POTEE mutation as a potential predictive biomarker for immune checkpoint inhibitors in lung adenocarcinoma.

Precise selection of patients who could benefit from immune checkpoint inhibitors (ICIs) is an important challenge for immunotherapy in lung cancer. POTEE (POTE Ankyrin Domain Family Member E) is a member of one primate-specific gene family which have been identified as cancer-related antigens and potential target for immunotherapy of cancer. Here, we investigated the correlation between POTEE mutation and the clinical outcome of ICIs treatment in non-small cell lung cancer (NSCLC). We merged three NSCLC cohorts (n = 165) to assess predictive value of POTEE mutation of immunotherapy efficacy in NSCLC. The prognostic analysis and the potential molecular mechanism exploration were conducted based on the data from The Cancer Genome Atlas (TCGA) database. In the merged cohort, patients with POTEE-mutation (POTEE-Mut) had a significantly higher objective response rate (ORR) (100% vs 27.7%; P < 0.001) and longer progression-free survival (PFS) (P = 0.001; HR 0.08; 95% CI 0.01 - 0.54) compared to patients with POTEE wild-type (POTEE-WT) in NSCLC. Also, patients with POTEE-Mut showed higher ORR (100% vs 27.2%; P < 0.001) and longer PFS (P = 0.001; HR 0.07; 95% CI 0.01 - 0.52) in lung adenocarcinoma (LUAD). POTEE mutation was significantly associated with higher tumor mutational burden (TMB) and higher neoantigen load (NAL), but not with PD-L1 expression in LUAD. Gene set enrichment analyses (GSEA) analysis revealed prominent enrichment of signatures related to DNA repair in POTEE-Mut group (P < 0.001) in LUAD. Our results indicate that POTEE mutation could serve as a potential predictive biomarker for ICIs in LUAD. However, prospective cohort studies are still needed for further validation.

POTEE promotes colorectal carcinoma progression via activating the Rac1/Cdc42 pathway.

Current studies have shown that POTE ankyrin domain family members have high expressions as tumor antigens in malignant tumors, such as prostate cancer, ovarian cancer, breast cancer and the like. POTEE is a member of the POTE anchor protein family E. However, its role in colorectal carcinoma (CRC) has not been studied. In this study, the function of POTEE in CRC was examined for the first time and its correlation with CRC cell biological behaviors was analyzed. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blotting, and immunohistochemistry revealed that POTEE was remarkably overexpressed in CRC and associated with an aggressive phenotype. We also found that POTEE was localized in the cytoplasm. In addition, downregulation of POTEE expression can notably inhibit the proliferation, migration, and invasion of CRC cell in vitro, and repressed tumor growth and metastasis in vivo. In contrast, overexpression of POTEE could promote the aggressive behaviors of CRC cells. Mechanistically, POTEE promoted CRC migration, invasion and epithelial-mesenchymal transition (EMT) by increasing the activation of Rac1 and Cdc42. To summarize, these results suggested that POTEE might serve as an oncogene for CRC tumorigenesis and progression, and may become a novel molecular marker for clinical diagnosis and treatment.

Identification of MΦ specific POTEE expression: Its role in mTORC2 activation via protein-protein interaction in TAMs.

POTE is known as cancer antigen, expressed in many cancers, along with very few normal tissues like prostate, ovary, testes and embryo. Till date, POTEE identified as majorly expressed POTE paralog. Functionally, POTEF regulates TLR signaling which play important role in innate immunity provided clue about expression of POTE in immune cells. We have chosen three Thp1monocytes, Jurkat T1 and MΦ cells as a model. Here, first time we report expression of POTEE in immune cells specifically only in MΦ but not in monocytes or T-cells. In addition, expression level remains unaltered in MΦ subtypes M1 and M2 and MΦ subjected to various stresses, except MΦs treated with Hyp-CM where MΦs acquires properties of TAMs. In TAMs, POTEE was involved differential protein-protein interaction with mTOR, RICTOR, and Rad51 indicating its biological role in cell invasion through mTORC2 activation. siRNA mediated knockdown of POTEE suggests its importance in cell survival of MΦs as well as TAMs.

POTEE promotes breast cancer cell malignancy by inducing invadopodia formation through the activation of SUMOylated Rac1.

The small GTPase Rac1 (Ras-related C3 botulinum toxin substrate 1) has been implicated in cancer progression and in the poor prognosis of various types of tumors. Rac1 SUMOylation occurs during epithelial-mesenchymal transition (EMT), and it is required for tumor cell migration and invasion. Here we identify POTEE (POTE Ankyrin domain family member E) as a novel Rac1-SUMO1 effector involved in breast cancer malignancy that controls invadopodium formation through the activation of Rac1-SUMO1. POTEE activates Rac1 in the invadopodium by recruiting TRIO-GEF (triple functional domain protein), and it induces tumor cell proliferation and metastasis in vitro and in vivo. We found that the co-localization of POTEE with Rac1 is correlated with more aggressive breast cancer subtypes. Given its role in tumor dissemination, the leading cause of cancer-related deaths, POTEE could represent a potential therapeutic target for these types of cancer.

Phytochemicals from Ayurvedic plants as potential medicaments for ovarian cancer: an in silico analysis.

Ovarian cancer is one of the highly prominent gynecological malignancies after breast cancer. Although myriad literature is available, there is no specific biomarker available for the personalized treatment strategy. The unavailability of effective drug therapy for ovarian cancer calls for an urgent push in its development from the multidisciplinary scientific community. Indian Ayurvedic medicine pharmacology is widely appreciated and accepted for its immense healthcare benefits. Bioinformatics and cheminformatics approaches can be effectively used to screen phytochemicals present in the Indian Ayurvedic plants against ovarian cancer target receptors. Recent studies discern that POTE, a cancer-testis antigen (CTA) family, plays a crucial role in the proliferation and progression of cancers including ovarian cancer. Specifically, POTEE paralog has been observed to be hypermethylated in ovarian cancer. This study undertakes an in silico analysis of Indian Ayurvedic plants for their anticancer efficacy against ovarian cancer proliferation target receptor POTEE. Structures of 100 phytochemicals from 11 Ayurvedic plants were screened with ADME criteria, and qualified phytochemicals were subjected to molecular docking and interaction analysis. Only 6 phytochemicals having a high affinity to the target receptor (POTEE) were then subjected to an all-atom replica exchange molecular dynamics simulation for 50 ns. Binding affinities of 6 phytochemicals cedeodarin, deodarin, hematoxylin, matairesinol, quercetin, and taxifolin with POTEE were -8.1, -7.7, -7.7, -7.9, -8.0, and - 7.7 kcal/mol, respectively, and their RMSD were recorded as zero. This study concludes that phytochemicals present in Indian Ayurvedic plants namely Cedrus deodara and Asparagus racemosus possess inhibitory effects against ovarian cancer proliferation receptor POTEE.

In silico approach to understand epigenetics of POTEE in ovarian cancer.

Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.

POTEE stimulates the proliferation of pancreatic cancer by activating the PI3K/Akt/GSK-3ß/ß-catenin signaling.

To explore the role of POTEE in the malignant development of pancreatic cancer and the possible mechanism. POTEE levels in pancreatic cancer samples were detected. The relationship between POTEE level and clinical data of pancreatic cancer patients was analyzed. After knockdown of POTEE or treatment of the GSK-3ß inhibitor, proliferative change in pancreatic cancer cells was assessed. Protein levels of vital genes in the PI3K/Akt/GSK-3ß/ß-catenin signaling influenced by POTEE were examined. POTEE was upregulated in pancreatic cancer samples. High level of POTEE indicated advanced tumor staging, large tumor size, and poor prognosis in pancreatic cancer patients. Knockdown of POTEE or treatment of Tideglusib remarkably attenuated proliferative ability in pancreatic cancer cells. Vital genes in the PI3K/Akt/GSK-3ß/ß-catenin signaling were downregulated by knockdown of POTEE. POTEE stimulates the proliferative ability in pancreatic cancer by activating the PI3K/Akt/GSK-3ß/ß-catenin signaling. High level of POTEE indicates advanced tumor staging, large tumor size and poor prognosis in pancreatic cancer patients.

HIV-1 Nef-POTEE; A novel interaction modulates macrophage dissemination via mTORC2 signaling pathway.

AIMS: Human immunodeficiency virus -1 [HIV-1] Nef, localizes in different cellular compartments and modulates several cellular pathways. Nef promotes virus pathogenicity through alteration in cell surface receptor expression, apoptosis, protein trafficking etc. Nef regulates viral pathogenesis through interaction with different host proteins. Thus, molecular mechanisms of pathogenesis could be deciphered by identifying novel Nef interacting proteins. MAIN METHODS: HIV-1 Nef interacting proteins were identified by pull down assay and MALDI-TOF analysis. The interaction was further validated through mammalian two hybrid assay. Functional role of this interaction was identified by immunoprecipitation assay, cell invasion and cell migration studies. Fold Change in mRNA levels of CD163, CD206, CCL17 and CCL18 was analyzed using qPCR. KEY FINDINGS: In current study, C. elegans protein ACT4C and its human homolog POTEE was identified to be interacting with Nef. This interaction activates mTORC2 complex, which in-turn activates AKT and PKC-α. The activation of mTORC2 complex was found to be initiated by the interaction of Nef, mTORC2, Rictor to POTEE. The cellular phenotype and functions affected by Nef-POTEE interaction resulted in significant increase in cell invasion and migration of macrophages (MΦ). SIGNIFICANCE: MΦ is primary target of HIV-1 infection where HIV-1 replicates and polarizes immunosuppressive M2 phenotype. Combine effect of M2 phenotype and Viral-host protein interactions compromise the MΦ associated physiological functions. Infected MΦ dissemination into other system also leads to HIV-1 induced malignancies. Therefore, targeting POTEE-Nef interaction can lead to formulating better therapeutic strategy against HIV-1.