Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 88
Filtrar
1.
Plant Dis ; 2024 Jan 24.
Artigo em Inglês | MEDLINE | ID: mdl-38268168

RESUMO

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

2.
Plant Dis ; 2024 Jan 08.
Artigo em Inglês | MEDLINE | ID: mdl-38190365

RESUMO

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

3.
Plant Dis ; 2023 Jan 23.
Artigo em Inglês | MEDLINE | ID: mdl-36691276

RESUMO

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

4.
Angew Chem Int Ed Engl ; 62(47): e202312599, 2023 Nov 20.
Artigo em Inglês | MEDLINE | ID: mdl-37821726

RESUMO

Cephalotaxus diterpenoids are attractive natural products with intriguing molecular frameworks and promising biological features. As a structurally unusual member, (-)-cephalotanin B possesses an extraordinarily congested heptacyclic skeleton, three lactone units, and nine consecutive stereocenters. Herein, we report an enantioselective total synthesis of (-)-cephalotanin B based on a divergent asymmetric Michael addition reaction, a novel Pauson-Khand/deacyloxylation process discovered in the development of a second-generation stereoselective Pauson-Khand reaction protocol, and an epoxide-opening/elimination/dual-lactonization cascade to construct the challenging propeller-shaped A-B-C ring system as key transformations.

5.
Plant Dis ; 2022 Apr 22.
Artigo em Inglês | MEDLINE | ID: mdl-35452253

RESUMO

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

6.
Foodborne Pathog Dis ; 19(5): 304-310, 2022 05.
Artigo em Inglês | MEDLINE | ID: mdl-35447050

RESUMO

This study aimed to investigate the prevalence of Cronobacter sakazakii in goat milk-based infant formula (GIF) collected from Shaanxi Province, China, and reveal the molecular characterization and antibiotic resistance profile of these isolates. A total of 750 GIF samples were collected from the retail markets in 5 cities in Shaanxi Province from February 2019 to February 2021. Molecular characterization was investigated using multilocus sequence typing and O-antigen serotyping. Antibiotic resistance of C. sakazakii isolates was assessed using antimicrobial susceptibility testing. Thirty-two strains of C. sakazakii were isolated from GIF samples with a prevalence rate of 4.27% and were divided into 16 sequence types (STs); among them, ST4 (6/32, 18.75%) and ST21 (5/32, 15.63%) were dominant. Five C. sakazakii serotypes (O2, O1, O7, O4, and O3) were detected, and C. sakazakii serotype O2 (15/32, 46.88%) was the main. Of the 21 antimicrobials, isolates showed higher resistance against cephalothin (87.5%), amoxicillin (25%), azithromycin (18.75%), oxytetracycline (18.75%), ampicillin (12.5%), and streptomycin (12.5%). In addition, three isolates were found to be resistant to three antimicrobials. These findings revealed the potential epidemiological risk and characterization of C. sakazakii in GIF from Shaanxi Province, China, and provided reference data for the effective prevention and control of C. sakazakii in powdered infant formula.


Assuntos
Cronobacter sakazakii , Cronobacter , Animais , China/epidemiologia , Resistência Microbiana a Medicamentos , Microbiologia de Alimentos , Cabras , Humanos , Lactente , Fórmulas Infantis , Leite
7.
Ann Hum Biol ; 49(7-8): 361-366, 2022 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-36437608

RESUMO

BACKGROUND: The analysis of Y chromosomal genetic markers is of great significance in human genetic fields related to male individuals. The Han nationality is the most populous ethnic group. It is critical to investigate the Y-chromosome short tandem repeat (Y-STR) genetic informativeness of Han nationalities in different Chinese regions in order to gain a comprehensive understanding of their paternal genetic relationships and origin. AIM: To assess the allelic and haplotypic polymorphisms of the novel AGCU Y SUPP STR amplification system containing seven Y-STRs in the maximal dataset of the Y-STR Haplotype Reference Database (YHRD) and 17 newly included Y-STRs, and explore the genetic relationships among the Shaanxi Han population and 12 reference populations from China. SUBJECTS AND METHODS: A total sample of 220 Han male subjects were obtained from the Shaanxi Province, China, and genotyped by the novel AGCU Y SUPP STR amplification system. Multiplex population genetic analyses derived from the same 16 Y-STR loci were carried out among the Shaanxi Han population and 12 reference populations from China. RESULTS: The gene diversities (GD) ranged from the maximum value of 0.9609 (DYS385a,b) to the minimum value of 0.5441 (DYS531). Besides, 217 distinct haplotypes were detected wholly in 220 individuals, of which 214 (98.62%) were exclusive. The entire haplotype diversity (HD) and discrimination capacity (DC) were 0.9999 and 0.9864, respectively, while the haplotype match probability (HMP) was 0.0045. Among the reference populations, the obtained results of population genetic analyses revealed that the Shaanxi Han population had the largest genetic distance with the Guangxi Yao group, but the smallest genetic distance with the Hunan Tujia group. CONCLUSIONS: These Y-STR loci in the AGCU Y SUPP STR amplification system were of high genetic polymorphisms and the amplification system could be used as a prospective complementary tool for forensic application and paternal genetics in the Shaanxi Han population.


Assuntos
Cromossomos Humanos Y , População do Leste Asiático , Genética Populacional , Humanos , Masculino , China , Cromossomos Humanos Y/genética , População do Leste Asiático/genética , Haplótipos , Repetições de Microssatélites , Polimorfismo Genético , Estudos Prospectivos
8.
Zhongguo Yi Xue Ke Xue Yuan Xue Bao ; 44(6): 933-940, 2022 Dec.
Artigo em Chinês | MEDLINE | ID: mdl-36621782

RESUMO

Objective To evaluate the genetic polymorphisms and forensic efficiencies of 35 deletion/insertion polymorphism(DIP)loci and explore the genetic structure of the Han population in Shaanxi province.Methods Blood samples of 305 unrelated healthy individuals of the Han population in Shaanxi province were collected.And the allelic frequencies and forensic parameters of 35 DIP loci were calculated and analyzed based on their genotyping results by a self-developed amplification system.The genetic relationship of the Han population in Shaanxi province with the reference populations was explored by molecular variance analyses,phylogenetic tree reconstruction,multidimensional scale analyses,principal component analyses,and STRUCTURE analyses.Results The combined power of discrimination and probability of exclusion of the 35 DIP loci in the Han population in Shaanxi province were 0.999 999 999 999 991 119 and 0.9991,respectively.Population genetic analyses indicated that the Han population in Shaanxi province shared relatively closer genetic relationships with those in other regions of China.Conclusions The 35 DIP loci possessed high polymorphisms and could be used as an effective tool for forensic identification of individuals of the Han population in Shaanxi province.Furthermore,the 35 DIP loci could provide basic data for the genetic analysis of the Han population in Shaanxi province.


Assuntos
Loci Gênicos , Genética Populacional , Humanos , China , Frequência do Gene , Filogenia , Polimorfismo Genético , Mutação INDEL
9.
Int J Legal Med ; 135(4): 1359-1367, 2021 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-33907868

RESUMO

Most of insertion/deletion polymorphisms are diallelic molecular markers characterized as small amplicon sizes, high inter-population diversities, and low mutation rates, which make them the promising genetic markers in biogeographic ancestor inference field. The developmental validations of a 39 ancestry informative marker-insertion/deletion (AIM-InDel) panel and the genetic polymorphic investigations of this panel were performed in the Shaanxi Han population of China. The developmental validation included the optimizations of PCR-related indicators, repeatability, reproducibility, precision, accuracy, sensitivity, species specificity, stability of the panel, and the abilities in analyzing degraded, casework, and mixture samples, and the present results demonstrated that this 39 AIM-InDel panel was robust, sensitive, and accurate. For the population diversity analyses, the combined discrimination power value of 38 AIM-InDel loci except for rs36038238 locus was 0.999999999931257, indicating that this novel panel was highly polymorphic, biogeographic informative, and could be also used in individual identifications in the Shaanxi Han population.


Assuntos
Povo Asiático/genética , Genética Forense/instrumentação , Análise de Sequência de DNA/métodos , China/etnologia , Marcadores Genéticos , Humanos , Mutação INDEL , Linhagem , Polimorfismo Genético , Reprodutibilidade dos Testes , Especificidade da Espécie
10.
Genomics ; 112(6): 3837-3845, 2020 11.
Artigo em Inglês | MEDLINE | ID: mdl-32574833

RESUMO

The genetic polymorphisms of diallelic deletion/insertion polymorphic (DIP) loci in the Shaanxi Han population are still not clearly characterized. Herein, allele frequencies and forensic application efficiencies for 30 diallelic DIP loci were investigated in 506 unrelated healthy Han individuals from Chinese Shaanxi province. Based on population data of the same 30 diallelic DIP loci, the genetic differentiations, hierarchical clustering relationships and population architectures among Shaanxi Han and other 50 populations were further dissected through genetic and bioinformatics analyses. Results indicated that most of the 30 diallelic DIP loci were relatively high polymorphisms in the Shaanxi Han population; and there were the genetically intimate relationships between Shaanxi Han and the East Asian populations. In summary, this study provided significant insights into genetic background of Shaanxi Han population, and the multiplex amplification of these 30 diallelic DIP loci was appropriate for forensic individual identification and population genetic research in Shaanxi Han population.


Assuntos
Alelos , Etnicidade/genética , Genética Forense , Genética Populacional , Mutação INDEL , Polimorfismo Genético , China , Humanos , Reação em Cadeia da Polimerase Multiplex
11.
Electrophoresis ; 41(13-14): 1230-1237, 2020 07.
Artigo em Inglês | MEDLINE | ID: mdl-32329071

RESUMO

Compound marker consists of two different types of genetic markers, like deletion/insertion polymorphism and single nucleotide polymorphism in the genomic region of 200 bp, and microhaplotype consists of a series of closely linked single nucleotide polymorphisms in a small DNA segment (<300 bp), which show great potential for human identifications and mixture analyses. In this study, we initially selected 23 novel genetic markers comprising 10 microhaplotypes and 13 compound markers according to previously reported single nucleotide polymorphism or deletion/insertion polymorphism loci. Genetic distributions of these 23 loci in different continental populations showed that they could be used as valuable loci for forensic human identification purpose. Besides, high informativeness values (>0.1) were observed in six loci which could be further employed for forensic ancestry analyses. Finally, 18 loci were successfully developed into a multiplex panel and detected by the next generation sequencing (NGS) technology. Further analyses of these 18 loci in the studied Shaanxi Han population showed that 15 loci exhibited relatively high expected heterozygosities (>0.5). Cumulative power of discrimination (0.999 999 999 99 4835) of these 18 loci revealed that the multiplex panel could also be utilized for human identifications in the studied Shaanxi Han population.


Assuntos
Povo Asiático/genética , Marcadores Genéticos/genética , Haplótipos/genética , Sequenciamento de Nucleotídeos em Larga Escala/métodos , China , Humanos , Polimorfismo de Nucleotídeo Único/genética
12.
Biochem Genet ; 58(2): 279-293, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-31696339

RESUMO

Mitochondrial DNA (mtDNA) has been widely employed as one tool for the studies of human migration and phylogenetic evolution owing to the characteristics of its lack of recombination and matrilineal inheritance. In this study, we analyze genetic distributions of 60 mtDNA markers in 126 unrelated individuals of Southern Shaanxi Han population and classify their haplogroups. Genetic distribution comparisons between Southern Shaanxi Han and other populations from different continents are conducted based on the same mtDNA markers. The majority of 60 mtDNA markers are polymorphic in Southern Shaanxi Han population. The most common haplogroups observed in Southern Shaanxi Han population are B5, followed by D5, A, D4e, and N9a1'3. Obtained matching probability for these 60 mtDNA markers indicates that the panel could be used as a valuable tool in forensic caseworks. Results of genetic distances (Fst) and multidimensional scaling analysis show that Southern Shaanxi Han population has relatively close genetic relationships with other Han populations in different regions. In conclusion, the panel comprising 60 mtDNA markers could be utilized for forensic applications in Southern Shaanxi Han population.


Assuntos
Povo Asiático/genética , DNA Mitocondrial/genética , Marcadores Genéticos , China , Variação Genética , Haplótipos , Humanos , Filogeografia
13.
Parasitol Res ; 119(9): 3075-3081, 2020 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-32656656

RESUMO

Balantioides coli (syn. Balantidium coli) is an important zoonotic but usually neglected protozoa infecting human and a great number of animals, and the pig was considered to be the most important natural host and reservoir. However, no information about the infection of B. coli in pigs in northwestern China was available. In the present study, the prevalence and genetic diversity of B. coli in pigs in Shaanxi province were investigated. A total of 560 fecal samples were collected from pigs of four age groups in five different geographical regions and analyzed by using PCR targeting the ITS1-5.8S rRNA-ITS2 gene fragment. The infection of B. coli was detected in all age groups and regions, with the total prevalence of 16.8% (94/560). Significant differences (P < 0.01) in prevalence were found among four investigated age groups, with the highest in fatteners (38.8%) and the lowest in adults (5.7%). The prevalence was also significantly (P < 0.01) different among pigs from five sampling regions. Sequence analysis revealed two genetic variants, namely, A and B, in these investigated pigs, and both of them were detected in all age groups and regions, with the latter as the predominant one. Further, sixty-eight different haplotypes were found, with 19 and 49 belonged to genetic variants A and B, respectively. The findings in the present study indicated wide distribution and high diversity of B. coli in pigs in Shaanxi province and provided fundamental data for implementing control strategies on B. coli infection in pigs as well as other hosts in this province.


Assuntos
Infecções por Cilióforos/veterinária , Doenças dos Suínos/parasitologia , Trichostomatida/genética , Animais , China/epidemiologia , Infecções por Cilióforos/epidemiologia , Infecções por Cilióforos/parasitologia , Fezes/parasitologia , Prevalência , Suínos , Doenças dos Suínos/epidemiologia , Trichostomatida/classificação , Trichostomatida/isolamento & purificação
14.
BMC Pregnancy Childbirth ; 19(1): 326, 2019 Sep 04.
Artigo em Inglês | MEDLINE | ID: mdl-31484502

RESUMO

BACKGROUND: Identifying and understanding the knowledge, attitude and practice (KAP) level of women at the periconceptional period has implications for formulating and measuring the adverse pregnancy outcomes for primary prevention. METHODS: A cross-sectional study among pregestational and pregnant women was conducted in Shaanxi during 2016-2017. RESULTS: Among 791 participants, the average score of periconceptional healthcare knowledge awareness was 6.32 ± 1.78, whereas 28.8% of women have failed. Women who planned to or had undergone premarital and pre-pregnancy examinations accounted for 50.2, and 62.5%, respectively. Less than half (42.0%) of the women started taking folic acid (FA) before pregnancy, and only 37.9% of them took FA regularly at the right time. Multivariate analysis showed that age was the main factor influencing the Attitude and Practice level of women at the periconceptional period, and demonstrated a positive effect on the awareness of right timing of folic acid supplementation, and high rates of premarital and pre-pregnancy examinations. Also, the knowledge pass rate was increased with education level. Fewer women who have birth experience were willing to take FA consistently at the right time compared to those women without birth. CONCLUSIONS: The women at the periconceptional period in Shaanxi lacked the total KAP level of periconceptional healthcare, especially those who live in rural areas and have less education. Government agencies should reinforce more effective primary preventive measures and policies for the prevention of adverse pregnancy outcomes.


Assuntos
Conhecimentos, Atitudes e Prática em Saúde , Cuidado Pré-Concepcional , Gestantes , Cuidado Pré-Natal , Prevenção Primária , Adulto , China , Anormalidades Congênitas , Estudos Transversais , Escolaridade , Feminino , Ácido Fólico/uso terapêutico , Humanos , Hipertensão Induzida pela Gravidez , Recém-Nascido , Pessoa de Meia-Idade , Triagem Neonatal , Defeitos do Tubo Neural/prevenção & controle , Gravidez , Complicações Cardiovasculares na Gravidez , Complicações Infecciosas na Gravidez , Resultado da Gravidez , População Rural , Sepse , Hemorragia Uterina , Complexo Vitamínico B/uso terapêutico , Adulto Jovem
15.
Environ Monit Assess ; 191(2): 102, 2019 Jan 26.
Artigo em Inglês | MEDLINE | ID: mdl-30685817

RESUMO

Managing and disposing of sewage sludge have been a severe environmental challenge around the world. China produces hundreds of million tons of sewage sludge annually, and a better understanding of the extent and risk of the associated pollution is of critical importance for implementing environmentally safe regulations and practices. The present study examined the quantity, composition, source, and risk of polycyclic aromatic hydrocarbons (PAHs) in sewage sludge from 18 wastewater treatment plants (WWTPs) in Shaanxi, one of China's top coal-producing provinces. The total concentrations of 16 PAHs varied from 778 to 3264 ng/g dry weight, which is below the upper safety limit (5000 ng/g dry weight) set for the disposal of sludge from municipal wastewater treatment plants for agricultural use in China. However, the concentration of individual PAH compound exceeded the acceptable level prescribed by the Netherland Soil Standard. Three-ring PAHs were the most abundant constituent (50% of total PAHs on average), followed by four-ring PAHs averaging 25%. Relative to sludge PAHs in the same region a decade ago, the total concentrations decreased by more than 27% and the composition shifted to a more pronounced dominance by low molecular weight compounds. This compositional shift suggests higher contributions of petrogenic sources, which may reflect China's increasing consumption of petroleum products over the past decade. The flux of sludge PAHs from each WWTP was positively correlated with the corresponding city's GDP and population, and the total flux amounted to over 100 kg each year for WWTPs in the Xi'an city. The mean toxicity equivalent quantity (TEQ) value was more than twice higher than the value recommended by the Netherlands Soil Standard, and seven carcinogenic PAHs were the primary contributor (i.e., 89-99%) of the TEQ. Collectively, our findings demonstrate that sewage sludge PAHs in Shaanxi constitute a significant source of environmental pollution and toxicity, which cautions against the direct discharge and reuse of sewage sludge and further highlights challenges in managing and disposing of the vast quantities of sewage sludge in China.


Assuntos
Monitoramento Ambiental , Hidrocarbonetos Policíclicos Aromáticos/análise , Eliminação de Resíduos Líquidos , Águas Residuárias/análise , Poluentes Químicos da Água/análise , Animais , China , Humanos , Hidrocarbonetos Policíclicos Aromáticos/toxicidade , Medição de Risco , Poluentes Químicos da Água/toxicidade
16.
Emerg Infect Dis ; 24(6): 1095-1098, 2018 06.
Artigo em Inglês | MEDLINE | ID: mdl-29619922

RESUMO

We report infection of humans with highly pathogenic avian influenza A(H7N9) virus in Shaanxi, China, in May 2017. We obtained complete genomes for samples from 5 patients and from live poultry markets or farms in 4 cities. Results indicate that H7N9 is spreading westward from southern and eastern China.


Assuntos
Subtipo H7N9 do Vírus da Influenza A , Influenza Humana/epidemiologia , Influenza Humana/virologia , Animais , China/epidemiologia , Genes Virais , Humanos , Subtipo H7N9 do Vírus da Influenza A/patogenicidade , Influenza Humana/transmissão , Filogenia , RNA Viral
17.
J Med Virol ; 89(9): 1511-1519, 2017 09.
Artigo em Inglês | MEDLINE | ID: mdl-28112421

RESUMO

To explore the epidemiological, phylogeographic, and migration characteristics of human rabies in Shaanxi province, China from 2009 to 2015. The collected data were described and the sequenced glycoprotein (G) and nucleoprotein (N) genes were implemented to estimate the evolutionary rates and phylogeographic patterns using BEAST v.1.8.2. A total of 269 rabies cases were reported and 70.26% of the cases were male and 61.71% were between the ages of 19-59. The majority of the cases were farmers (83.27%). The estimated evolutionary rate of the N genes was 2.4 × 10-4 substitutions/site/year and the G genes was 3.4 × 10-4 . The time of the most recent common ancestor (TMRCA) was estimated around 1990. We detected viral migration paths from Sichuan, Guizhou, and Hunan to Hanzhong prefecture of Shaanxi and then spreaded to Xi'an and other prefectures. The main population affected by rabies virus was male adult farmers. The evolution rate of rabies viruses in Shaanxi was similar with the prior results reported by others and the ancestor virus should be circulating in neighboring province Sichuan around 1990 and then transmitted to Shaanxi. Promptly standard wound treatment and timely post-exposure prophylaxis should be compulsory for the dog-bitten victims.


Assuntos
Doenças Transmissíveis Emergentes/epidemiologia , Doenças Transmissíveis Emergentes/virologia , Filogeografia , Vírus da Raiva/classificação , Raiva/epidemiologia , Raiva/virologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Animais , Antígenos Virais/genética , Criança , Pré-Escolar , China/epidemiologia , Cães , Evolução Molecular , Feminino , Glicoproteínas/genética , Humanos , Lactente , Masculino , Pessoa de Meia-Idade , Taxa de Mutação , Proteínas do Nucleocapsídeo/genética , Exposição Ocupacional , Vírus da Raiva/genética , Vírus da Raiva/isolamento & purificação , Análise de Sequência de DNA , Proteínas do Envelope Viral/genética , Adulto Jovem
18.
Parasitol Res ; 115(3): 1355-61, 2016 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-26782809

RESUMO

Giardia duodenalis and Enterocytozoon bieneusi are two common protozoa that parasitize the intestinal epithelium of animals and humans. Calves have been identified as important reservoirs of these two pathogens, but limited data is available for these two pathogens in calves in China. In the present study, the prevalence and assemblages/genotypes of both parasites in calves of dairy and native beef (Qinchuan) cattle in Shaanxi province, northwestern China, were analyzed using multilocus genotyping (MLST). Of 371 fecal samples collected from calves (including 198 dairy calves and 173 Qinchuan calves), the respective overall prevalence of G. duodenalis and E. bieneusi was 18.87 (70 of 371) and 19.68 % (73 of 371). Both the zoonotic G. duodenalis assemblage A and animal adapted assemblage E were found in dairy and Qinchuan calves. Seventeen, eight, five, and two G. duodenalis subtypes were detected at the triose phosphate isomerase (tpi), ß-giardin (bg), glutamate dehydrogenase (gdh), and small subunit ribosomal RNA (SSU-rRNA) loci, with five and two novel subtypes detected at the tpi and bg loci, forming 25 multiple genotypes (MLGs) (15 and 11 in dairy and Qinchuan calves, respectively). Of 73 samples that were positive for E. bieneusi at the ribosomal RNA internal transcribed spacer (ITS) locus, five ITS genotypes were found, including three known zoonotic genotypes (I, J, CHN1) and two novel genotypes (CSX1 and CSX2). MLST analysis of three microsatellite loci (MS1, MS3, MS7) and one minisatellite locus (MS4) detected six, two, two, and two genotypes at the MS1, MS3, MS4, and MS7 loci, respectively, forming ten MLGs (seven and four in dairy and Qinchuan calves, respectively). These results indicate complex population structures of G. duodenalis and E. bieneusi in calves in Shaanxi province and the zoonotic potential of these two pathogens in calves in this province.


Assuntos
Doenças dos Bovinos/parasitologia , Enterocytozoon/genética , Giardia lamblia/genética , Giardíase/veterinária , Animais , Bovinos , Doenças dos Bovinos/epidemiologia , China/epidemiologia , DNA de Protozoário/genética , Fezes/parasitologia , Genótipo , Giardíase/parasitologia , Humanos , Repetições de Microssatélites , Tipagem de Sequências Multilocus , Triose-Fosfato Isomerase/genética
19.
Korean J Parasitol ; 53(1): 113-7, 2015 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-25748718

RESUMO

Cryptosporidium spp., ubiquitous enteric parasitic protozoa of vertebrates, recently emerged as an important cause of economic loss and zoonosis. The present study aimed to determine the distribution and species of Cryptosporidium in post-weaned and adult pigs in Shaanxi province, northwestern China. A total of 1,337 fresh fecal samples of post-weaned and adult pigs were collected by sterile disposable gloves from 8 areas of Shaanxi province. The samples were examined by Sheather's sugar flotation technique and microscopy at × 400 magnification for Cryptosporidium infection, and the species in positive samples was further identified by PCR amplification of the small subunit (SSU) rRNA gene. A total of 44 fecal samples were successfully amplified by the nested PCR of the partial SSU rRNA, with overall prevalence of 3.3%. The average prevalence of Cryptosporidium infection in each pig farms ranged from 0 to 14.4%. Species identification by sequencing of SSU rRNA gene revealed that 42 (3.1%) samples were Cryptosporidium suis and 2 (0.15%) were Cryptosporidium scrofarum. C. suis had the highest prevalence (7.5%) in growers and the lowest in breeding pigs (0.97%). C. suis was the predominant species in pre-weaned and adult pigs, while C. scrofarum infected pigs older than 3 months only. A season-related difference of C. suis was observed in this study, with the highest prevalence in autumn (5.5%) and the lowest (1.7%) in winter. The present study provided basic information for control of Cryptosporidium infection in pigs and assessment of zoonotic transmission of pigs in Shaanxi province, China.


Assuntos
Criptosporidiose/epidemiologia , Criptosporidiose/parasitologia , Cryptosporidium/isolamento & purificação , Doenças dos Suínos/epidemiologia , Doenças dos Suínos/parasitologia , Animais , China/epidemiologia , Análise por Conglomerados , Cryptosporidium/classificação , Cryptosporidium/genética , DNA de Protozoário/química , DNA de Protozoário/genética , DNA Ribossômico/química , DNA Ribossômico/genética , Fezes/parasitologia , Dados de Sequência Molecular , Filogenia , Reação em Cadeia da Polimerase , Prevalência , RNA Ribossômico 18S/genética , Estações do Ano , Análise de Sequência de DNA , Suínos
20.
Environ Monit Assess ; 187(10): 644, 2015 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-26407858

RESUMO

This study examines landscape changes in the context of China's national Grain for Green (GFG) policy, one of the world's largest "payment for environmental/ecosystem services" (PES) programs. We explored landscape structures and dynamics between 2000 and 2010 in Shaanxi Province, the Chinese province with the greatest amount of cropland conversion and reforestation in recent decades. We used Landsat Thematic Mapper (TM)-derived data and landscape metrics for six land cover classes to determine (1) the major land cover changes during enforcement of the policy, (2) the spatial and temporal variations in these changes, and (3) the effects of land cover changes on landscape structure and dynamics. The results suggested that provincial-level land cover changes modestly reflected the goals of the GFG. Over the 10-year study period, the forest and grassland coverages expanded from 95,737.9 to 97,017.4 km(2) and from 37,235.9 to 40,613.1 km(2), respectively, while the cropland coverage decreased from 59,222.8 to 54,007.6 km(2). The conversion direction differed regionally: the targeted croplands in Shanbei, namely, types III and IV, were mainly transformed into grassland while those in Shannan were mainly transformed into forestland. Reforestation was associated with increased inter-landscape aggregation and connection. Despite this large-scale reforestation trend, we found notable and significant differences in the land cover changes at the subprovincial level.


Assuntos
Agricultura/métodos , Conservação dos Recursos Naturais/métodos , Monitoramento Ambiental/métodos , Agricultura Florestal/métodos , Programas Governamentais , Agricultura/economia , Agricultura/tendências , China , Conservação dos Recursos Naturais/economia , Conservação dos Recursos Naturais/tendências , Produtos Agrícolas/economia , Produtos Agrícolas/crescimento & desenvolvimento , Ecossistema , Política Ambiental , Agricultura Florestal/economia , Agricultura Florestal/tendências , Florestas , Pradaria
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA