A balance between vector survival and virus transmission is achieved through JAK/STAT signaling inhibition by a plant virus.

Viruses pose a great threat to animal and plant health worldwide, with many being dependent on insect vectors for transmission between hosts. While the virus-host arms race has been well established, how viruses and insect vectors adapt to each other remains poorly understood. Begomoviruses comprise the largest genus of plant-infecting DNA viruses and are exclusively transmitted by the whitefly Bemisia tabaci. Here, we show that the vector Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway plays an important role in mediating the adaptation between the begomovirus tomato yellow leaf curl virus (TYLCV) and whiteflies. We found that the JAK/STAT pathway in B. tabaci functions as an antiviral mechanism against TYLCV infection in whiteflies as evidenced by the increase in viral DNA and coat protein (CP) levels after inhibiting JAK/STAT signaling. Two STAT-activated effector genes, BtCD109-2 and BtCD109-3, mediate this anti-TYLCV activity. To counteract this vector immunity, TYLCV has evolved strategies that impair the whitefly JAK/STAT pathway. Infection of TYLCV is associated with a reduction of JAK/STAT pathway activity in whiteflies. Moreover, TYLCV CP binds to STAT and blocks its nuclear translocation, thus, abrogating the STAT-dependent transactivation of target genes. We further show that inhibition of the whitefly JAK/STAT pathway facilitates TYLCV transmission but reduces whitefly survival and fecundity, indicating that this JAK/STAT-dependent TYLCV-whitefly interaction plays an important role in keeping a balance between whitefly fitness and TYLCV transmission. This study reveals a mechanism of plant virus-insect vector coadaptation in relation to vector survival and virus transmission.

Begomoviral ßC1 orchestrates organellar genomic instability to augment viral infection.

Chloroplast is the site for transforming light energy to chemical energy. It also acts as a production unit for a variety of defense-related molecules. These defense moieties are necessary to mount a successful counter defense against pathogens, including viruses. Previous studies indicated disruption of chloroplast homeostasis as a basic strategy of Begomovirus for its successful infection leading to the production of vein-clearing, mosaic, and chlorotic symptoms in infected plants. Although begomoviral pathogenicity determinant protein Beta C1 (ßC1) was implicated for pathogenicity, the underlying mechanism was unclear. Here we show that, begomoviral ßC1 directly interferes with the host plastid homeostasis. ßC1 induced DPD1, an organelle-specific nuclease, implicated in nutrient salvage and senescence, as well as modulated the function of a major plastid genome maintainer protein RecA1, to subvert plastid genome. We show that ßC1 was able to physically interact with bacterial RecA and its plant homolog RecA1, resulting in its altered activity. We observed that knocking-down DPD1 during virus infection significantly reduced virus-induced necrosis. These results indicate the presence of a strategy in which a viral protein alters host defense by targeting modulators of chloroplast DNA. We predict that the mechanism identified here might have similarities in other plant-pathogen interactions.

Genetic analysis of resistance to bean leaf crumple virus identifies a candidate LRR-RLK gene.

Bean leaf crumple virus (BLCrV) is a novel begomovirus (family Geminiviridae, genus Begomovirus) infecting common bean (Phaseolus vulgaris L.), threatening bean production in Latin America. Genetic resistance is required to ensure yield stability and reduce the use of insecticides, yet the available resistance sources are limited. In this study, three common bean populations containing a total of 558 genotypes were evaluated in different yield and BLCrV resistance trials under natural infection in the field. A genome-wide association study identified the locus BLC7.1 on chromosome Pv07 at 3.31 Mbp, explaining 8 to 16% of the phenotypic variation for BLCrV resistance. In comparison, whole-genome regression models explained 51 to 78% of the variation and identified the same region on Pv07 to confer resistance. The most significantly associated markers were located within the gene model Phvul.007G040400, which encodes a leucine-rich repeat receptor-like kinase subfamily III member and is likely to be involved in the innate immune response against the virus. The allelic diversity within this gene revealed five different haplotype groups, one of which was significantly associated with BLCrV resistance. As the same genome region was previously reported to be associated with resistance against other geminiviruses affecting common bean, our study highlights the role of previous breeding efforts for virus resistance in the accumulation of positive alleles against newly emerging viruses. In addition, we provide novel diagnostic single-nucleotide polymorphism markers for marker-assisted selection to exploit BLC7.1 for breeding against geminivirus diseases in one of the most important food crops worldwide.

Transcriptomic profiling reveals the complex interaction between a bipartite begomovirus and a cucurbitaceous host plant.

BACKGROUND: Begomoviruses are major constraint in the production of many crops. Upon infection, begomoviruses may substantially modulate plant biological processes. While how monopartite begomoviruses interact with their plant hosts has been investigated extensively, bipartite begomoviruses-plant interactions are understudied. Moreover, as one of the major groups of hosts, cucurbitaceous plants have been seldom examined in the interaction with begomoviruses. RESULTS: We profiled the zucchini transcriptomic changes induced by a bipartite begomovirus squash leaf curl China virus (SLCCNV). We identified 2275 differentially-expressed genes (DEGs), of which 1310 were upregulated and 965 were downregulated. KEGG enrichment analysis of the DEGs revealed that many pathways related to primary and secondary metabolisms were enriched. qRT-PCR verified the transcriptional changes of twelve selected DEGs induced by SLCCNV infection. Close examination revealed that the expression levels of all the DEGs of the pathway Photosynthesis were downregulated upon SLCCNV infection. Most DEGs in the pathway Plant-pathogen interaction were upregulated, including some positive regulators of plant defenses. Moreover, the majority of DEGs in the MAPK signaling pathway-plant were upregulated. CONCLUSION: Our findings indicates that SLCCNV actively interact with its cucurbitaceous plant host by suppressing the conversion of light energy to chemical energy and inducing immune responses. Our study not only provides new insights into the interactions between begomoviruses and host plants, but also adds to our knowledge on virus-plant interactions in general.

Cy-1, a major QTL for tomato leaf curl New Delhi virus resistance, harbors a gene encoding a DFDGD-Class RNA-dependent RNA polymerase in cucumber (Cucumis sativus).

BACKGROUND: Tomato leaf curl New Delhi virus (ToLCNDV) (family Geminiviridae, genus Begomovirus) is a significant threat to cucumber (Cucumis sativus) production in many regions. Previous studies have reported the genetic mapping of loci related to ToLCNDV resistance, but no resistance genes have been identified. RESULTS: We conducted map-based cloning of the ToLCNDV resistance gene in cucumber accession No.44. Agroinfiltration and graft-inoculation analyses confirmed the resistance of No.44 to ToLCNDV isolates from the Mediterranean and Asian countries. Initial mapping involving two rounds of phenotyping with two independent F2 populations generated by crossing the begomovirus-susceptible cultivar SHF and No.44 consistently detected major quantitative trait loci (QTLs) on chromosomes 1 and 2 that confer resistance to ToLCNDV. Fine-mapping of Cy-1, the dominant QTL on chromosome 1, using F3 populations narrowed the candidate region to a 209-kb genomic segment harboring 24 predicted genes. Among these genes, DFDGD-class RNA-dependent RNA polymerase (CsRDR3), an ortholog of Ty-1/Ty-3 of tomato and Pepy-2 of capsicum, was found to be a strong candidate conferring ToLCNDV resistance. The CsRDR3 sequence of No.44 contained multiple amino acid substitutions; the promoter region of CsRDR3 in No.44 had a large deletion; and the CsRDR3 transcript levels were greater in No.44 than in SHF. Virus-induced gene silencing (VIGS) of CsRDR3 using two chromosome segment substitution lines harboring chromosome 1 segments derived from No.44 compromised resistance to ToLCNDV. CONCLUSIONS: Forward and reverse genetic approaches identified CsRDR3, which encodes a DFDGD-class RNA-dependent RNA polymerase, as the gene responsible for ToLCNDV resistance at the major QTL Cy-1 on chromosome 1 in cucumber. Marker-assisted breeding of ToLCNDV resistance in cucumber will be expedited by using No.44 and the DNA markers developed in this study.

Identification of a novel monopartite begomovirus associated with leaf curl disease of Citharexylum spinosum in India.

The present study reports the complete genome of a novel monopartite begomovirus, named tentatively as "Citharexylum leaf curl virus" (CitLCuV), associated with leaf curl disease of Citharexylum spinosum in India. CitLCuV genome (2767 nucleotide) contained the typical genome organization of Old World begomoviruses and shared the maximum nucleotide sequence identity of 89.7% with a papaya leaf crumple virus (PaLCrV) isolate. In addition, two small non-canonical open reading frames (C5 and C6) were determined in the complementary strand of CitLCuV genome. Phylogenetic analysis revealed the relatedness of CitLCuV to PaLCrV and rose leaf curl virus. Recombination analysis detected a possible recombination event in CitLCuV genome. Based on begomovirus species demarcation criteria, CitLCuV can be regarded as a novel begomoviral species.

Breakdown of Ty-1-Based Resistance to Tomato Yellow Leaf Curl Virus in Tomato Plants at High Temperatures.

The global dissemination of the Israel (IL) and mild (Mld) strains of tomato yellow leaf curl virus (TYLCV) (family Geminiviridae, genus Begomovirus) is a major threat to tomato production in many regions worldwide. The use of resistant hybrid cultivars bearing the dominant resistance genes Ty-1, Ty-3, and Ty-3a has become a common practice for controlling tomato yellow leaf curl disease (TYLCD) caused by TYLCV. However, TYLCD symptoms have been sporadically observed in resistant cultivars grown in seasons when temperatures are high. In this study, we used TYLCV-resistant cultivars with confirmed presence of Ty-1, which were determined using newly developed allele-specific markers based on polymorphisms within the locus. These Ty-1-bearing resistant tomato plants and susceptible plants were infected with TYLCV and grown at moderate or high temperatures. Under high-temperature conditions, the Ty-1-bearing tomato cultivar Momotaro Hope (MH) infected with TYLCV-IL had severe TYLCD symptoms, which were almost equivalent to those of the susceptible cultivar. However, MH plants infected with TYLCV-Mld were symptomless or had slight symptoms under the same temperature condition. The quantitative analysis of the TYLCV-IL viral DNA content revealed a correlation between symptom development and viral DNA accumulation. Furthermore, under high-temperature conditions, TYLCV-IL caused severe symptoms in multiple commercial tomato cultivars with different genetic backgrounds. Our study provided the scientific evidence for the experientially known phenomenon by tomato growers, and it is anticipated that global warming, associated with climate change, could potentially disrupt the management of TYLCV in tomato plants mediated by the Ty-1 gene.

First report of Tomato interveinal chlorosis virus infecting Rhynchosia minima plants in Brazil.

Tomato interveinal chlorosis virus (ToICV; Begomovirus solanumintervenae, genus Begomovirus, family Geminiviridae) has been described infecting tomato (Solanum lycopersicum) and Macroptilium lathyroides in Northeastern (NE) Brazil for more than a decade (Albuquerque et al., 2012; Silva et al., 2012). During a survey in 2020, plants of the leguminous weed Rhynchosia minima exhibiting virus-like symptoms such as mosaic and interveinal chlorosis were observed in the state of Alagoas, NE Brazil. Symptomatic leaf samples of R. minima were randomly collected (n=15; supplementary figure 1). Total DNA from each sample was used as a template for PCR amplification of partial begomoviral DNA-A sequences using the degenerate primer pair PAL1v1978 and PAR1c496, universal for geminiviruses (Rojas et al., 1993). Amplicons of ~1.2 kbp were observed from 12 samples, although this should not be considered as incidence since only symptomatic plants were collected. To identify the begomovirus associated with R. minima, viral genomes were amplified from PCR-positive samples using rolling circle amplification (RCA) (Inoue-Nagata et al., 2004). The RCA products were digested with HindIII, cloned into the pBluescript II KS+ plasmid vector and bidirectionally Sanger-sequenced (Macrogen Inc., Seoul). BLASTn searches indicated that the clones (n=4) reported here corresponded to a begomovirus DNA-A component, and pairwise comparisons showed that they shared the highest identity with ToICV, at 92.4-94.7% nucleotide sequence identity. Based on the species demarcation criteria of ≥91% nucleotide identity for the genus Begomovirus (Brown et al., 2015), the begomoviruses obtained from R. minima are new isolates of ToICV. The new DNA-A sequences of 2,619-2,623 nt in length were deposited in GenBank under accession numbers PP639092 to PP639095. Multiple nucleotide sequence alignments were prepared using the MUSCLE algorithm implemented in MEGA v.11 (Kumar et al., 2018), and a maximum likelihood (ML) tree was reconstructed in RaxML-NG (Kozlov et al., 2019), assuming a general time reversible (GTR) nucleotide substitution model with a gamma (G) model of rate heterogeneity and 1,000 bootstrap replicates. The DNA-A-based tree showed that the ToICV sequences clustered into a monophyletic group, additionally supporting these isolates as members of the species Begomovirus solanumintervenae. At least two independent interspecies recombination events were predicted among the ToICV isolates, with breakpoints located in the Rep-encoding region and ToICV (GenBank Accession JF803253), tomato mottle leaf curl virus (JF803248) and soybean blistering mosaic virus (MN486865) detected as putative parents. To the best of our knowledge, this is the first report of ToICV infecting R. minima worldwide, expanding the host range of this begomovirus. Non-cultivated plants such as R. minima play a crucial role as reservoirs and sources of inoculum for begomoviruses (Paz-Carrasco et al., 2014), reinforcing their relevance to socioeconomically important crops.

An Interspecies Recombinant Sida Yellow Mosaic China Virus Isolate and Betasatellite Cause a Leaf Curl Disease in Tobacco in Hainan, China.

Tobacco (Nicotiana tabacum) is an herbaceous crop. Cigar tobacco, a group of tobacco cultivars, has recently been planted in a few provinces in China. Since its introduction, symptoms such as leaf curling and vein thickening have appeared. Here we report a begomovirus, Sida yellow mosaic China virus-Hainan isolate (designated SiYMCNV-HN), associated with the betasatellite (designated SiYMCNB-HN) as the causal agent of a leaf curl disease in cigar tobacco (N. tabacum cv. Haiyan101) in Hainan Province, China. Phylogenetic and recombination analyses indicate that SiYMCNV-HN is an interspecies recombinant with a SiYMCNV isolate as the major parent and a Sida yellow vein Vietnam virus isolate as the minor parent. Full-length infectious clones of SiYMCNV-HN and SiYMCNB-HN were generated, which were highly infectious and induced high pathogenicity through agroinfiltration in Nicotiana benthamiana and N. tabacum. This newly reported recombinant begomovirus poses potential threats to tobacco plantations in the region.

Cucurbit Leaf Crumple Virus (CuLCrV) is Seed Transmitted in Yellow Squash (Cucurbita pepo L.).

The traditional understanding of begomovirus transmission exclusively through the whitefly Bemisia tabaci (Gennadius) has shifted with findings of seed transmission in some begomoviruses over the last decade. We investigated the seed transmissibility of cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus that has recently emerged as a severe constraint for yellow squash (Cucurbita pepo L.) production in the southeastern United States. We found high concentration of CuLCrV in male and female flower tissues of infected squash, including pollen and ovules. The virus infiltrated the fruit tissues including the endocarp and funiculus, which are anatomically positioned adjacent to the seeds. In seeds, CuLCrV was detected in the endosperm and embryo where there are no vascular connections, in addition to the seed coat. The virus was detected in the radicle, plumule, cotyledonary leaves, and true leaves of seedlings grown from seeds collected from infected fruits. In the grow-out test conducted, CuLCrV infections ranged from 17-56% of the progeny plants. To ensure that partial viral genome fragments were not being mistaken for replicative forms of the virus, we performed RCA ̶ PCR and amplified complete DNA-A and DNA-B of CuLCrV from seed tissues, seedlings, progeny plants of CuLCrV infected squash. Near complete DNA-A and DNA-B sequences of CuLCrV were recovered from a progeny plant, further validating our findings. Our results demonstrate that CuLCrV can translocate from vegetative to reproductive tissues of yellow squash, persist within the seeds, and subsequently induce infection in progeny plants, confirming its capacity for seed transmission.

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Resistance to the insect vector Bemisia tabaci enhances the robustness and durability of tomato yellow leaf curl virus resistance conferred by Ty-1.

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (genus Begomovirus, family Geminiviridae) transmitted persistently by the whitefly Bemisia tabaci. It causes tomato yellow leaf curl disease (TYLCD), resulting in significant yield losses worldwide. TYLCD is controlled mainly by using F1 hybrid tomato cultivars harboring the TYLCV resistance gene Ty-1. However, infected Ty-1-bearing tomato plants accumulate viral DNA, which may eventually lead to the emergence of a resistance-breaking TYLCV variant. Recently, a B. tabaci-resistant tomato line derived from the introgression of type IV leaf glandular trichomes and acylsucrose secretion from wild tomato (Solanum pimpinellifolium) was shown to effectively control the spread of TYLCV. In this study, we combined B. tabaci resistance and Ty-1-based TYLCV resistance to increase the robustness and durability of the TYLCD resistance mediated by Ty-1 in tomato plants. Specifically, we characterized and used a Group 2-like isolate of the Israel strain of TYLCV (TYLCV-IL-G2) that contributes to TYLCD epidemics in southeastern Spain. A comparison with isolates of the previously identified TYLCV variant revealed TYLCV-IL-G2 has a similar host range, but it induces a slightly more severe TYLCD in Ty-1-bearing tomato plants. Moreover, we demonstrated that acylsucrose-producing B. tabaci-resistant tomato plants can limit the spread of TYLCV-IL-G2 better than a near-isogenic line lacking type IV trichomes and unable to secrete acylsucrose. Pyramiding Ty-1-based TYLCV resistance and B. tabaci resistance provided by type IV glandular trichomes helped to decrease the effects of TYLCV on Ty-1-bearing tomato plants as well as the likelihood of TYLCV evolution in infected plants.

Genetic Diversity and Pathogenicity Characterization of Tomato-Infecting Begomoviruses in Taiwan.

The tomato yellow leaf curl disease (TYLCD) caused by whitefly (Bemisia tabaci)-transmitted begomoviruses (Geminiviridae) has constrained tomato production in Taiwan since 1981. Lisianthus enation leaf curl virus (LELCV), tomato leaf curl Taiwan virus (ToLCTV), and tomato yellow leaf curl Thailand virus (TYLCTHV) were the major viruses associated with TYLCD. In 2019 to 2020, we investigated TYLCD throughout Taiwan, with a 10 to 100% incidence on tomato fields. Begomovirus sequences were detected in 321 out of 506 collected samples by PCR with primers PAL1v1978B and PAR1c715H. In 2015 to 2016, 59 out of 99 samples collected in Hualien-Taitung areas were also found to have begomovirus sequences. Based on the analysis of 68 viral genomic sequences, six begomoviruses were identified, including LELCV, ToLCTV, TYLCTHV, tomato leaf curl Hsinchu virus, and two new begomoviruses, tentatively named tomato leaf curl Chiayi virus (ToLCCYV) and tomato leaf curl Nantou virus (ToLCNTV). Various isolates of LELCV and TYLCTHV were grouped into four and two strains, respectively. Recombinants were detected in LELCV-A, -C, and -D, ToLCCYV, ToLCNTV, and TYLCTHV-F. Based on virus-specific detection, the majority of TYLCD-associated viruses were mixed-infected by TYLCTHV-B with TYLCTHV-F, LELCV-A, -B, or -D, and/or ToLCTV. Meanwhile, viral DNA-B was mostly associated with TYLCTHV, and all identified DNA-Bs were highly homologous with previous TYLCTHV DNA-B. The pathogenicity of selected begomoviruses was confirmed through agroinfection and whitefly transmission. All tomato plants carrying Ty-1/3 and Ty-2 resistant genes were infected by all LELCV strains and ToLCCYV, although they appeared symptomless, suggesting these viruses could be managed through the use of the resistance pyramid.

Size Restriction Is Required for Proper Functioning of a Bipartite Begomovirus AC4 Protein.

Many geminiviruses, including members of the genus Begomovirus, produce a protein known as C4 or AC4. Whereas C4/AC4 typically consists of more than 80 amino acid residues, a few are much shorter. The significance of these shorter C4/AC4 proteins in viral infection and why the virus maintains their abbreviated length is not yet understood. The AC4 of the begomovirus Tomato leaf curl Hsinchu virus contains only 65 amino acids, but it extends to 96 amino acids when the natural termination codon is replaced with a normal codon. We discovered that both interrupting and extending AC4 were harmful to tomato leaf curl Hsinchu virus (ToLCHsV). The extended AC4 (EAC4) also showed a reduced ability to promote the infection of the heterologous virus Potato virus X than the wild-type AC4. When the wild-type AC4 was fused with yellow fluorescent protein (AC4-YFP), it was predominantly found in chloroplasts, whereas EAC4-YFP was mainly localized to the cell periphery. These results suggest that ToLCHsV's AC4 protein is important for viral infection, and the virus may benefit from the abbreviated length, because it may lead to chloroplast localization. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Differential expression of genes during recovery of Nicotiana tabacum from tomato leaf curl Gujarat virus infection.

MAIN CONCLUSION: Nicotiana tabacum exhibits recovery response towards tomato leaf curl Gujarat virus. Transcriptome analysis revealed the differential expression of defense-related genes. Genes encoding for cysteine protease inhibitor, hormonal- and stress-related to DNA repair mechanism are found to be involved in the recovery process. Elucidating the role of host factors in response to viral infection is crucial in understanding the plant host-virus interaction. Begomovirus, a genus in the family Geminiviridae, is reported throughout the globe and is known to cause serious crop diseases. Tomato leaf curl Gujarat virus (ToLCGV) infection in Nicotiana tabacum resulted in initial symptom expression followed by a quick recovery in the systemic leaves. Transcriptome analysis using next-generation sequencing (NGS) revealed a large number of differentially expressed genes both in symptomatic as well as recovered leaves when compared to mock-inoculated plants. The virus infected N. tabacum results in alteration of various metabolic pathways, phytohormone signaling pathway, defense related protein, protease inhibitor, and DNA repair pathway. RT-qPCR results indicated that Germin-like protein subfamily T member 2 (NtGLPST), Cysteine protease inhibitor 1-like (NtCPI), Thaumatin-like protein (NtTLP), Kirola-like (NtKL), and Ethylene-responsive transcription factor ERF109-like (NtERTFL) were down-regulated in symptomatic leaves when compared to recovered leaves of ToLCGV-infected plants. In contrast, the Auxin-responsive protein SAUR71-like (NtARPSL) was found to be differentially down-regulated in recovered leaves when compared to symptomatic leaves and the mock-inoculated plants. Lastly, Histone 2X protein like (NtHH2L) gene was found to be down-regulated, whereas Uncharacterized (NtUNCD) was up-regulated in both symptomatic as well as recovered leaves compared to the mock-inoculated plants. Taken together, the present study suggests potential roles of the differentially expressed genes that might govern tobacco's susceptibility and/or recovery response towards ToLCGV infection.

How To Be a Successful Monopartite Begomovirus in a Bipartite-Dominated World: Emergence and Spread of Tomato Mottle Leaf Curl Virus in Brazil.

Begomoviruses are members of the family Geminiviridae, a large and diverse group of plant viruses characterized by a small circular single-stranded DNA genome encapsidated in twinned quasi-icosahedral virions. Cultivated tomato (Solanum lycopersicum L.) is particularly susceptible and is infected by >100 bipartite and monopartite begomoviruses worldwide. In Brazil, 25 tomato-infecting begomoviruses have been described, most of which are bipartite. Tomato mottle leaf curl virus (ToMoLCV) is one of the most important of these and was first described in the late 1990s but has not been fully characterized. Here, we show that ToMoLCV is a monopartite begomovirus with a genomic DNA similar in size and genome organization to those of DNA-A components of New World (NW) begomoviruses. Tomato plants agroinoculated with the cloned ToMoLCV genomic DNA developed typical tomato mottle leaf curl disease symptoms, thereby fulfilling Koch's postulates and confirming the monopartite nature of the ToMoLCV genome. We further show that ToMoLCV is transmitted by whiteflies, but not mechanically. Phylogenetic analyses placed ToMoLCV in a distinct and strongly supported clade with other begomoviruses from northeastern Brazil, designated the ToMoLCV lineage. Genetic analyses of the complete sequences of 87 ToMoLCV isolates revealed substantial genetic diversity, including five strain groups and seven subpopulations, consistent with a long evolutionary history. Phylogeographic models generated with partial or complete sequences predicted that the ToMoLCV emerged in northeastern Brazil >700 years ago, diversifying locally and then spreading widely in the country. Thus, ToMoLCV emerged well before the introduction of MEAM1 whiteflies, suggesting that the evolution of NW monopartite begomoviruses was facilitated by local whitefly populations and the highly susceptible tomato host. IMPORTANCE Worldwide, diseases of tomato caused by whitefly-transmitted geminiviruses (begomoviruses) cause substantial economic losses and a reliance on insecticides for management. Here, we describe the molecular and biological properties of tomato mottle leaf curl virus (ToMoLCV) from Brazil and establish that it is a NW monopartite begomovirus indigenous to northeastern Brazil. This answered a long-standing question regarding the genome of this virus, and it is part of an emerging group of these viruses in Latin America. This appears to be driven by widespread planting of the highly susceptible tomato and by local and exotic whiteflies. Our extensive phylogenetic studies placed ToMoLCV in a distinct strongly supported clade with other begomoviruses from northeastern Brazil and revealed new insights into the origin of Brazilian begomoviruses. The novel phylogeographic analysis indicated that ToMoLCV has had a long evolutionary history, emerging in northeastern Brazil >700 years ago. Finally, the tools used here (agroinoculation system and ToMoLCV-specific PCR test) and information on the biology of the virus (host range and whitefly transmission) will be useful in developing and implementing integrated pest management (IPM) programs targeting ToMoLCV.

Constant ratio between the genomic components of bipartite begomoviruses during infection and transmission.

The genomic components of multipartite viruses are encapsidated in separate virus particles, and the frequencies of genomic components represent one of the key genetic features. Many begomoviruses of economic significance are bipartite, and the details of the association between their genomic components remain largely unexplored. We first analyzed the temporal dynamics of the quantities of DNA-A and DNA-B and the B/A ratio of the squash leaf curl China virus (SLCCNV) in plants and found that while the quantities of DNA-A and DNA-B varied significantly during infection, the B/A ratio remained constant. We then found that changes in the B/A ratio in agrobacteria inoculum may significantly alter the B/A ratio in plants at 6 days post inoculation, but the differences disappeared shortly thereafter. We next showed that while the quantities of DNA-A and DNA-B among plants infected by agrobacteria, sap transmission and whitefly-mediated transmission differed significantly, the B/A ratios were similar. Further analysis of gene expression revealed that the ratio of the expression of genes encoded by DNA-A and DNA-B varied significantly during infection. Finally, we monitored the temporal dynamics of the quantities of DNA-A and DNA-B and the B/A ratio of another bipartite begomovirus, and a constant B/A ratio was similarly observed. Our findings highlight the maintenance of a constant ratio between the two genomic components of bipartite begomoviruses during infection and transmission, and provide new insights into the biology of begomoviruses.

Association of a novel begomovirus species with fenugreek yellow vein disease in India.

BACKGROUND: Fenugreek (Trigonella foenum-graecum L.) is an annual medicinal and spice crop belonging to the family Fabaceae. The occurrence of a yellow vein disease was recorded in fenugreek in Jodhpur (India) in 2022. The infection of begomoviruses in legume crops results in significant yield loss and major economic loss. The current study reports an association of a novel begomovirus species associated with yellow vein disease in Fenugreek. METHODS AND RESULTS: In symptomatic fenugreek plants, geminivirus-like particles were visible under a transmission electron microscope. Further, nucleotide sequence analysis of the rolling circle amplified product revealed 2743 nucleotide DNA-A genome with close relatedness to French bean leaf curl virus (88.21%) and Senna leaf curl virus (87.63%). It was proposed as a new begomovirus species, Fenugreek yellow vein Rajasthan virus. The genome organization suggested the presence of a typical nonanucleotide sequence along with 7 ORFs in DNA-A. A possible recombination event took place in the coat protein (V1) region with Pedilanthus leaf curl virus and Chilli leaf curl virus as major and minor parents. The recombinant virus poses possible threats to several other legume crops. To the best of our knowledge, this is the first report of the association of FeYVRaV with fenugreek yellow vein disease from northwestern India. CONCLUSIONS: In conclusion, the presence of a novel begomovirus species associated with yellow vein disease in fenugreek is alarming and needs further studies on its infectivity to prevent its spread to legume crops.

Identification of begomoviruses associated with the insect vector Bemisia tabaci and various host plants on Java Island, Indonesia.

Begomoviruses are economically important plant viruses and are transmitted by Bemisia tabaci which is a complex of various cryptic species. However, it is uncertain whether most begomoviruses that infect host plants are transmitted by B. tabaci at a similar rate. We compared the begomovirus profiles that were detected in a total of 37 whitefly populations and 52 host plants on Java Island, Indonesia. Seven begomovirus species were detected in B. tabaci at different rates: pepper yellow leaf curl Indonesia virus (PepYLCIV, 56.8%), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV, 46.0%), tomato leaf curl New Delhi virus (ToLCNDV, 21.6%), squash leaf curl China virus (SLCCNV, 21.6%), ageratum yellow vein China virus (AYVCNV, 2.7%), mungbean yellow mosaic India virus (MYMIV, 2.7%), and okra enation leaf curl virus (OELCuV, 2.7%). The begomoviruses were detected at different rates in three cryptic species of B. tabaci. In addition, six begomovirus species were detected in the various host plants at different rates: PepYLCIV (67.3%), TYLCKaV (53.9%), ToLCNDV (13.5%), MYMIV (11.5%), AYVCNV (3.9%), and Tomato yellow leaf curl Thailand virus (TYLCTHV) (1.9%). By comparing the virus presence between whiteflies and plants, five begomoviruses (AYVCNV, MYMIV, PepYLCIV, ToLCNDV, and TYLCKaV) were detected in both samples, but their sequence similarity was highly variable depending on the begomovirus themselves; TYLCKaV was highest (99.4%-100%) than any other viruses. Our study suggests B. tabaci acquire begomoviruses at different rates from plants. This study provides important information on the potential variation in the begomovirus transmission mechanism.

An Insight into Emerging Begomoviruses and their Satellite Complex causing Papaya Leaf Curl Disease.

Papaya leaf curl disease (PaLCD) was primarily detected in India and causes major economic damage to agriculture crops grown globally, seriously threatening food security. Begomoviruses are communicated by the vector Bemisia tabaci, and their transmission efficiency and persistence in the vector are the highest, exhibiting the widest host range due to adaptation and evolution. Symptoms induced during PaLCD include leaf curl, leaf yellowing, interveinal chlorosis, and reduced fruit quality and yield. Consequently, plants have evolved several multi-layered defense mechanisms to resist Begomovirus infection and distribution. Subsequently, Begomovirus genomes organise circular ssDNA of size ~2.5-2.7 kb of overlapping viral transcripts and carry six-seven ORFs encoding multifunctional proteins, which are precisely evolved by the viruses to maintain the genome-constraint and develop complex but integrated interactions with a variety of host components to expand and facilitate successful infection cycles, i.e., suppression of host defense strategies. Geographical distribution is continuing to increase due to the advent and evolution of new Begomoviruses, and sweep to new regions is a future scenario. This review summarizes the current information on the biological functions of papaya-infecting Begomoviruses and their encoded proteins in transmission through vectors and modulating host-mediated responses, which may improve our understanding of how to challenge these significant plant viruses by revealing new information on the development of antiviral approaches against Begomoviruses associated with PaLCD.