Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Circular RNA Circ_0001777 Suppresses Lung Adenocarcinoma Progression In Vitro and In Vivo.

Circular RNA_0001777 (circ_0001777) is reported to be down-regulated in lung cancer. Nevertheless, the function of circ_0001777 in lung adenocarcinoma is largely unclear. We explored the role of circ_0001777 in lung adenocarcinoma progression and the underlying molecular mechanism. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and Western blot assay were conducted to determine the expression of RNAs and proteins. 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide, 5-ethynyl-20-deoxyuridine, and colony formation assays were conducted to analyze cell proliferation ability. Flow cytometry was carried out to assess cell apoptosis rate. Cell migration and invasion abilities were analyzed by wound healing assay and transwell assays. Cell glycolytic metabolism was measured using a fluorescence-based glucose assay kit and a lactate oxidase-based colorimetric assay kit. Dual-luciferase reporter assay and RNA immunoprecipitation assay were implemented to verify the intermolecular interactions. Circ_0001777 expression was reduced in lung adenocarcinoma tissues and cell lines. Circ_0001777 overexpression restrained the proliferation, migration, invasion, and glycolysis and promoted the apoptosis of lung adenocarcinoma cells. Circ_0001777 could directly bind to microRNA-942-5p (miR-942-5p). The anti-tumor effects of circ_0001777 overexpression in lung adenocarcinoma cells were reversed after miR-942-5p accumulation. miR-942-5p directly bound to the 3' untranslated region (3'UTR) of prickle planar cell polarity protein 2 (PRICKLE2), and PRICKLE2 silencing reversed the anti-tumor effects of miR-942-5p knockdown in lung adenocarcinoma cells. Circ_0001777 could regulate PRICKLE2 expression by absorbing miR-942-5p. Circ_0001777 overexpression markedly hampered tumor progression in vivo. Circ_0001777 suppressed the progression of lung adenocarcinoma by binding to miR-942-5p to induce PRICKLE2 expression.

DNA methylation of Hugl-2 is a prognostic biomarker in kidney renal clear cell carcinoma.

It has been reported that loss of Hugl-2 contributes to tumour formation and progression in vitro and in vivo. However, whether Hugl-2 levels decrease during kidney renal clear cell carcinoma (KIRC) and the mechanism involved remain unknown. This study aimed to investigate whether DNA methylation of Hugl-2 reduces its expression, leading to the progression and poor prognosis of KIRC. Hugl-2 methylation and mRNA expression and KIRC clinicopathological data were extracted from The Cancer Genome Atlas (TCGA), and relationships among these factors were analyzed using UALCAN, MethHC, Wanderer and LinkedOmics web tools. We found that Hugl-2 mRNA and protein levels were reduced in KIRC tissues. Moreover, Hugl-2 mRNA levels were related to tumour grade and overall survival, and Hugl-2 methylation was increased in KIRC. According to the results of methylation-specific PCR, KIRC cells had higher Hugl-2 DNA methylation levels than HKC cells. Moreover, Hugl-2 DNA methylation correlated negatively with Hugl-2 mRNA and was also related to the pathology and T stage of KIRC patients. KIRC patients with high Hugl-2 DNA methylation also had shorter overall survival. Additionally, methylation of cg08827674, a Hugl-2 probe, was related to pathologic stage, T stage, neoplasm histologic grade, serum calcium level without laterality, M stage, N stage, and ethnicity. Furthermore, treatment with the DNA methylation inhibitor decitabine resulted in upregulation of Hugl-2 mRNA and protein levels in KIRC cell lines. These results indicate that Hugl-2 DNA methylation may be both a prognostic marker and a therapeutic target in KIRC.

LOXL2 promotes vasculogenic mimicry and tumour aggressiveness in hepatocellular carcinoma.

Lysyl oxidase-like 2 (LOXL2) has shown to promote metastasis and poor prognosis in hepatocellular carcinoma (HCC). Also, we have previously reported that vasculogenic mimicry (VM) is associated with invasion, metastasis and poor survival in HCC patients. In the present study, we investigated molecular function of LOXL2 in HCC and VM. We used the immunohistochemical and CD31/periodic acid-Schiff double staining to detect the relationship between LOXL2 and VM formation. We performed the gain and loss of function studies and analysed the migratory, invasion and tube formation in HCC cell lines. We analysed the function of LOXL2 in VM formation and HCC metastasis both in vitro and in vivo. We have showed that LOXL2 was overexpression in HCC and was positively correlated with tumour grade, metastasis, VM formation and poor survival in 201 HCC patients. Secondly, our studies have showed that LOXL2 overexpression in HCC cells significantly promoted migration, invasion and tube formation. Finally, we found that LOXL2 may increase SNAIL expression, thereby enabling VM. Our study indicated that LOXL2 may promote VM formation and tumour metastasis by collaborating with SNAIL in HCC. What's more, the overexpression of LOXL2 indicated a poor prognosis in HCC patients.

DNA methylation of CRB3 is a prognostic biomarker in clear cell renal cell carcinoma.

Our previous study revealed that CRB3 protein expression was reduced in clear cell renal cell carcinoma (ccRCC) and was associated with TNM stage, pathological grade, and poor prognosis of ccRCC. This study aimed to investigate if DNA methylation of CRB3 decreases its expression, subsequently leading to the progression and poor prognosis of ccRCC. Data for DNA methylation of CRB3, CRB3 mRNA expression, and ccRCC clinicopathological parameters were extracted from the cancer genome atlas (TCGA) database. The relationships among DNA methylation of CRB3, CRB3 mRNA expression, and ccRCC clinicopathological parameters were analyzed using UALCAN, MethHC, LinkedOmics, and Wanderer. We found that CRB3 mRNA levels were lower in ccRCC compared to normal tissues. Methylation of CRB3 increased in ccRCC, with all probes showing differences between ccRCC and normal tissues. Furthermore, CRB3 DNA methylation negatively correlated with CRB3 mRNA expression. CRB3 DNA methylation was also related to pathologic stage, T stage, N stage, and M stage of ccRCC. Overall survival was shorter in ccRCC patients with high CRB3 DNA methylation compared to ccRCC patients with low CRB3 DNA methylation. Methylation of cg24798010, a CRB3 probe, was related to laterality, pathologic stage, T stage, M stage, neoplasm-histologic-grade without N stage, and race. Furthermore, treatment with the DNA methylation inhibitor Decitabine resulted in the upregulation of CRB3 mRNA in ccRCC cell lines. These results indicate that DNA methylation of CRB3 may be both a prognostic marker and therapeutic target for ccRCC.

Cell Polarity Protein Pals1-Associated Tight Junction Expression Is a Favorable Prognostic Marker in Clear Cell Renal Cell Carcinoma.

Introduction: The Pals1-associated tight junction (PATJ) is a Crumbs (CRB) complex component that regulates epithelial cell apico-basal polarity and directional migration. This study assessed PATJ expression in clear cell renal cell carcinoma (ccRCC) vs. normal tissues and associated with ccRCC progression and prognosis. Methods: The effects of PATJ knockdown were investigated on regulation of normal kidney epithelial cell viability and protein expression in vitro. The PATJ mRNA data in ccRCC were obtained from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases and analyzed with UALCAN, LinkedOmics, Kaplan-Meier Plotter, GEPIA, and SurvExpress tools. Immunohistochemistry was performed for PATJ in tissue microarray sections (n = 150 ccRCC and 30 normal renal specimens). Normal human kidney tubular epithelial cell (HKC) cells were transfected with PATJ and negative control siRNA for cell viability CCK-8 assay, flow cytometry, and western blots. Results: The data showed that PATJ mRNA and protein were downregulated in ccRCC tissues and cell lines. Downregulation of PATJ mRNA was associated with male patients, advanced tumor stages, grades, and ccB subtypes as well as poorer overall and disease-free survival of patients. Furthermore, PATJ protein was also significantly downregulated in ccRCC tissues and associated with advanced tumor pathologic, TNM stages and poorer overall. In vitro, knockdown of PATJ expression promoted HKC proliferation and the activation of mitogen-activated protein kinases (MAPK) pathway proteins. Conclusions: This study revealed that a decrease of PATJ in ccRCC, which was associated with male patients, advanced tumor, and poorer survival, suggesting that PATJ may be a useful prognostic biomarker and therapeutic target for ccRCC.