RESUMO
Germline colonization by retroviruses results in the formation of endogenous retroviruses (ERVs). Most colonization's occurred millions of years ago. However, in the Australo-Papuan region (Australia and New Guinea), several recent germline colonization events have been discovered. The Wallace Line separates much of Southeast Asia from the Australo-Papuan region restricting faunal and pathogen dispersion. West of the Wallace Line, gibbon ape leukemia viruses (GALVs) have been isolated from captive gibbons. Two microbat species from China appear to have been infected naturally. East of Wallace's Line, the woolly monkey virus (a GALV) and the closely related koala retrovirus (KoRV) have been detected in eutherians and marsupials in the Australo-Papuan region, often vertically transmitted. The detected vertically transmitted GALV-like viruses in Australo-Papuan fauna compared to sporadic horizontal transmission in Southeast Asia and China suggest the GALV-KoRV clade originates in the former region and further models of early-stage genome colonization may be found. We screened 278 samples, seven bat and one rodent family endemic to the Australo-Papuan region and bat and rodent species found on both sides of the Wallace Line. We identified two rodents (Melomys) from Australia and Papua New Guinea and no bat species harboring GALV-like retroviruses. Melomys leucogaster from New Guinea harbored a genomically complete replication-competent retrovirus with a shared integration site among individuals. The integration was only present in some individuals of the species indicating this retrovirus is at the earliest stages of germline colonization of the Melomys genome, providing a new small wild mammal model of early-stage genome colonization.
Assuntos
Quirópteros , Retrovirus Endógenos , Gammaretrovirus , Marsupiais , Animais , Vírus da Leucemia do Macaco Gibão/genética , Nova Guiné , Gammaretrovirus/genética , Murinae/genética , Marsupiais/genética , Células GerminativasRESUMO
BACKGROUND: Watermelon mosaic virus (WMV) is one of the most prevalent viruses affecting melon worldwide. Recessive resistance to WMV in melon has previously been reported in the African accession TGR-1551. Moreover, the genomic regions associated to the resistance have also been described. Nevertheless, the transcriptomic response that might infer the resistance to this potyvirus has not been explored. RESULTS: We have performed a comparative transcriptomic analysis using mock and WMV-inoculated plants of the susceptible cultivar "Bola de oro" (BO) and a resistant RIL (Recombinant inbred line) derived from the initial cross between "TGR-1551" and BO. In total, 616 genes were identified as differentially expressed and the weighted gene co-expression network analysis (WGCNA) detected 19 gene clusters (GCs), of which 7 were differentially expressed for the genotype x treatment interaction term. SNPs with a predicted high impact on the protein function were detected within the coding regions of most of the detected DEGs. Moreover, 3 and 16 DEGs were detected within the QTL regions previously described in chromosomes 11 and 5, respectively. In addition to these two specific genomic regions, we also observde large transcriptomic changes from genes spread across the genome in the resistant plants in response to the virus infection. This early response against WMV implied genes involved in plant-pathogen interaction, plant hormone signal transduction, the MAPK signaling pathway or ubiquitin mediated proteolysis, in detriment to the photosynthetic and basal metabolites pathways. Moreover, the gene MELO3C021395, which coded a mediator of RNA polymerase II transcription subunit 33A (MED33A), has been proposed as the candidate gene located on chromosome 11 conferring resistance to WMV. CONCLUSIONS: The comparative transcriptomic analysis presented here showed that, even though the resistance to WMV in TGR-1551 has a recessive nature, it triggers an active defense response at a transcriptomic level, which involves broad-spectrum resistance mechanisms. Thus, this study represents a step forward on our understanding of the mechanisms underlaying WMV resistance in melon. In addition, it sheds light into a broader topic on the mechanisms of recessive resistances.
Assuntos
Cucurbitaceae , Potyvirus , Cucurbitaceae/genética , Potyvirus/fisiologia , Perfilação da Expressão Gênica , Transcriptoma , Doenças das Plantas/genéticaRESUMO
Understanding the emergence and prevalence of viral diseases in crops requires the systematic epidemiological monitoring of viruses, as well as the analysis of how ecological and evolutionary processes combine to shape viral population dynamics. Here, we extensively monitored the occurrence of six aphid-transmitted viruses in melon and zucchini crops in Spain for 10 consecutive cropping seasons between 2011 and 2020. The most prevalent viruses were cucurbit aphid-borne yellows virus (CABYV) and watermelon mosaic virus (WMV), found in 31 and 26% of samples with yellowing and mosaic symptoms. Other viruses, such as zucchini yellow mosaic virus, cucumber mosaic virus, Moroccan watermelon mosaic virus, and papaya ring spot virus, were detected less frequently (<3%) and mostly in mixed infections. Notably, our statistical analysis showed a significant association between CABYV and WMV in melon and zucchini hosts, suggesting that mixed infections might be influencing the evolutionary epidemiology of these viral diseases. We then carried out a comprehensive genetic characterization of the full-length genome sequences from CABYV and WMV isolates by using the Pacific Biosciences single-molecule real-time (PacBio) high-throughput technology to assess the genetic variation and structure of their populations. Our results showed that the CABYV population displayed seven codons under positive selection, and although most isolates clustered in the Mediterranean clade, a subsequent analysis of molecular variance revealed a significant, fine-scale temporal structure, which was in part explained by the level of the variance between isolates from single and mixed infections. In contrast, the WMV population genetic analysis showed that most of the isolates grouped into the Emergent clade, with no genetic differentiation and under purifying selection. These results underlie the epidemiological relevance of mixed infections for CABYV and provide a link between genetic diversity and CABYV dynamics at the whole-genome level.
Assuntos
Afídeos , Coinfecção , Cucurbita , Cucurbitaceae , Luteoviridae , Viroses , Animais , Doenças das Plantas , Luteoviridae/genética , Produtos Agrícolas , Verduras , Variação GenéticaRESUMO
Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.
RESUMO
In plants, introgression of genetic resistance is a proven strategy for developing new resistant lines. While host proteins involved in genome replication and cell to cell movement are widely studied, other cell mechanisms responsible for virus infection remain under investigated. Endosomal sorting complexes required for transport (ESCRT) play a key role in membrane trafficking in plants and are involved in the replication of several plant RNA viruses. In this work, we describe the role of the ESCRT protein CmVPS4 as a new susceptibility factor to the Potyvirus Watermelon mosaic virus (WMV) in melon. Using a worldwide collection of melons, we identified three different alleles carrying non-synonymous substitutions in CmVps4. Two of these alleles were shown to be associated with WMV resistance. Using a complementation approach, we demonstrated that resistance is due to a single non-synonymous substitution in the allele CmVps4P30R. This work opens up new avenues of research on a new family of host factors required for virus infection and new targets for resistance.
Assuntos
Cucurbitaceae , Vírus de Plantas , Potyvirus , Cucurbitaceae/genética , Complexos Endossomais de Distribuição Requeridos para Transporte/genética , Doenças das Plantas/genética , Transporte ProteicoRESUMO
BACKGROUND: Viruses are among the most destructive and difficult to control plant pathogens. Melon (Cucumis melo L.) has become the model species for the agriculturally important Cucurbitaceae family. Approaches that take advantage of recently developed genomic tools in melon have been extremely useful for understanding viral pathogenesis and can contribute to the identification of target genes for breeding new resistant cultivars. In this work, we have used a recently described melon microarray for transcriptome profiling of two melon cultivars infected with two strains of Melon necrotic spot virus (MNSV) that only differ on their 3'-untranslated regions. RESULTS: Melon plant tissues from the cultivars Tendral or Planters Jumbo were locally infected with either MNSV-Mα5 or MNSV-Mα5/3'264 and analysed in a time-course experiment. Principal component and hierarchical clustering analyses identified treatment (healthy vs. infected) and sampling date (3 vs. 5 dpi) as the primary and secondary variables, respectively. Out of 7566 and 7074 genes deregulated by MNSV-Mα5 and MNSV-Mα5/3'264, 1851 and 1356, respectively, were strain-specific. Likewise, MNSV-Mα5/3'264 specifically deregulated 2925 and 1618 genes in Tendral and Planters Jumbo, respectively. The GO categories that were significantly affected were clearly different for the different virus/host combinations. Grouping genes according to their patterns of expression allowed for the identification of two groups that were specifically deregulated by MNSV-Mα5/3'264 with respect to MNSV-Mα5 in Tendral, and one group that was antagonistically regulated in Planters Jumbo vs. Tendral after MNSV-Mα5/3'264 infection. Genes in these three groups belonged to diverse functional classes, and no obvious regulatory commonalities were identified. When data on MNSV-Mα5/Tendral infections were compared to equivalent data on cucumber mosaic virus or watermelon mosaic virus infections, cytokinin-O-glucosyltransferase2 was identified as the only gene that was deregulated by all three viruses, with infection dynamics correlating with the amplitude of transcriptome remodeling. CONCLUSIONS: Strain-specific changes, as well as cultivar-specific changes, were identified by profiling the transcriptomes of plants from two melon cultivars infected with two MNSV strains. No obvious regulatory features shared among deregulated genes have been identified, pointing toward regulation through differential functional pathways.
Assuntos
Cucurbitaceae/genética , Cucurbitaceae/virologia , Perfilação da Expressão Gênica , Interações Hospedeiro-Patógeno/genética , Doenças das Plantas/genética , Doenças das Plantas/virologia , Tombusviridae/fisiologia , Transcriptoma , Análise por Conglomerados , Biologia Computacional/métodos , Regulação da Expressão Gênica de Plantas , Ontologia Genética , Especificidade de Órgãos , FenótipoRESUMO
BACKGROUND: Brain atrophy has been reported in patients with end-stage renal disease receiving hemodialysis, although its mechanism is unknown. However, little is known regarding brain atrophy in patients receiving peritoneal dialysis (PD). Therefore, we examined brain volume and its annual change over 2 years in PD patients compared with patients with non-dialysis-dependent chronic kidney disease (NDD-CKD). STUDY DESIGN: Cross-sectional and longitudinal cohort. SETTING & PARTICIPANTS: 62 PD patients and 69 patients with NDD-CKD with no history of cerebrovascular disease who underwent brain magnetic resonance imaging (MRI) were recruited in a cross-sectional study. Among them, 34 PD patients and 61 patients with NDD-CKD, who underwent a second brain MRI after 2 years, were recruited in a longitudinal study. PREDICTOR: PD therapy versus NDD-CKD. OUTCOMES & MEASUREMENTS: T1-weighted magnetic resonance images were analyzed. Total gray matter volume (GMV), total white matter volume (WMV), and cerebrospinal fluid space volume were segmented, and each volume was quantified using statistical parametric mapping software. Normalized GMV and WMV values were calculated by division of GMV and WMV by intracranial volume to adjust for variations in head size. We compared normalized GMV and normalized WMV between PD patients and patients with NDD-CKD in the cross-sectional study and the annual change in normalized GMV in the longitudinal study. RESULTS: In the cross-sectional study, normalized GMV, which was correlated inversely with age, was lower in PD patients than in patients with NDD-CKD. However, normalized WMV, which was not correlated with age, was comparable between the groups. Annual change in normalized GMV was significantly higher in PD patients than in patients with NDD-CKD. These differences remained significant even after adjustment for potential confounding factors. LIMITATIONS: A short observation period and high dropout rate in the longitudinal study. CONCLUSIONS: Decline in normalized GMV is faster in PD patients than in patients with NDD-CKD.
Assuntos
Encéfalo/patologia , Diálise Peritoneal/efeitos adversos , Insuficiência Renal Crônica/epidemiologia , Insuficiência Renal Crônica/terapia , Idoso , Atrofia/diagnóstico , Atrofia/epidemiologia , Estudos de Coortes , Estudos Transversais , Feminino , Humanos , Estudos Longitudinais , Masculino , Pessoa de Meia-Idade , Diálise Peritoneal/tendênciasRESUMO
The effectiveness of pest and disease management in crops relies on knowledge about their presence and distribution in crop-producing areas. Aphids and whiteflies are among the main threats to vegetable crops since these hemipterans feed on plants, causing severe damage, and are also able to transmit a large number of devastating plant viral diseases. In particular, the widespread occurrence of aphid-transmitted viruses in cucurbit crops, along with the lack of effective control measures, makes surveillance programs and virus epidemiology necessary for providing sound advice and further integration into the management strategies that can ensure sustainable food production. This review describes the current presence and distribution of aphid-transmitted viruses in cucurbits in Spain, providing valuable epidemiological information, including symptom expressions of virus-infected plants for further surveillance and viral detection. We also provide an overview of the current measures for virus infection prevention and control strategies in cucurbits and indicate the need for further research and innovative strategies against aphid pests and their associated viral diseases.
RESUMO
CRISPR/Cas9 is one of the most robust technologies for plant breeding enabling precise and efficient modifications in a genome. This technology is being used for the manipulation of target genes in a host to develop resistance against the plant pathogens. Cucumis sativus elF4E is one of the target genes playing a key role in viral infection during interaction with potyvirus viral proteins genome linked (VPg). Nevertheless, the allelic and positional effect of elF4E mutations in C. sativus is to be clarified in elF4E-VPg interaction. In addition, there are entanglements in the massive production of pathogen-resistant cultivars suitable for commercial production using CRISPR/Cas9 technology. Therefore, we targeted different positions of the elF4E in G27 and G247 inbred lines, using specific gRNA1 and gRNA2 for the first and third exons, respectively, and 1,221 transgene-free plants were selected in segregated T1 generation, where 192 G27 and 79 G247 plants had the least mutation at Cas9 cleavage site of gRNA1 or gRNA2. Crossing was performed to see allelic effects of elfF4E mutations in F1 populations, which were homozygous and heterozygous single (elF4E_1DEL or elF4E_3DEL) and double (elF4E_1-3DEL) mutants. Disease symptoms of watermelon mosaic virus (WMV), papaya ringspot virus (PRSV), and zucchini yellow mosaic virus (ZYMV) were evaluated in both non-edited and edited F1 plants, and we did not observe any symptom in homozygous elF4E_1-3DEL and elF4E_1DEL mutants. However, homozygous elF4E_3DEL was positive in reverse transcription polymerase chain reaction (RT-PCR), even if there were no significant symptoms on the inoculated leaves. ELISA and qRT-PCR indicated lower viral accumulation in homozygous elF4E_3DEL than heterozygous and non-edited plants. Regeneration and transformation protocols were also optimized comprehensively for both the genotypes. The average number of shoots/100 explants was determined for both G27 and G247 as 13.6 and 18.0, respectively. We could not detect any distinguishing difference between the non-edited and edited F1 plants for yield and morphology. Our results demonstrate an effective route for mass production of viral resistant cultivars of cucumber to WMV, ZYMV, and PRSV. In this way, the pathogen-resistant cultivars could be generated to reduce the losses caused by these pathogens in cucumber production.
RESUMO
Watermelon mosaic virus (WMV) causes serious damage to several crops worldwide, mainly cucurbits. Disease control is based on preventing spread and search for natural resistances for plant breeding, which requires tools for sensitive detection and precise quantitation. We developed a procedure based on reverse transcription followed by real-time quantitative polymerase chain reaction (RT-qPCR) with a primer pair and a TaqMan® probe specific for WMV. The primers and probe were designed from conserved sequence stretches to target a wide range of WMV isolates. A standard curve performed with transcripts enabled estimation of WMV RNA copies per ng of total RNA, with a wide dynamic range and sensitivity (104 to 1011). This RT-qPCR was assayed with field samples from different cucurbits and used to evaluate the temporal accumulation in pumpkin plants.
Assuntos
Doenças das Plantas , RNA Viral , Potyvirus , RNA Viral/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sensibilidade e EspecificidadeRESUMO
The ability of plant resistance inducers to provide protection against viral diseases is one of their main advantages over conventional pesticides. In the case of viral diseases that cannot be controlled directly with pesticides, insecticides are used to control the vectors of viruses. However, the effectiveness of such treatments is strictly dependent on the time of application. The plant response to the application of systemic acquired resistance (SAR) inducers, as a result of the stimulating action of these substances, does not depend on the time of application as it triggers the plant's natural defence mechanism. The best-recognised substance showing SAR inducer activity is acibenzolar-S-methyl ester (ASM, BTH). As its activity against different plant pathogens of crops has been well documented, the current research is concentrated on the search for novel substances of the type. The tested substance, N-methoxy-N-methylbenzo(1,2,3)thiadiazole-7-carboxamide (BTHWA), is an amide derivative of benzothiadiazole, showing plant resistance-inducing activity. This article presents the activity of BTHWA that has led to increased resistance of zucchini (Cucurbita pepo convar. giromontiina) towards viral infections. In addition, since the occurrence of the fungal pathogen, powdery mildew, was also observed during the two-year field experiments, the activity of BTHWA related to the reduction of infection with this fungus was also investigated. The substance was applied in two different variants either four or eight times, over the whole vegetation season. Surprisingly, the variant of four applications performed at the beginning of the vegetation season proved more effective in protection against viruses and fungus. A possible explanation may be the occurrence of the growth-immunity trade-off phenomenon that is known in the literature. Disturbance in plant metabolism resulting from eight applications may lead to lower yields of plants treated with SAR inducers. Perhaps such overstimulation of the plants we treated eight times may not have brought the optimum increase in plant resistance.
RESUMO
Viral infections on cucurbit plants cause substantial quality and yield losses on their crops. The diseased plants can often be infected by multiple viruses, and their epidemiology may depend, in addition to the agro-ecological management practices, on the combination of these viral infections. Watermelon mosaic virus (WMV) is one of the most prevalent viruses in cucurbit crops, and Moroccan watermelon mosaic virus (MWMV) emerged as a related species that threatens these crops. The occurrence of WMV and MWMV was monitored in a total of 196 apical-leaf samples of watermelon and pumpkin plants that displayed mosaic symptoms. The samples were collected from 49 fields in three major cucurbit-producing areas in Spain (Castilla La-Mancha, Alicante, and Murcia) for three consecutive (2018-2020) seasons. A molecular hybridization dot-blot method revealed that WMV was mainly (53%) found in both cultivated plants, with an unadvertised occurrence of MWMV. To determine the extent of cultivated plant species and mixed infections on viral dynamics, two infectious cDNA clones were constructed from a WMV isolate (MeWM7), and an MWMV isolate (ZuM10). Based on the full-length genomes, both isolates were grouped phylogenetically with the Emergent and European clades, respectively. Five-cucurbit plant species were infected steadily with either WMV or MWMV cDNA clones, showing variations on symptom expressions. Furthermore, the viral load varied depending on the plant species and infection type. In single infections, the WMV isolate showed a higher viral load than the MWMV isolate in melon and pumpkin, and MWMV only showed higher viral load than the WMV isolate in zucchini plants. However, in mixed infections, the viral load of the WMV isolate was greater than MWMV isolate in melon, watermelon and zucchini, whereas MWMV isolate was markedly reduced in zucchini. These results suggest that the impaired distribution of MWMV in cucurbit crops may be due to the cultivated plant species, in addition to the high prevalence of WMV.
RESUMO
Watermelon mosaic virus (WMV) is an important virus causing adverse effects on cucurbits throughout the world. In this study, we recorded WMV infection in the watermelon (Citrullus lanatus)-growing area of Alwar and Sikar in districts of Rajasthan, India. The RT-PCR-based detection was performed to confirm the presence of WMV, by using potyvirus-degenerated coat protein primers. Further, the complete genome sequences of two WMV isolates were compared with previously reported genome sequences. The complete genome of each isolate was 10,030 nt long, excluding the poly-A tails. Phylogeny relationships of the WMV isolates in the present study revealed the presence of uneven evolutionary pressure among the different WMV viral genomic segments. The analysis revealed that all the WMV isolates were divided into three clusters and the Indian WMV isolates cluster together with the French isolate. Recombination analysis of WMV exhibited significant recombination hotspots in the P1, NIa-Pro and Nib-CP regions. Our finding highlights the importance of genetic variability and recombination analysis to provide a better understanding of WMV molecular diversity.
RESUMO
BACKGROUND: Increasing evidence supported the possible neuro-invasion potential of SARS-CoV-2. However, no studies were conducted to explore the existence of the micro-structural changes in the central nervous system after infection. We aimed to identify the existence of potential brain micro-structural changes related to SARS-CoV-2. METHODS: In this prospective study, diffusion tensor imaging (DTI) and 3D high-resolution T1WI sequences were acquired in 60 recovered COVID-19 patients (56.67% male; age: 44.10 ± 16.00) and 39 age- and sex-matched non-COVID-19 controls (56.41% male; age: 45.88 ± 13.90). Registered fractional anisotropy (FA), mean diffusivity (MD), axial diffusivity (AD), and radial diffusivity (RD) were quantified for DTI, and an index score system was introduced. Regional volumes derived from Voxel-based Morphometry (VBM) and DTI metrics were compared using analysis of covariance (ANCOVA). Two sample t-test and Spearman correlation were conducted to assess the relationships among imaging indices, index scores and clinical information. FINDINGS: In this follow-up stage, neurological symptoms were presented in 55% COVID-19 patients. COVID-19 patients had statistically significantly higher bilateral gray matter volumes (GMV) in olfactory cortices, hippocampi, insulas, left Rolandic operculum, left Heschl's gyrus and right cingulate gyrus and a general decline of MD, AD, RD accompanied with an increase of FA in white matter, especially AD in the right CR, EC and SFF, and MD in SFF compared with non-COVID-19 volunteers (corrected p value <0.05). Global GMV, GMVs in left Rolandic operculum, right cingulate, bilateral hippocampi, left Heschl's gyrus, and Global MD of WM were found to correlate with memory loss (p value <0.05). GMVs in the right cingulate gyrus and left hippocampus were related to smell loss (p value <0.05). MD-GM score, global GMV, and GMV in right cingulate gyrus were correlated with LDH level (p value <0.05). INTERPRETATION: Study findings revealed possible disruption to micro-structural and functional brain integrity in the recovery stages of COVID-19, suggesting the long-term consequences of SARS-CoV-2. FUNDING: Shanghai Natural Science Foundation, Youth Program of National Natural Science Foundation of China, Shanghai Sailing Program, Shanghai Science and Technology Development, Shanghai Municipal Science and Technology Major Project and ZJ Lab.
RESUMO
PURPOSE: Autosomal dominant lateral temporal epilepsy (ADLTE) is a genetic focal epilepsy syndrome characterized by focal seizures with dominant auditory symptomatology. We present a case report of an 18-year-old patient with acute onset of seizures associated with epilepsy. Based on the clinical course of the disease and the results of the investigation, the diagnosis of ADLTE with a proven mutation in the RELN gene, which is considered causative, was subsequently confirmed. The aim of this study was to use 3 Tesla (3â¯T) magnetic resonance imaging (MRI) and advanced neuroimaging methods in a patient with a confirmed diagnosis of ADTLE. METHODS: 3â¯T MRI brain scan and advanced neuroimaging methods were used in the standard protocols to analyzse voxel-based MRI, cortical thickness, and functional connectivity. RESULTS: Morphometric MRI analysis (blurred grey-white matter junctions, voxel-based morphometry, and cortical thickness analysis) did not provide any informative results. The functional connectivity analysis revealed higher local synchrony in the patient in the left temporal (middle temporal gyrus), left frontal (supplementary motor area, superior frontal gyrus), and left parietal (gyrus angularis, gyrus supramarginalis) regions and the cingulate (middle cingulate gyrus) as compared to healthy controls. CONCLUSIONS: Evidence of multiple areas of functional connectivity supports the theory of epileptogenic networks in ADTLE. Further studies are needed to elucidate this theory.
RESUMO
Watermelon mosaic potyvirus (WMV) is considered as an important virus infecting watermelon and causing adverse effects on crop productivity. To overcome this problem one of the main objectives of plant breeders is to make these strains less effective in the ability to infect plants by treatment with plant extracts. Due to the advantages of plant tissue culture, in vitro, in the process of the selection of different cultivars under biotic stress, this study was conducted to achieve this aim by evaluating the effect of three concentrations of Thuja extract on the multiplication of WMV in watermelon by measuring callus fresh weight and soluble proteins (mg g(-1) fresh weight) of healthy and infected hypocotyl explants. Also, WMV was isolated from naturally infected watermelon and characterized as potyvirus by serological and molecular analyses. The isolated virus gave a positive reaction with WMV antiserum compared with other antibodies of CMV, ZYMV and SqMV using DAS-ELISA. RT-PCR, with the specific primer for WMV-cp. gene, yielded 825 base pair DNA fragments. The results that belong to soluble protein analysis indicated that infected hypocotyl explants treated with 6 g L(-1) recorded the highest rate in the number of soluble protein bands compared with the rest of treatments. As a conclusion of these results, we can recommend to apply the Thuja extract at 6 g L(-1) as a optimum dosage to decrease the infection caused by watermelon mosaic potyvirus.
RESUMO
Zucchini yellow mosaic virus (ZYMV, genus Potyvirus) causes important crop losses in cucurbits worldwide. In France, ZYMV epidemics are sporadic but occasionally very severe. This contrasts with Watermelon mosaic virus (WMV, genus Potyvirus) which causes regular and early epidemics. Factors influencing ZYMV epidemiology are still poorly understood. In order to gain new insights on the ecology and epidemiology of this virus, a 5-year multilocation trial was conducted in which ZYMV spread and populations were studied in each of the 20 plot/year combinations and compared with WMV. Search for ZYMV alternative hosts was conducted by testing weeds growing naturally around one plot and also by checking ZYMV natural infections in selected ornamental species. Although similar ZYMV populations were observed occasionally in the same plot in two successive years suggesting the occurrence of overwintering hosts nearby, only two Lamium amplexicaule plants were found to be infected by ZYMV of 3459 weed samples that were tested. The scarcity of ZYMV reservoirs contrasts with the frequent detection of WMV in the same samples. Since ZYMV and WMV have many aphid vectors in common and are transmitted with similar efficiencies, the differences observed in ZYMV and WMV reservoir abundances could be a major explanatory factor for the differences observed in the typology of ZYMV and WMV epidemics in France. Other potential ZYMV alternative hosts have been identified in ornamental species including begonia. Although possible in a few cases, exchanges of populations between different plots located from 500 m to 4 km apart seem uncommon. Therefore, the potential dissemination range of ZYMV by its aphid vectors seems to be rather limited in a fragmented landscape.
Assuntos
Citrullus/virologia , Cucurbita/virologia , Filogenia , Doenças das Plantas/virologia , Potyvirus/genética , RNA Viral/genética , Animais , Afídeos/fisiologia , Comportamento Animal , Citrullus/parasitologia , Cucurbita/parasitologia , Comportamento Alimentar , França , Haplótipos , Especificidade de Hospedeiro , Interações Hospedeiro-Parasita , Insetos Vetores/fisiologia , Epidemiologia Molecular , Filogeografia , Doenças das Plantas/parasitologia , Plantas Daninhas/parasitologia , Plantas Daninhas/virologia , Potyvirus/classificação , Potyvirus/isolamento & purificaçãoRESUMO
Functional small RNAs, such as short interfering RNAs (siRNAs) and microRNAs (miRNAs), exist in freshly consumed fruits and vegetables. These siRNAs can be derived either from endogenous sequences or from viruses that infect them. Symptomatic tomatoes, watermelons, zucchini, and onions were purchased from grocery stores and investigated by small RNA sequencing. By aligning the obtained small RNA sequences to sequences of known viruses, four different viruses were identified as infecting these fruits and vegetables. Many of these virally derived small RNAs along with endogenous small RNAs were found to be highly complementary to human genes. However, the established history of safe consumption of these vegetables suggests that this sequence homology has little biological relevance. By extension, these results provide evidence for the safe use by humans and animals of genetically engineered crops using RNA-based suppression technologies, especially vegetable crops with virus resistance conferred by expression of siRNAs or miRNAs derived from viral sequences.
Assuntos
MicroRNAs/genética , Doenças das Plantas/genética , RNA de Plantas/genética , RNA Interferente Pequeno/genética , RNA Viral/genética , Verduras/genética , Verduras/virologia , Vírus/genética , Doenças das Plantas/virologia , Verduras/economia , Vírus/classificação , Vírus/isolamento & purificaçãoRESUMO
OBJECTIVE: White matter atrophy occurs independently of lesions in multiple sclerosis. In contrast to lesion detection, the quantitative assessment of white matter atrophy in individual patients has been regarded as a major challenge. We therefore tested the hypothesis that white matter atrophy (WMA) is present at the very beginning of multiple sclerosis (MS) and in virtually each individual patient. To find a new sensitive and robust marker for WMA we investigated the relationship between cortical surface area, white matter volume (WMV), and whole-brain-surface-averaged rectified cortical extrinsic curvature. Based on geometrical considerations we hypothesized that cortical curvature increases if WMV decreases and the cortical surface area remains constant. METHODS: In total, 95 participants were enrolled: 30 patients with early and advanced relapsing-remitting MS; 30 age-matched control subjects; 30 patients with Alzheimer's disease (AD) and 5 patients with clinically isolated syndrome (CIS). RESULTS: 29/30 MS and 5/5 CIS patients showed lower WMV than expected from their intracranial volume (average reduction 13.0%, P < 10(- 10)), while the cortical surface area showed no significant differences compared with controls. The estimated WMV reductions were correlated with an increase in cortical curvature (R = 0.62, P = 0.000001). Discriminant analysis revealed that the curvature increase was highly specific for the MS and CIS groups (96.7% correct assignments between MS and control groups) and was significantly correlated with reduction of white matter fractional anisotropy, as determined by diffusion tensor imaging and the Expanded Disability Status Scale. As expected by the predominant gray and WM degeneration in AD, no systematic curvature increase was observed in AD. CONCLUSION: Whole-brain-averaged cortical extrinsic curvature appears to be a specific and quantitative marker for a WMV-cortex disproportionality and allows us to assess "pure" WMA without being confounded by intracranial volume. WMA seems to be a characteristic symptom in early MS and can already occur in patients with CIS and should thus be considered in future MS research and clinical studies.