2D Materials Kill Bacteria from Within.

Early work demonstrated that some two-dimensional (2D) materials could kill bacteria by using their sharp edges to physically rupture the bacteria envelope, which presents distinct advantages over traditional antibiotics, as bacteria are not able to evolve resistance to the former. This mechano-bactericidal mode of action, however, suffers from low antibacterial efficiency, fundamentally because of random orientation of 2D materials outside the bacteria, where the desirable "edge-to-envelope" contacts occur with low probability. Here, we demonstrate a proof-of-concept approach to significantly enhance the potency of the mechano-bactericidal activity of 2D materials. This approach is in marked contrast with previous work, as the 2D materials are designed to be in situ generated inside the bacteria from a molecularly engineered monomer in a self-assembled manner, profoundly promoting the probability of the "edge-to-envelope" contacts. The rationale in this study sheds light on a mechanically new nanostructure-enabled antibacterial strategy to combat antibiotic resistance.

Cy-1, a major QTL for tomato leaf curl New Delhi virus resistance, harbors a gene encoding a DFDGD-Class RNA-dependent RNA polymerase in cucumber (Cucumis sativus).

BACKGROUND: Tomato leaf curl New Delhi virus (ToLCNDV) (family Geminiviridae, genus Begomovirus) is a significant threat to cucumber (Cucumis sativus) production in many regions. Previous studies have reported the genetic mapping of loci related to ToLCNDV resistance, but no resistance genes have been identified. RESULTS: We conducted map-based cloning of the ToLCNDV resistance gene in cucumber accession No.44. Agroinfiltration and graft-inoculation analyses confirmed the resistance of No.44 to ToLCNDV isolates from the Mediterranean and Asian countries. Initial mapping involving two rounds of phenotyping with two independent F2 populations generated by crossing the begomovirus-susceptible cultivar SHF and No.44 consistently detected major quantitative trait loci (QTLs) on chromosomes 1 and 2 that confer resistance to ToLCNDV. Fine-mapping of Cy-1, the dominant QTL on chromosome 1, using F3 populations narrowed the candidate region to a 209-kb genomic segment harboring 24 predicted genes. Among these genes, DFDGD-class RNA-dependent RNA polymerase (CsRDR3), an ortholog of Ty-1/Ty-3 of tomato and Pepy-2 of capsicum, was found to be a strong candidate conferring ToLCNDV resistance. The CsRDR3 sequence of No.44 contained multiple amino acid substitutions; the promoter region of CsRDR3 in No.44 had a large deletion; and the CsRDR3 transcript levels were greater in No.44 than in SHF. Virus-induced gene silencing (VIGS) of CsRDR3 using two chromosome segment substitution lines harboring chromosome 1 segments derived from No.44 compromised resistance to ToLCNDV. CONCLUSIONS: Forward and reverse genetic approaches identified CsRDR3, which encodes a DFDGD-class RNA-dependent RNA polymerase, as the gene responsible for ToLCNDV resistance at the major QTL Cy-1 on chromosome 1 in cucumber. Marker-assisted breeding of ToLCNDV resistance in cucumber will be expedited by using No.44 and the DNA markers developed in this study.

A Cucurbit[8]uril-Based Supramolecular Framework Material for Reversible Iodine Capture in the Vapor Phase and Solution.

The safe and efficient management of hazardous radioactive iodine is significant for nuclear waste reprocessing and environmental industries. A novel supramolecular framework compound based on cucurbit[8]uril (Q[8]) and 4-aminopyridine (4-AP) is reported in this paper. In the single crystal structure of Q[8]-(4-AP), two 4-AP molecules interact with the outer surface of Q[8] and the two other 4-AP molecules are encapsulated into the Q[8] cavity to form the self-assembly Q[8]-(4-AP). Iodine adsorption experiments show that the as-prepared Q[8]-(4-AP) not only has a high adsorption capacity (1.74 g· g-1) for iodine vapor but also can remove the iodine in the organic solvent and the aqueous solution with the removal efficiencies of 95% and 91%, respectively. The presence of a large number of hydrogen bonds between the iodine molecule and the absorbent, as seen in the single crystal structure of iodine-loaded Q[8]-(4-AP) (I2@Q[8]-(4-AP)), is thought to be responsible for the exceptional iodine adsorption capacity of the material. In addition, the adsorption-desorption tests reveal that the self-assembly material has no significant loss of iodine capture capacity after five cycles, indicating that it has sufficient reusability.

Viologen-Cucurbit[7]uril Based Polyrotaxanated Covalent Organic Networks: A Metal Free Electrocatalyst for Oxygen Evolution Reaction.

Viologen-based covalent organic networks represent a burgeoning class of materials distinguished by their captivating properties. Here, supramolecular chemistry is harnessed to fabricate polyrotaxanated ionic covalent organic polymers (iCOP) through a Schiff-base condensation reaction under solvothermal conditions. The reaction between 1,1'-bis(4-aminophenyl)-[4,4'-bipyridine]-1,1'-diium dichloride (DPV-NH2) and 1,3,5-triformylphloroglucinol (TPG) in various solvents yields an iCOP-1 and iCOP-2. Likewise, employing cucurbit[7]uril (CB[7]) in the reaction yielded polyrotaxanated iCOPs, denoted as iCOP-CB[7]-1 and iCOP-CB[7]-2. All four iCOPs exhibit exceptional stability under the acidic and basic conditions. iCOP-CB[7]-2 displays outstanding electrocatalytic Oxygen Evolution Reaction (OER) performance, demanding an overpotential of 296 and 332 mV at 10 and 20 mA cm-2, respectively. Moreover, the CB[7] integrated iCOP-2 exhibits a long-term stable nature for 30 h in 1 m KOH environment. Further, intrinsic activity studies like TOF show a 4.2-fold increase in generation of oxygen (O2) molecules than the bare iCOP-2. Also, it is found that iCOP-CB[7]-2 exhibits a high specific (19.48 mA cm-2) and mass activity (76.74 mA mg-1) at 1.59 V versus RHE. Operando-EIS study evident that iCOP-CB[7]-2 commences OER at a relatively low applied potential of 1.5 V versus RHE. These findings pave the way for a novel approach to synthesizing various mechanically interlocked molecules through straightforward solvothermal conditions.

Responsive Supramolecular Nanomicelles Formed through Self-Assembly of Acyclic Cucurbit[n]uril for Targeted Drug Delivery to Cancer Cells.

The supramolecular drug delivery systems (SDDSs) based on host-guest recognition through noncovalent interactions, capable of responsive behavior and dynamic switching to external stimuli, have attracted considerable attention in cancer therapy. In this study, a targeted dual-functional drug delivery system was designed and synthesized. A hydrophilic macrocyclic host molecule (acyclic cucurbit[n]uril ACB) was modified with folic acid (FA) as a targeting ligand. The guest molecule consists of a disulfide bond attached to adamantane (DA) and cannabidiol (CBD) at both ends of the response element of glutathione. Recognition and self-assembly of host and guest molecules successfully functionalize supramolecular nanomicelles (SNMs), targeting cancer cells and releasing drugs in a high glutathione environment. The interactions between host and guest molecules were investigated by using nuclear magnetic resonance (NMR), fluorescence titration, Fourier-transform infrared spectroscopy (FT-IR), and thermal analysis (TGA). Transmission electron microscopy (TEM) and dynamic light scattering (DLS) confirmed the nanostructure of the SNMs. Experimentation with 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB) demonstrated the responsiveness of SNMs to glutathione (GSH). In vitro cytotoxicity assays demonstrated that SNMs had a greater targeting efficacy for four types of cancer cells (HeLa, HCT-116, A549, and HepG2) compared to normal 293T cells. Cellular uptake studies revealed that HeLa cells more readily absorbed SNMs, leading to their accumulation in the tumor cell cytoplasm. Fluorescence colocalization assays verified that SNMs efficiently accumulated in organelles related to energy metabolism and signaling, including mitochondria and the endoplasmic reticulum, affecting cellular metabolic death. Both flow cytometry and confocal nuclear staining assays confirmed that SNMs effectively induced apoptosis over time, ultimately resulting in the death of cancer cells. These findings demonstrate that SNMs exhibit excellent targeting ability, responsiveness, high bioavailability, and stability, suggesting significant potential in drug delivery applications.

Leucine 127 of Cucurbit Chlorotic Yellows Virus P22 Is Crucial for Its RNA Silencing Suppression Activity and Pathogenicity.

Plant viruses produce particular suppressors to antagonize the host defense response of RNA silencing to establish infection. Cucurbit chlorotic yellows virus (CCYV), a member of the genus Crinivirus of the family Closteroviridae, severely damages the production of economically essential cucurbits worldwide. Here, we used the attenuated zucchini yellow mosaic virus (ZYMV) vector ZAC to express individual coding sequences, including CP, CPm, P25, and P22, of a Taiwan CCYV isolate (CCYV-TW) to identify their possible roles as pathogenicity determinants. ZAC is an HC-Pro function mutant that lacks the ability of local lesion induction on Chenopodium quinoa leaves and induces mild mottling followed by recovery on its natural host zucchini squash plants. Only the recombinant expressing CCYV-TW P22 complemented the effect of ZAC HC-Pro dysfunction, causing more severe symptoms on zucchini squash plants and restoring lesion formation on C. quinoa leaves, with lesions forming faster than those generated by the wild-type ZYMV. This suggests that CCYV-TW P22 is a virulence enhancer. Sequence analysis of criniviral P22s revealed the presence of four conserved leucine residues (L10, L17, L84, and L127) and one conserved lysine residue (K185). The five P22 residues conserved among the CCYV isolates and the P22 orthologs of two other criniviruses were each substituted with alanine in CCYV-TW P22 to investigate its ability to suppress RNA silencing and pathogenicity. The results provide new insights into CCYV-P22, showing that the L127 residue of P22 is indispensable for maintaining its stability in RNA silencing suppression and essential for virulence enhancement.

Cucurbit[8]uril-based supramolecular theranostics.

Different from most of the conventional platforms with dissatisfactory theranostic capabilities, supramolecular nanotheranostic systems have unparalleled advantages via the artful combination of supramolecular chemistry and nanotechnology. Benefiting from the tunable stimuli-responsiveness and compatible hierarchical organization, host-guest interactions have developed into the most popular mainstay for constructing supramolecular nanoplatforms. Characterized by the strong and diverse complexation property, cucurbit[8]uril (CB[8]) shows great potential as important building blocks for supramolecular theranostic systems. In this review, we summarize the recent progress of CB[8]-based supramolecular theranostics regarding the design, manufacture and theranostic mechanism. Meanwhile, the current limitations and corresponding reasonable solutions as well as the potential future development are also discussed.

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

First report of cucurbit yellow vine disease caused by Serratia marcescens on cucurbit crops in Iowa.

Cucurbit yellow vine disease (CYVD) is caused by Serratia marcescens, vectored by squash bugs (Anasa tristis), and is an emerging disease in many parts of the U.S. CYVD can cause 100% yield losses in cucurbits (Bruton et al., 2003). In the summer of 2021, at the Iowa State University Horticultural Research Station (HRS) in Gilbert, Iowa, we observed leaf yellowing, vine decline, and honey-brown discoloration of the phloem of acorn squash (Cucurbita pepo cv. Table Ace) plants in research fields that were infested with squash bugs. In 2022, we observed similar symptoms on pumpkin (Cucurbita maxima cv. Howden) and muskmelon (Cucumis melo cv. Athena) in different fields at the HRS and on giant pumpkins (Cucurbita maxima cv. Prizewinner) in Jones and Ringgold counties. For up to 3 symptomatic plants of each cucurbit species per location, a 20-cm-long stem section immediately above the soil line was excised, surface sterilized by immersion in 10% sodium hypochlorite and 70% ethanol for 2 min each, then triple rinsed in sterile water. The interior of the cross-section tissue was blotted on Luria agar amended with cycloheximide (100 µg/ml) and tetracycline (20 µg/ml) (Stock et al. 2003). Whitish translucent colonies developed after incubation at 28°C for 48 h. The genomic DNA of three isolates from symptomatic plants of muskmelon (MK01), pumpkin (HFP01), and giant pumpkin (AP01), was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). S. marcescens species-specific primers YV1 (5'-GGGACTTGCTCCCCGG-3') and YV4 (5'-AACGTCAATTGATGAACGTATTAAGT-3') (Bruton et al. 2003) were used to amplify part of the 16S rDNA gene, and the primers specific to S. marcescens CYVD strains A79F/A79R (Zhang et al., 2005) were used to amplify part of a major facilitatory superfamily (MFS) transporter gene strain. The sequences of the 16S rRNA PCR product for the three isolates were identical and were deposited in NCBI under Accession OR963533. They shared 100% (395/395 nt) identity with other CYVD strains (Rascoe et al. 2003) and those of other S. marcescens strains in NCBI. The sequences of the amplified region of the MFS transporter gene of the three isolates (NCBI Accession OR962261) were identical and showed a 98.8% (319/323 nt) identity to that of non-CYVD-causing S. marcescens strains, such as N10A28 (Accession CP033623.1). Koch's postulates were fulfilled by inoculating C. pepo cv. Zephyr plants with either strain HFP01 or phosphate buffer saline (PBS) (10 plants per treatment) 1 wk after seeding by injecting 300 µl of bacteria (~108 CFU/ml) or PBS using a syringe needle. Plants were incubated at 28°C in a growth room for 4 wks. CYVD symptoms similar to those observed in the field developed on 7 out of 10 plants inoculated with strain HFP01 in one study, and 9 out 10 plants in a replicate study, with none of the PBS-inoculated plants showing CYVD symptoms. Bacteria were isolated from the symptomatic plants with selection on tetracycline. The PCR fragments amplified with YV1/YV4 and A79F/A79R were the same size as those of the pre-inoculation strain HFP01. To our knowledge this is the first report of CYVD in Iowa and in the Upper Midwest of the U.S. CYVD is a devastating disease that poses a significant threat to cucurbit production. This report can serve as an alert for the region's growers and for the development of effective management practices.

Locking Patterned Carbon Nanotube Cages by Nanofibrous Mats to Construct Cucurbituril[n]-Based Ultrapermselective Dye/Salt Separation Membranes.

Surface patterning is a promising strategy to overcome the trade-off effect of separation membranes. Herein, a bottom-up patterning strategy of locking micron-sized carbon nanotube cages (CNCs) onto a nanofibrous substrate is developed. The strongly enhanced capillary force triggered by the abundant narrow channels in CNCs endows the precisely patterned substrate with excellent wettability and antigravity water transport. Both are crucial for the preloading of cucurbit[n]uril (CB6)-embeded amine solution to form an ultrathin (∼20 nm) polyamide selective layer clinging to CNCs-patterned substrate. The CNCs-patterning and CB6 modification result in a 40.2% increased transmission area, a reduced thickness, and a lowered cross-linking degree of selective layer, leading to a high water permeability of 124.9 L·m-2 h-1 bar-1 and a rejection of 99.9% for Janus Green B (511.07 Da), an order of magnitude higher than that of commercial membranes. The new patterning strategy provides technical and theoretical guidance for designing next-generation dye/salt separation membranes.

Comparative Genomic Analysis of PEBP Genes in Cucurbits Explores the Interactors of Cucumber CsPEBPs Related to Flowering Time.

The family of phosphatidylethanolamine-binding proteins (PEBPs) participates in various plant biological processes, mainly flowering regulation and seed germination. In cucurbit crops, several PEBP genes have been recognized to be responsible for flowering time. However, the investigation of PEBP family members across the genomes of cucurbit species has not been reported, and their conservation and divergence in structure and function remain largely unclear. Herein, PEBP genes were identified from seven cucurbit crops and were used to perform a comparative genomics analysis. The cucurbit PEBP proteins could be classified into MFT, FT, TFL, and PEBP clades, and further, the TFL clade was divided into BFT-like, CEN-like, and TFL1-like subclades. The MFT-like, FT-like, and TFL-like proteins were clearly distinguished by a critical amino acid residue at the 85th position of the Arabidopsis FT protein. In gene expression analysis, CsaPEBP1 was highly expressed in flowers, and its expression levels in females and males were 70.5 and 89.2 times higher, respectively, than those in leaves. CsaPEBP5, CsaPEBP6, and CsaPEBP7 were specifically expressed in male flowers, with expression levels 58.1, 17.3, and 15.7 times higher, respectively, than those of leaves. At least five CsaPEBP genes exhibited the highest expression during the later stages of corolla opening. Through clustering of time-series-based RNA-seq data, several potential transcription factors (TFs) interacting with four CsaPEBPs were identified during cucumber corolla opening. Because of the tandem repeats of binding sites in promoters, NF-YB (Csa4G037610) and GATA (Csa7G64580) TFs appeared to be better able to regulate the CsaPEBP2 and CsaPEBP5 genes, respectively. This study would provide helpful information for further investigating the roles of PEBP genes and their interacting TFs in growth and development processes, such as flowering time regulation in cucurbit crops.

Density Functional Theory Prediction of Laser Dyes-Cucurbit[7]uril Binding Affinities.

Among a variety of diverse host molecules distinguished by specific characteristics, the cucurbit[n]uril (CB) family stands out, being widely known for the attractive properties of its representatives along with their increasingly expanding area of applications. The presented herewith density functional theory (DFT)-based study is inspired by some recent studies exploring CBs as a key component in multifunctional hydrogels with applications in materials science, thus considering CB-assisted supramolecular polymeric hydrogels (CB-SPHs), a new class of 3D cross-linked polymer materials. The research systematically investigates the inclusion process between the most applied representative of the cavitand family CB[7] and a series of laser dye molecules as guests, as well as the possible encapsulation of a model side chain from the photoanisotropic polymer PAZO and its sodium-containing salt. The obtained results shed light on the most significant factors that play a key role in the recognition process, such as binding mode, charge, and dielectric constant of the solvent. The observed findings provide valuable insights at a molecular level for the design of dye-CB[7] systems in various environments, with potential applications in intriguing and prosperous fields like photonics and material science.

Preparation, characterization and heat release behavior of inclusion complexes formed between carvone or limonene and acyclic cucurbit[n]urils.

BACKGROUND: Carvone and limonene are naturally occurring monoterpenoids with unique aromas, making them valuable substances in synthetic fragrance production. However, their application is limited due to low stability and rapid volatilization. To address this challenge, host-guest complexes offer a promising solution. RESULTS: In this study, two acyclic cucurbit[n]urils were synthesized to form inclusion complexes with carvone and limonene, aiming to enhance their thermal stability and achieve excellent heat release properties. The binding behavior of the complexes was investigated using NMR, X-ray diffraction (XRD), Fourier transform infrared (FTIR) and molecular bonding analyses, confirming the formation of host-guest inclusion complexes. CONCLUSION: Our study successfully prepared four inclusion complexes (M1/CA, M2/CA, M1/LI, M2/LI) and characterized them using NMR, XRD and FTIR techniques. These complexes exhibited a 1:1 stoichiometric ratio, and their binding constants were determined through fluorescence titration. The thermal controlled release experiment shows that the degree of carvone and limonene release is different with a change of temperature, indicating that the inclusion complexes have good thermally controlled release performance, and the thermal release retention rate has a certain correlation with KS value. The larger the KS value, the higher the thermal release retention rate of the inclusion complexes, the lower the volatilization of the inclusion complexes, the longer the retention time and the better the thermal stability. This study presents a novel approach for developing carvone- and limonene-based fragrances, expanding their application potential in various industries. © 2024 Society of Chemical Industry.

Supramolecular Genome Editing: Targeted Delivery and Endogenous Activation of CRISPR/Cas9 by Dynamic Host-Guest Recognition.

We synthesize supramolecular poly(disulfide) (CPS) containing covalently attached cucurbit[7]uril (CB[7]), which is exploited not only as a carrier to deliver plasmid DNA encoding destabilized Cas9 (dsCas9), but also as a host to include trimethoprim (TMP) by CB[7] moieties through the supramolecular complexation to form TMP@CPS/dsCas9. Once the plasmid is transfected into tumor cells by CPS, the presence of polyamines can competitively trigger the decomplexation of TMP@CPS, thereby displacing and releasing TMP from CB[7] to stabilize dsCas9 that can target and edit the genomic locus of PLK1 to inhibit the growth of tumor cells. Following the systemic administration of TMP@CPS/dsCas9 decorated with hyaluronic acid (HA), tumor-specific editing of PLK1 is detected due to the elevated polyamines in tumor microenvironment, greatly minimizing off-target editing in healthy tissues and non-targeted organs. As the metabolism of polyamines is dysregulated in a wide range of disorders, this study offers a supramolecular approach to precisely control CRISPR/Cas9 functions under particular pathological contexts.

Cucurbit[8]uril-Mediated Supramolecular Heterodimerisation and Photoinduced [2+2] Heterocycloaddition to Generate Unexpected [2]Rotaxanes.

In contrast to the self-assembly of homosupramolecules, the self-assembly of heterosupramolecules is more challenging and significant in various fields. Herein, we design and investigate a cucurbit[8]uril-mediated heterodimerisation based on an arene-fluoroarene strategy. Furthermore, the heteroternary complex is found to be able to undergo a photoinduced [2+2] heterocycloaddition, resulting in the formation of an unexpected [2]rotaxane. This work demonstrates a novel supramolecular heterodimerisation system that not only contributes to the development of photoisomerisation systems, but also enriches synthetic methods for mechanically interlocked molecules.

Genome-wide characterization of long terminal repeat retrotransposons provides insights into trait evolution of four cucurbit species.

Cucurbits are a diverse plant family that includes economically important crops, such as cucumber, watermelon, melon, and pumpkin. Knowledge of the roles that long terminal repeat retrotransposons (LTR-RTs) have played in diversification of cucurbit species is limited; to add to understanding of the roles of LTR-RTs, we assessed their distributions in four cucurbit species. We identified 381, 578, 1086, and 623 intact LTR-RTs in cucumber (Cucumis sativus L. var. sativus cv. Chinese Long), watermelon (Citrullus lanatus subsp. vulgaris cv. 97103), melon (Cucumis melo cv. DHL92), and Cucurbita (Cucurbita moschata var. Rifu), respectively. Among these LTR-RTs, the Ale clade of the Copia superfamily was the most abundant in all the four cucurbit species. Insertion time and copy number analysis revealed that an LTR-RT burst occurred approximately 2 million years ago in cucumber, watermelon, melon, and Cucurbita, and may have contributed to their genome size variation. Phylogenetic and nucleotide polymorphism analyses suggested that most LTR-RTs were formed after species diversification. Analysis of gene insertions by LTR-RTs revealed that the most frequent insertions were of Ale and Tekay and that genes related to dietary fiber synthesis were the most commonly affected by LTR-RTs in Cucurbita. These results increase our understanding of LTR-RTs and their roles in genome evolution and trait characterization in cucurbits.

Tunable Multicolor Lanthanide Supramolecular Assemblies with White Light Emission Confined by Cucurbituril[7].

Macrocyclic confinement-induced supramolecular luminescence materials have important application value in the fields of bio-sensing, cell imaging, and information anti-counterfeiting. Herein, a tunable multicolor lanthanide supramolecular assembly with white light emission is reported, which is constructed by co-assembly of cucurbit[7]uril (CB[7]) encapsulating naphthylimidazolium dicarboxylic acid (G1 )/Ln (Eu3+ /Tb3+ ) complex and carbon quantum dots (CD). Benefiting from the macrocyclic confinement effect of CB[7], the supramolecular assembly not only extends the fluorescence intensity of the lanthanide complex G1 /Tb3+ by 36 times, but also increases the quantum yield by 28 times and the fluorescence lifetime by 12 times. Furthermore, the CB[7]/G1 /Ln assembly can further co-assemble with CD and diarylethene derivatives (DAE) to realize the intelligently-regulated full-color spectrum including white light, which results from the competitive encapsulation of adamantylamine and CB[7], the change of pH, and photochromic DAE. The multi-level logic gate based on lanthanide supramolecular assembly is successfully applied in anti-counterfeiting system and information storage, providing an effective method for the research of new luminescent intelligent materials.

A Combination of Bio-Orthogonal Supramolecular Clicking and Proximity Chemical Tagging as a Supramolecular Tool for Discovery of Putative Proteins Associated with Laminopathic Disease.

Protein mutations alter protein-protein interactions that can lead to a number of illnesses. Mutations in lamin A (LMNA) have been reported to cause laminopathies. However, the proteins associated with the LMNA mutation have mostly remained unexplored. Herein, a new chemical tool for proximal proteomics is reported, developed by a combination of proximity chemical tagging and a bio-orthogonal supramolecular latching based on cucurbit[7]uril (CB[7])-based host-guest interactions. As this host-guest interaction acts as a noncovalent clickable motif that can be unclicked on-demand, this new chemical tool is exploited for reliable detection of the proximal proteins of LMNA and its mutant that causes laminopathic dilated cardiomyopathy (DCM). Most importantly, a comparison study reveals, for the first time, mutant-dependent alteration in LMNA proteomic environments, which allows to identify putative laminopathic DCM-linked proteins including FOXJ3 and CELF2. This study demonstrates the feasibility of this chemical tool for reliable proximal proteomics, and its immense potential as a new research platform for discovering biomarkers associated with protein mutation-linked diseases.

Unveiling the Collaborative Effect at the Cucurbit[8]uril-MoS2 Hybrid Interface for Electrochemical Melatonin Determination.

Host-guest interactions are of paramount importance in supramolecular chemistry and in a wide range of applications. Particularly well known is the ability of cucurbit[n]urils (CB[n]) to selectively host small molecules. We show that the charge transfer and complexation capabilities of CB[n] are retained on the surface of 2D transition metal dichalcogenides (TMDs), allowing the development of efficient electrochemical sensing platforms. We unveil the mechanisms of host-guest recognition between the MoS2 -CB[8] hybrid interface and melatonin (MLT), an important molecular regulator of vital constants in vertebrates. We find that CB[8] on MoS2 organizes the receptor portals perpendicularly to the surface, facilitating MLT complexation. This advantageous adsorption geometry is specific to TMDs and favours MLT electro-oxidation, as opposed to other 2D platforms like graphene, where one receptor portal is closed. This study rationalises the cooperative interaction in 2D hybrid systems to improve the efficiency and selectivity of electrochemical sensing platforms.