPL5 and RPS4) showed positive selection. Phylogenetic analysis indicates that L. cylindrica is closely related to L. acutangula. The present results provide the mt genome of L. cylindrica, which may facilitate possible genetic variation, evolutionary, and molecular breeding studies of L. cylindrica.

Protective effect of Luffa cylindrica Roemer against dexamethasone-induced muscle atrophy in primary rat skeletal muscle cells.

Glucocorticoids (GCs) are commonly used in the treatment of chronic inflammatory conditions. However, the administration of high doses and long-term use of GCs can induce muscle atrophy (MA) in patients, leading to a decline in quality of life and increased mortality. MA leads to protein degradation in skeletal muscle, resulting in a reduction of muscle mass. This process is triggered by GCs like dexamethasone (DEX), which induce the expression of E3 ubiquitin ligases, namely Atrogin-1 and muscle RING-finger protein-1 (MuRF1). In this study, we examined the anti-MA potential of Luffa cylindrica Roemer (LCR) on DEX-treated primary skeletal myotubes. Primary skeletal myotubes stimulated with LCR alone resulted in a significant upregulation of myotube development, characterized by an increase in both the number and diameter of myotubes. Contrastingly, combined treatment with LCR and DEX reduced the expression of Atrogin-1, while treatment with DEX alone induced the expression of MuRF1. Furthermore, LCR treatment successfully restored the number and diameter of myotubes that had been diminished by DEX treatment. These findings suggest that LCR holds potential for treating MA, as an accelerating effect on muscle development and anti-MA effects on primary skeletal muscle cells were observed.

Complete genome sequence of a novel amalgavirus in sponge gourd, Luffa cylindrica.

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.

Removal of Azo Dyes from Water Using Natural Luffa cylindrica as a Non-Conventional Adsorbent.

Reducing high concentrations of pollutants such as heavy metals, pesticides, drugs, and dyes from water is an emerging necessity. We evaluated the use of Luffa cylindrica (Lc) as a natural non-conventional adsorbent to remove azo dye mixture (ADM) from water. The capacity of Lc at three different doses (2.5, 5.0, and 10.0 g/L) was evaluated using three concentrations of azo dyes (0.125, 0.250, and 0.500 g/L). The removal percent (R%), maximum adsorption capacity (Qm), isotherm and kinetics adsorption models, and pH influence were evaluated, and Fourier-transform infrared spectroscopy and scanning electron microscopy were performed. The maximum R% was 70.8% for 10.0 g L-1Lc and 0.125 g L-1 ADM. The Qm of Lc was 161.29 mg g-1. Adsorption by Lc obeys a Langmuir isotherm and occurs through the pseudo-second-order kinetic model. Statistical analysis showed that the adsorbent dose, the azo dye concentration, and contact time significantly influenced R% and the adsorption capacity. These findings indicate that Lc could be used as a natural non-conventional adsorbent to reduce ADM in water, and it has a potential application in the pretreatment of wastewaters.

Ameliorative effect of Luffa cylindrica fruits on Caenorhabditis elegans and cellular models of Alzheimer's disease-related pathology via autophagy induction.

BACKGROUND: Alzheimer's disease (AD) is a prevalent neurodegenerative disorder without an effective cure. Natural products, while showing promise as potential therapeutics for AD, remain underexplored. AIMS: This study was conducted with the goal of identifying potential anti-AD candidates from natural sources using Caenorhabditis elegans (C. elegans) AD-like models and exploring their mechanisms of action. MATERIALS & METHODS: Our laboratory's in-house herbal extract library was utilized to screen for potential anti-AD candidates using the C. elegans AD-like model CL4176. The neuroprotective effects of the candidates were evaluated in multiple C. elegans AD-like models, specifically targeting Aß- and Tau-induced pathology. In vitro validation was conducted using PC-12 cells. To investigate the role of autophagy in mediating the anti-AD effects of the candidates, RNAi bacteria and autophagy inhibitors were employed. RESULTS: The ethanol extract of air-dried fruits of Luffa cylindrica (LCE), a medicine-food homology species, was found to inhibit Aß- and Tau-induced pathology (paralysis, ROS production, neurotoxicity, and Aß and pTau deposition) in C. elegans AD-like models. LCE was non-toxic and enhanced C. elegans' health. It was shown that LCE activates autophagy and its anti-AD efficacy is weakened with the RNAi knockdown of autophagy-related genes. Additionally, LCE induced mTOR-mediated autophagy, reduced the expression of AD-associated proteins, and decreased cell death in PC-12 cells, which was reversed by autophagy inhibitors (bafilomycin A1 and 3-methyladenine). DISCUSSION: LCE, identified from our natural product library, emerged as a valuable autophagy enhancer that effectively protects against neurodegeneration in multiple AD-like models. RNAi knockdown of autophagy-related genes and cotreatment with autophagy inhibitors weakened its anti-AD efficacy, implying a critical role of autophagy in mediating the neuroprotective effects of LCE. CONCLUSION: Our findings highlight the potential of LCE as a functional food or drug for targeting AD pathology and promoting human health.

An in vitro evaluation of luffa cylindrica stem sap in preadipocytes and dermal fibroblasts.

BACKGROUND: Luffa cylindrica stem sap (LuCS) has been ethnopharmacologically used as a cosmetic ingredients to improve the facial condition in Asians, but there is no scientific proof about the advantages of LuCS as a supplement for skin elasticity inducer. PURPOSE: Presently, we have validated the beneficial effect of LuCS in human preadipocyte and fibroblast. METHODS: In vitro activities of LuCS on expression of cellular elastin and collagen type I were validated using Western blot analysis in human fibroblasts. Effect of LuCS on preadipocyte development was performed using MDI medium containing isobutyl-methylxanthine, dexamethasone, and insulin and then evaluated using oil red O staining. RESULTS: Treatment of LuCS stimulated the expression of cellular elastin and type I procollagen in human skin fibroblasts. Exposure to LuCS induced lipid accumulation of preadipocytes via activation of CEBP/α signaling pathway in preadipocytes. Expression of collagen I, elastin, or CEBP/α mRNA was decreased by age. 3-bromo-3-methylisoxazol-5-amine enhanced the synthesis of cellular lipid in preadipocytes. CONCLUSIONS: Collectively, these results suggest the rationale of LuCS treatment in enhancing the skin condition.

Surface magnetization of hydrolyzed Luffa Cylindrica biowaste with cobalt ferrite nanoparticles for facile Ni2+ removal from wastewater.

A novel magnetic adsorbent based on hydrolyzed Luffa Cylindrica (HLC) was synthesized through the chemical co-precipitation technique, and its potential was evaluated in the adsorptive elimination of divalent nickel ions from water medium. Morphological assessment and properties of the adsorbent were performed using FTIR, SEM, EDX, XRD, BET, and TEM techniques. The effect of pH, temperature, time and nickel concentration on the removal efficiency was studied, and pH = 6, room temperature (25 °C), contact time of 60 min, and Ni2+ ion concentration of 10 mg.L-1 were introduced as the optimal values. At optimal conditions, the removal efficiency of Ni2+ ions using HLC and HLC/CoFe2O4 magnetic composite was calculated as 96.38 and 99.13%, respectively. The adsorption process kinetic followed a pseudo-first-order model. Langmuir isotherm was suitable for modelling the experimental data of the Ni2+ adsorption. The maximum elimination capacity of HLC and HLC/CoFe2O4 samples was calculated as 42.75 and 44.42 mg g-1, respectively. Furthermore, thermodynamic investigations proved the spontaneous and exothermic nature of the process. The adsorption efficiency was decreased with increasing the content of Ca2+ and Na + cations in aqueous media. During reusability of the synthesized adsorbents, it was found that after 8 cycles, no significant decrease has occurred in the adsorption efficiency. In addition, real wastewater treatment results proved that HLC/CoFe2O4 magnetic composite has an excellent performance in removal of heavy metals pollutant from shipbuilding effluent.

First Report of Alternaria tenuissima Causing Leaf spot on Luffa cylindrica in China.

In August 2020-2021, symptoms of leaf spot were observed in luffa (Luffa cylindrical) fields in Qingdao city, Shandong Province. In all the 10 fields investigated, leaf spot occurred. The incidence (% luffa plants with symptoms from a defined number of plants assessed) was 35 to 60%. Early symptoms of infected leaves were small and irregular chlorotic lesions which later became irregular brown spots. As the disease progressed, the lesions gradually spread from the edge to the center of leaves to the middle, and became dark brown. The enlarged spots coalesced and eventually led to the withering and death of the leaves. In order to isolate the pathogen, 30 symptomatic leaves were collected from different planting fields. Small pieces of leaf tissues (5×5 mm) were cut from the junction of healthy and diseased tissues, sanitized with 2% NaClO for 1 min, rinsed three times with sterile distilled water. The tissue samples were then placed on potato dextrose agar (PDA) amended with 50 mg/L streptomycin sulfate, and incubated at 28℃ for 5 days in the dark. Ten purified fungal isolates were obtained by single spore isolation method. Colonies of these fungal isolates on the PDA medium were initially grayish-white, and then turned olive green with abundant cotton-like aerial hyphae. On potato carrot agar (PCA) medium, these fungi produced light brown and solitary conidiophore with septum. Conidia were obclavate or ellipsoid, brown, with 1-5 transverse septa and 0-3 longitudinal septa, and measured 13.2 to 49.5 × 9.5 to 21.6 µm (n=50). The morphological characteristics of these isolates were consistent with that of Alternaria spp. (Simmons 2007). The representative isolate NEAU-SG-1 was selected for molecular identification. The internal transcribed spacer (ITS) region of ribosomal DNA, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), translation elongation factor 1-α gene (TEF), histone 3 (HIS3), and RNA polymerase II second largest subunit (RPB2) were amplified using primer pairs ITS1/ITS4 (White et al. 1990), gpd1/gpd2 (Berbee et al. 1999), EF1-728F/EF1-986R (Carbone and Kohn 1999), H3-1a/H3-1b (Glass and Donaldson 1995), and RPB2-5F2/fRPB2-7cR (Sung et al. 2007), respectively. Sequences of these genes of isolate NEAU-SG-1 were deposited into GenBank database with the accession numbers of OL307719, OL415166, OL415169, OL415167, and OL415168. BLAST analysis of these sequences showed 99-100% homology with sequence homology with Alternaria tenuissima strains (ITS, MH824269; GAPDH, MK683783; TEF, MN056178; HIS3, MH824371; RPB2, LC621694). To fulfill Koch's postulates, ten surface disinfected 30-day-old luffa seedlings were inoculated by spraying conidia suspension (106 conidia/ml) of isolate NEAU-SG-1. The other ten surface disinfected seedlings inoculated with sterile distilled water served as the control group. After inoculation, each plant was covered with plastic bags for three days and cultured in greenhouse at 25℃. One week later, leaves inoculated with conidia suspension were observed with the same symptoms as described above, while the leaves of the control group were asymptomatic. Pathogenicity test was repeated twice. The Alternaria isolates were successfully re-isolated from those infected leaves and identified using the morphological and molecular methods described above. A. tenuissima has a wide host range in the world, and is the pathogen of leaf spot of many crops (Ma et al. 2021). To our knowledge, this is the first report of A. tenuissima causing leaf spot on luffa in China. This report will provide basic information for the diagnosis and prevention and control strategies of luffa leaf spot.

Tomato chlorosis virus infecting Luffa cylindrica and Citrullus lanatus in China.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Evaluating the effect of Luffa cylindrica stem sap on dermal fibroblasts; An invitro study.

Luffa cylindrica stem sap (LuCS) has been traditionally used as a facial cosmetic supplement to enhance the skin condition of Asians. However, LuCS has yet to be described and there is no solid scientific evidence regarding the use of LuCS as an anti-wrinkle agent. In the present study, we have evaluated the functional effect of LuCS and its underlying mechanisms based on scientific evidence. Treatment with LuCS stimulated the growth and migration of human skin fibroblasts. LuCS treatment activated EGFR signaling via the enhanced expression of EGFR and down-regulation of PPARγ in human skin fibroblasts. Exposure to LuCS induced the synthesis of cellular type I procollagen and elastin in consort with the down-regulation of various proteinases including MMP-1, -2 and -9 in human skin fibroblasts. LuCS treatment also reversed the skin damage induced by UV-A irradiation in human skin fibroblasts. 3-bromo-3-methylisoxazol-5-amine was identified as the functional component using UPLC-MS-MS analysis and increased production of cellular type I procollagen. Collectively, these results suggest the efficacy of LuCS supplementation in improving the skin condition via anti-wrinkle effect.

Construction of a high-density genetic linkage map and identification of gene controlling resistance to cucumber mosaic virus in Luffa cylindrica (L.) Roem. based on specific length amplified fragment sequencing.

Luffa cylindrica L. is a cash crop which has important health, medicinal and industrial value, but no high saturation genetic map has been constructed owing to a lack of efficient markers. Furthermore, no genes were reportedly responsible for CMV resistance in Luffa spp. Specific length amplified fragment sequencing (SLAF-seq) is a valuable tool for large-scale discovery of markers and genetic mapping. The present study reported the construction of a high-density genetic map and the mapping of CMV resistant genes by using an F2 population of 130 individuals and their two inbred line parents. A total of 271.01 Mb pair-end reads were generated. 100,077 high-quality SLAFs were detected, and 7404 of them were polymorphic. Finally, 3701 of the polymorphic markers were selected for genetic map construction, and 13 linkage groups were generated. The map spanned 1518.56 cM with an average distance of 0.41 cM between adjacent markers. Based on the newly constructed high-density map, one gene located on chromosome 1 (100.072-100.457 cM) was identified to regulate CMV resistance in L. cylindrica. A gag-polypeptide of LTR copia-type retrotransposon was predicted as the candidate gene responsible for CMV resistance in L. cylindrica. The high-density genetic map and the CMV resistant gene mapped and predicted in this study will be useful in future research.

Genetic diversity and population structure detection in sponge gourd (Luffa cylindrica) using ISSR, SCoT and morphological markers.

Investigation of genetic diversity is essential for the selection of parents for crop breeding and conservation of genetic resources. To estimate the genetic variability and population structure in the midst of 45 accessions of sponge gourd brought together from different geographical areas of India, morphological traits and two molecular markers, ISSR and SCoT markers were compared. Principal components analysis of 20 morphological traits showed 72.70% variability and significant positive correlations between fruit traits. All three marker techniques clustered all accessions into two groups with few outgroups. High level of polymorphism was observed among ISSR (74.6%) and SCoT (71.5%) primers. The Bayesian model revealed the hidden grouping and showed admixture type of population. The diversity pattern is influenced by genetic marker used, as different molecular markers have different polymorphism evaluation efficiency. This study can be helpful in amplifying the genetic base and selection of specific traits for breeding. Thus, ISSR and SCoT markers are potential marker for identification in sponge gourd and provide valuable data on its genetic correlation and structure.

Stability of immobilized laccase on Luffa Cylindrica fibers and assessment of synthetic hormone degradation.

In this work were studied the pH, thermal, and storage stability of free and immobilized laccases. Enzymes were produced by Pleurotus ostreatus on potato dextrose (PD) broth and potato dextrose modified (PDM) broth, and immobilized using Luffa cylindrica fibers as support. Both free and immobilized enzymes were assessed on their respective enzymatic activities and for 17α-ethinylestradiol (EE2) degradation. The optimum pH conditions concerning laccase activity ranged from 3.6 to 4.6, while temperature ranged between 30 °C and 50 °C for both free and immobilized enzyme. Laccase produced using PD broth presented greater storage stability and thermal stability than that of PDM. Best EE2 removals were of 79.22% and 75.00% for the free and immobilized enzymes, respectively. Removal rates were assessed during 8 h at pH 5. The removal of 17α-ethinylestradiol was stabilized in the fourth cycle of use. Results imply that immobilization promoted stability towards pH and temperature variations, although media played a decisive role in the enzymatic activity. Both free and immobilized laccases of P. ostreatus were able to degrade EE2, whereas immobilized laccase in PDM medium presented possible reuse applicability, albeit removal was not optimal when compared to other reports.

Chemical Composition of Aqueous Ethanol Extract of Luffa cylindrica Leaves and Its Effect on Representation of Caspase-8, Caspase-3, and the Proliferation Marker Ki67 in Intrinsic Molecular Subtypes of Breast Cancer in Vitro.

Breast cancer constitutes the second most prevalent cancer in Egypt, the problem needs more trends in treatment and treatment development either by regimen modification or introducing new drugs, and the main objective of this study is to screen the effects of the aqueous ethanol herbal extract of Luffa cylindrica leaves on different types of breast cancer cell lines representing different molecular subtypes of the disease. The major active constituents of the extract were tentatively identified by LC/MS which revealed the presence of phenolic compound derivatives and saponin that may be responsible in part for the activity of the extract. The emphasis was laid on the main apoptotic pathways as well as the extract effect on the normal cell line. Results of phytochemical investigation, cell cycle analysis, and molecular analysis of apoptotic and proliferative markers have shown effective anticancer activity against MCF-7, BT-474, and MDA-MB-231 cell lines which represent three subtypes of breast cancer, luminal A, luminal B, and triple negative, respectively. On the other hand, the effects on normal lung fibroblast cell line are less prominent at the dose used for treating breast cancer cell lines.

Variations in the Bioactive Compounds Composition and Biological Activities of Loofah (Luffa cylindrica) Fruits in Relation to Maturation Stages.

The present work aimed to determine the antioxidant and antiproliferative potential of Luffa cylindrica fruits collected at two different maturation stages and to identify and compare their functional components composition. The MeOH extracts of L. cylindrica fruits harvested at 60 - 65 days after seeding (S1) and 85 - 90 days after seeding (S2) were investigated for their antioxidant activity using various assays. Furthermore, the antiproliferative activity of the extracts against HeLa human cervical cancer cells was explored with xCELLigence real time cell analyzer, while the effect of the samples on the membrane integrity of the same cell line was assessed using LDH cytotoxicity leakage assay. Ultimately, the phytochemicals were analyzed using GC/MS and HPLC/TOF-MS. The S1 sample had higher contents and more diversity in the phenolic compounds composition than S2. Furthermore, the S1 extract showed the highest antioxidant and antiproliferative activity, while the S2 extract had higher cytotoxicity towards HeLa cells. The findings revealed that the time of harvest has a big impact on the phytochemicals content and activity and that harvesting L. cylindrica at an early stage before the beginning of the development of the cellulose fibrous system is recommended for a rich phytochemical composition and efficient antioxidant and antiproliferative activities.

Microarray and genetic analysis reveals that csa-miR159b plays a critical role in abscisic acid-mediated heat tolerance in grafted cucumber plants.

Root-shoot communication plays a vital role in plant growth, development and adaptation to environmental stimuli. Grafting-induced stress tolerance is associated with the induction of plentiful stress-related genes and proteins; the mechanism involved, however, remains obscure. Here, we show that the enhanced tolerance against heat stress in cucumber plants with luffa as rootstock was accompanied with an increased accumulation of abscisic acid (ABA), down-regulation of a subset of microRNAs (miRNAs) but up-regulation of their target genes and CsHSP70 accumulation in the shoots. Significantly, luffa rootstock and foliar application of ABA both down-regulated csa-miR159b and up-regulated its target mRNAs CsGAMYB1 and CsMYB29-like and CsHSP70 accumulation in cucumber, while ectopic expression of csa-miR159b led to decreased heat tolerance, AtMYB33 transcript and AtHSP70 accumulation in Arabidopsis plants. Taken together, our results suggest that root-originated signals such as ABA could alter miRNAs in the shoots, which have a major role in the post-transcriptional regulation of the stress-responsive genes.

Genome-wide transcriptome profiling reveals novel insights into Luffa cylindrica browning.

Luffa cylindrica (sponge gourd) is one of the most popular vegetables in China. Production and consumption of L. cylindrica are limited due to postharvest browning; however, little is known about the genetic regulation of the browning process. In the present study, transcriptome profiles of L. cylindrica cultivars, YLB05 (browning resistant) and XTR05 (browning sensitive), were analyzed using next-generation sequencing to clarify the genes and mechanisms associated with browning. A total of 9.1 Gb of valid data including 116,703 unigenes (>200 bp) were obtained and 39,473 sequences were annotated by alignment against five public databases. Of these, there were 27,407 genes assigned to 747 Gene Ontology functional categories; and 12,350 genes were annotated with 25 Eukaryotic Orthologous Groups (KOG) categories with 343 KOG functional terms. Additionally, by searching against the Kyoto Encyclopedia of Genes and Genomes database, 8689 unigenes were mapped to 189 pathways. Furthermore, there were 24,556 sequences found to be differentially regulated, including 4344 annotated unigenes. Several genes potentially associated with phenolic oxidation, carbohydrate and hormone metabolism were found differentially regulated between the cultivars of different browning sensitivities. Our results suggest that elements involved in enzymatic processes and other pathways might be responsible for L. cylindrica browning. The present study provides a comprehensive transcriptome sequence resource, which will facilitate further studies on gene discovery and exploiting the fruit browning mechanism of L. cylindrica.

Exploiting the efficacy of Lysinibacillus sp. RGS for decolorization and detoxification of industrial dyes, textile effluent and bioreactor studies.

Complete decolorization and detoxification of Reactive Orange 4 within 5 h (pH 6.6, at 30°C) by isolated Lysinibacillus sp. RGS was observed. Significant reduction in TOC (93%) and COD (90%) was indicative of conversion of complex dye into simple products, which were identified as naphthalene moieties by various analytical techniques (HPLC, FTIR, and GC-MS). Supplementation of agricultural waste extract considered as better option to make the process cost effective. Oxido-reductive enzymes were found to be involved in the degradation mechanism. Finally Loofa immobilized Lysinibacillus sp. cells in a fixed-bed bioreactor showed significant decolorization with reduction in TOC (51 and 64%) and COD (54 and 66%) for synthetic and textile effluent at 30 and 35 mL h(-1) feeding rate, respectively. The degraded metabolites showed non-toxic nature revealed by phytotoxicity and photosynthetic pigments content study for Sorghum vulgare and Phaseolus mungo. In addition nitrogen fixing and phosphate solubilizing microbes were less affected in treated wastewater and thus the treated effluent can be used for the irrigation purpose. This work could be useful for the development of efficient and ecofriendly technologies to reduce dye content in the wastewater to permissible levels at affordable cost.

Hydrogen peroxide mediates abscisic acid-induced HSP70 accumulation and heat tolerance in grafted cucumber plants.

Root-shoot communications play important roles in plant stress responses. Here, we examined the roles of root-sourced signals in the shoot response to heat in cucumber plants. Cucumber plants grafted onto their own roots and luffa roots were exposed to aerial and root-zone heat to examine their tolerance by assessing the levels of oxidative stress, PSII photoinhibition, accumulation of abscisic acid (ABA), H2 O2 and heat shock protein (HSP) 70 using immunoblotting, chlorophyll fluorescence, immunoassay, CeCl3 staining and Western blotting, respectively. Grafting onto the luffa rootstock enhanced the shoot tolerance to the heat. This enhanced tolerance was associated with increased accumulation of ABA and apoplastic H2 O2 , RBOH transcripts and HSP70 expression and a decrease in oxidative stress in the shoots. The increases in the ABA and H2 O2 concentrations in the shoots were attributed to an increase in ABA transport from roots and an increase in ABA biosynthesis in the shoots when the root-zone and shoots were heat stressed, respectively. Inhibition of H2 O2 accumulation compromised luffa rootstock-induced HSP70 expression and heat tolerance. These results suggest that, under heat stress, ABA triggers the expression of HSP70 in an apoplastic H2 O2 -dependent manner, implicating the role of an ABA-dependent H2 O2 -driven mechanism in a systemic response involving root-shoot communication.