RESUMO
Sickle cell disease (SCD) is a common genetic blood disorder associated with acute and chronic pain, progressive multiorgan damage, and early mortality. Recent advances in technologies to manipulate the human genome, a century of research and the development of techniques enabling the isolation, efficient genetic modification, and reimplantation of autologous patient hematopoietic stem cells (HSCs), mean that curing most patients with SCD could soon be a reality in wealthy countries. In parallel, ongoing research is pursuing more facile treatments, such as in-vivo-delivered genetic therapies and new drugs that can eventually be administered in low- and middle-income countries where most SCD patients reside.
Assuntos
Anemia Falciforme , Transplante de Células-Tronco Hematopoéticas , Humanos , Anemia Falciforme/genética , Anemia Falciforme/terapia , Edição de Genes/métodos , Células-Tronco Hematopoéticas , Terapia GenéticaRESUMO
ß-thalassemia is an inherited blood disease caused by reduced or inadequate ß-globin synthesis due to ß-globin gene mutation. Our previous study developed a gene-edited mice model (ß654-ER mice) by CRISPR/Cas9-mediated genome editing, targeting both the ßIVS2-654 (Câ >â T) mutation site and the 3' splicing acceptor site at 579 and corrected abnormal ß-globin mRNA splicing in the ß654-thalassemia mice. Herein, we further explored the therapeutic effect of the hematopoietic stem cells (HSCs) from ß654-ER mice on ß-thalassemia by consecutive HSC transplantation. The results indicated that HSC transplantation derived from gene-edited mice can significantly improve the survival rate of mice after lethal radiation doses and effectively achieve hematopoietic reconstruction and long-term hematopoiesis. Clinical symptoms, including hematologic parameters and tissue pathology of transplanted recipients, were significantly improved compared to the non-transplanted ß654 mice. The therapeutic effect of gene-edited HSC transplantation demonstrated no significant difference in hematological parameters and tissue pathology compared with wild-type mouse-derived HSCs. Our data revealed that HSC transplantation from gene-edited mice completely recovered the ß-thalassemia phenotype. Our study systematically investigated the therapeutic effect of HSCs derived from ß654-ER mice on ß-thalassemia and further confirmed the efficacy of our gene-editing approach. Altogether, it provided a reference and primary experimental data for the clinical usage of such gene-edited HSCs in the future.
Assuntos
Transplante de Células-Tronco Hematopoéticas , Talassemia , Talassemia beta , Camundongos , Animais , Talassemia beta/genética , Talassemia beta/terapia , Edição de Genes , Células-Tronco Hematopoéticas , Globinas beta/genéticaRESUMO
In recent years, a growing number of clinical trials have been initiated to evaluate gene therapy approaches for the treatment of patients with transfusion-dependent ß-thalassemia and sickle cell disease (SCD). Therapeutic modalities being assessed in these trials utilize different molecular techniques, including lentiviral vectors to add functional copies of the gene encoding the hemoglobin ß subunit in defective cells and CRISPR-Cas9, transcription activator-like effector protein nuclease, and zinc finger nuclease gene editing strategies to either directly address the underlying genetic cause of disease or induce fetal hemoglobin production by gene disruption. Here, we review the mechanisms of action of these various gene addition and gene editing approaches and describe the status of clinical trials designed to evaluate the potentially for these approaches to provide one-time functional cures to patients with transfusion-dependent ß-thalassemia and SCD.
Assuntos
Terapia Genética , Hemoglobinopatias , Animais , Humanos , Anemia Falciforme/terapia , Anemia Falciforme/genética , Talassemia beta/terapia , Talassemia beta/genética , Ensaios Clínicos como Assunto , Sistemas CRISPR-Cas , Edição de Genes/métodos , Terapia Genética/métodos , Vetores Genéticos/genética , Vetores Genéticos/administração & dosagem , Hemoglobinopatias/terapia , Hemoglobinopatias/genética , Lentivirus/genéticaRESUMO
Thalassemias are a group of inherited monogenic disorders characterized by defects in the synthesis of one or more of the globin chain subunits of the hemoglobin tetramer. Delta-beta (δß-) thalassemia has large deletions in the ß globin gene cluster involving δ- and ß-globin genes, leading to absent or reduced synthesis of both δ- and ß-globin chains. Here, we used direct globin-chain analysis using tandem mass spectrometry for the diagnosis of δß-thalassemia. Two cases from unrelated families were recruited for the study based on clinical and hematological evaluation. Peptides obtained after trypsin digestion of proteins extracted from red blood cell pellets from two affected individuals and their parents were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Mass spectrometric analysis revealed a severe reduction in δ, ß, and Aγ globin proteins with increased Gγ globin protein in the affected individuals. The diagnosis of Gγ(Aγδß)0 -thalassemia in the homozygous state in the affected individuals and in the heterozygous state in the parents was made from our results. The diagnosis was confirmed at the genetic level using multiplex ligation-dependent probe amplification (MLPA). Our findings demonstrate the utility of direct globin protein quantitation using LC-MS/MS to quantify individual globin proteins reflecting changes in globin production. This approach can be utilized for accurate and timely diagnosis of hemoglobinopathies, including rare variants, where existing diagnostic methods provide inconclusive results.
Assuntos
Espectrometria de Massas em Tandem , Humanos , Espectrometria de Massas em Tandem/métodos , Masculino , Feminino , Cromatografia Líquida/métodos , Globinas beta/genética , gama-Globinas/genéticaRESUMO
Hb H disease is the most severe form of α-thalassemia compatible with post-natal life. Compound heterozygous α0-thalassemia- SEA deletion/α+-thalassemia- 3.7kb deletion is the commonest cause of Hb H disease in Thailand. Preimplantation genetics testing for monogenic disorders (PGT-M) is an alternative for couples at risk of the disorder to begin a pregnancy with a healthy baby. This study aims to develop a novel PCR protocol for PGT-M of Hb H disease- SEA/-3.7kb using multiplex fluorescent PCR. A novel set of primers for α+-thalassemia- 3.7kb deletion was developed and tested. The PCR protocol for α0-thalassemia- SEA deletion was combined for Hb H disease- SEA/-3.7kb genotyping. The PCR protocols were applied to genomic DNA extracted from subjects with different thalassemia genotypes and on whole genome amplification (WGA) products from clinical PGT-M cycles of the families at risk of Hb Bart's. The results were compared and discussed. The results showed three PCR products from α+-thalassemia- 3.7kb primer set, and three from α0thalassemiaSEA primer set. The results were consistent with the known thalassemia genotypes. The novel -α3.7 primers protocol was also tested on 37 WGA products from clinical PGT-M cycles giving accurate genotyping results and a satisfying amplification efficiency with the ADO rates of 2.7%, 0%, and 0% for HBA2, HBA1, and internal control fragments, respectively. This novel PCR protocol can precisely distinguish Hb H disease- SEA/-3.7kb from other genotypes. Additionally, this is the first PCR protocol for Hb H disease- SEA/-3.7kb which is optimal for PGT-M.
Assuntos
Testes Genéticos , Diagnóstico Pré-Implantação , Talassemia alfa , Humanos , Talassemia alfa/genética , Talassemia alfa/diagnóstico , Diagnóstico Pré-Implantação/métodos , Testes Genéticos/métodos , Feminino , Gravidez , GenótipoRESUMO
I have been fortunate and privileged to have participated in amazing breakthroughs in human genetics since the 1960s. I was lucky to have trained in medical school at Dartmouth and Johns Hopkins, in pediatrics at the University of Minnesota and Johns Hopkins, and in genetics and molecular biology with Dr. Barton Childs at Johns Hopkins and Dr. Harvey Itano at the National Institutes of Health. Later, the collaborative spirit at Johns Hopkins and the University of Pennsylvania were important to my career. Here, I describe the thrill of scientific discovery in two diverse areas of human genetics: DNA haplotypes and their role in solving the molecular basis of beta thalassemia and the role of retrotransposons (jumping genes) in human biology. I hope that this article may inspire others who love human genetics as much as I do.
Assuntos
Genética Humana , Criança , HumanosRESUMO
The fetal-to-adult hemoglobin switch is regulated in a developmental stage-specific manner and reactivation of fetal hemoglobin (HbF) has therapeutic implications for treatment of ß-thalassemia and sickle cell anemia, two major global health problems. Although significant progress has been made in our understanding of the molecular mechanism of the fetal-to-adult hemoglobin switch, the mechanism of epigenetic regulation of HbF silencing remains to be fully defined. Here, we performed whole-genome bisulfite sequencing and RNA sequencing analysis of the bone marrow-derived GYPA+ erythroid cells from ß-thalassemia-affected individuals with widely varying levels of HbF groups (HbF ≥ 95th percentile or HbF ≤ 5th percentile) to screen epigenetic modulators of HbF and phenotypic diversity of ß-thalassemia. We identified an ETS2 repressor factor encoded by ERF, whose promoter hypermethylation and mRNA downregulation are associated with high HbF levels in ß-thalassemia. We further observed that hypermethylation of the ERF promoter mediated by enrichment of DNMT3A leads to demethylation of γ-globin genes and attenuation of binding of ERF on the HBG promoter and eventually re-activation of HbF in ß-thalassemia. We demonstrated that ERF depletion markedly increased HbF production in human CD34+ erythroid progenitor cells, HUDEP-2 cell lines, and transplanted NCG-Kit-V831M mice. ERF represses γ-globin expression by directly binding to two consensus motifs regulating γ-globin gene expression. Importantly, ERF depletion did not affect maturation of erythroid cells. Identification of alterations in DNA methylation of ERF as a modulator of HbF synthesis opens up therapeutic targets for ß-hemoglobinopathies.
Assuntos
Epigênese Genética , Perfilação da Expressão Gênica , Proteínas Repressoras/deficiência , Proteínas Repressoras/genética , Talassemia beta/genética , gama-Globinas/genética , Animais , Antígenos CD34/metabolismo , Sequência de Bases , Sistemas CRISPR-Cas/genética , Diferenciação Celular , Linhagem Celular , Criança , DNA (Citosina-5-)-Metiltransferases/genética , Metilação de DNA , DNA Metiltransferase 3A , Células Precursoras Eritroides/citologia , Células Precursoras Eritroides/metabolismo , Feminino , Hemoglobina Fetal/genética , Edição de Genes , Humanos , Masculino , Camundongos , Regiões Promotoras Genéticas/genética , Reprodutibilidade dos Testes , Sulfitos , Sequenciamento Completo do Genoma , Talassemia beta/patologiaRESUMO
The genetic underpinnings of beta-thalassaemia encompass a myriad of molecular mechanisms. The ability of synonymous mutations, an often-overlooked category of variants, to influence ß-globin expression and phenotypic disease is highlighted by this report by Gorivale et al. Commentary on: Gorivale et al. When a synonymous mutation breaks the silence in a thalassaemia patient. Br J Haematol 2024;204:677-682.
Assuntos
Talassemia , Talassemia beta , Humanos , Mutação Silenciosa , Mutação , Talassemia beta/genética , Globinas beta/genética , Globinas/genéticaRESUMO
BACKGROUND: LentiGlobin BB305 is a self-inactivating lentiviral vector carrying a human ß-globin expressing cassette for treating ß-thalassemia. Initially, a 2 × 250 bp chicken Locus Control Region fragment of cHS4, functioning as an insulator, was placed at its ΔU3, which was removed after the first clinical trial led by a French team to avoid abnormal splicing, etc. This action could potentially lead to an increasing risk of the transcriptional read-through rate driven by the ß-globin promoter to a significant level, posing a biosafety risk in clinical trials. METHODS: In the present study, a read-through reducing agent (C-U+ or WPRE) was designed to be placed at the 3' UTR of the ß-globin gene. The Enhancer Activities and/or Transcriptional Read-Through (EATRT) rate at the mRNA level and the protein expression level regarding lentiviral preparation titer were examined. RESULTS: We found that the insertion of the element (C-U+ or WPRE) reduced the EATRT effectively by 53% or 41%, respectively. C-U+ has less impact on virus package efficiency. Furthermore, there was no significant difference in the protein expression level after the C-U+ or WPRE insertion. CONCLUSIONS: The results of the present study show that inserting C-U+ or WPRE before the polyA sequence of the BB305 would reduce the EATRT rate at no cost of its expressing efficacy and viral preparation titers. Thus, we present an alternative improvement for a safer lentiviral vector for ß-thalassemia clinical trials.
Assuntos
Talassemia beta , Humanos , Talassemia beta/genética , Talassemia beta/terapia , Lentivirus/genética , Vetores Genéticos/genética , Terapia Genética/métodos , Globinas beta/genéticaRESUMO
Fetal-to-adult hemoglobin switching is controlled by programmed silencing of γ-globin while the re-activation of fetal hemoglobin (HbF) is an effective strategy for ameliorating the clinical severity of ß-thalassemia and sickle cell disease. The identification of enhancer RNAs (eRNAs) related to the fetal (α2γ2) to adult hemoglobin (α2ß2) switching remains incomplete. In this study, the transcriptomes of GYPA+ cells from six ß-thalassemia patients with extreme HbF levels were sequenced to identify differences in patterns of noncoding RNA expression. It is interesting that an enhancer upstream of CHD4, an HbF-related core subunit of the NuRD complex, was differentially transcribed. We found a significantly positive correlation of eRNA-CHD4 enhancer-gene interaction using the public database of FANTOM5. Specifically, the eRNA-CHD4 expression was found to be significantly higher in both CD34+ HSPCs and HUDEP-2 than those in K562 cells which commonly expressed high level of HbF, suggesting a correlation between eRNA and HbF expression. Furthermore, prediction of transcription binding sites of cis-eQTLs and the CHD4 genomic region revealed a putative interaction site between rs73264846 and ZNF410, a known transcription factor regulating HbF expression. Moreover, in-vitro validation showed that the inhibition of eRNA could reduce the expression of HBG expression in HUDEP-2 cells. Taken together, the findings of this study demonstrate that a distal enhancer contributes to stage-specific silencing of γ-globin genes through direct modulation of CHD4 expression and provide insights into the epigenetic mechanisms of NuRD-mediated hemoglobin switching.
Assuntos
Anemia Falciforme , Talassemia beta , Adulto , Humanos , Hemoglobina Fetal/genética , Hemoglobina Fetal/metabolismo , gama-Globinas/genética , gama-Globinas/metabolismo , Talassemia beta/genética , Regulação da Expressão Gênica , Anemia Falciforme/genética , Complexo Mi-2 de Remodelação de Nucleossomo e Desacetilase/genética , Complexo Mi-2 de Remodelação de Nucleossomo e Desacetilase/metabolismoRESUMO
Macrophages play essential roles in erythrophagocytosis and iron recycling. ß-thalassemia is characterized by a genetic defect in hemoglobin synthesis, which increases the rate of iron recycling. We previously showed that reduced expression of the BTB and CNC homolog 1 (BACH1) gene leads to increased phagocytosis of abnormal RBCs by activated monocytes. However, the mechanisms underlying this abnormal RBC clearance remained unclear. Herein, the spleen and bone marrow cells of ß-thalassemic mice were examined for erythrophagocytosis CD markers and iron-recycling genes. Higher expression levels of CD47 and CD163 on RBCs and macrophages, respectively, were observed in ß-thalassemic mice than in wild-type cells. The decreased expression of BACH1 caused an increase in Nrf2, Spic, Slc40a1, and HMOX1 expression in splenic red pulp macrophages of thalassemic mice. To investigate BACH1 regulation, a macrophage cell line was transfected with BACH1-siRNA. Decreased BACH1 expression caused an increase in CD163 expression; however, the expression levels were lower when the cells were cultured in media supplemented with ß-thalassemia/HbE patient plasma. Additionally, the iron recycling-related genes SPIC, SLC40A1, and HMOX1 were significantly upregulated in BACH1-suppressed macrophages. Our findings provide insights into BACH1 regulation, which plays an important role in erythrophagocytosis and iron recycling in thalassemic macrophages.
Assuntos
Ferro , Talassemia beta , Camundongos , Animais , Ferro/metabolismo , Talassemia beta/genética , Talassemia beta/metabolismo , Macrófagos/metabolismo , Monócitos/metabolismo , Eritrócitos/metabolismo , Fatores de Transcrição de Zíper de Leucina Básica/genéticaRESUMO
We conducted a retrospective cohort study on 663 transfusion-dependent ß-thalassemia patients receiving the same iron chelation monotherapy with deferoxamine, deferiprone, or deferasirox for up to 10 years (median age 31.8 years, 49.9 % females). Patients on all three iron chelators had a steady and significant decline in serum ferritin over the 10 years (median deferoxamine: -170.7 ng/mL, P = 0.049, deferiprone: -236.7 ng/mL, P = 0.001; deferasirox: -323.7 ng/mL, P < 0.001) yet had no significant change in liver iron concentration or cardiac T2*; while noting that patients generally had low hepatic and cardiac iron levels at study start. Median absolute, relative, and normalized changes were generally comparable between the three iron chelators. Patients receiving deferasirox had the highest morbidity and mortality-free survival probability among the three chelators, although the difference was only statistically significant when compared with deferoxamine (P = 0.037). On multivariate Cox regression analysis, there was no significant association between iron chelator type and the composite outcome of morbidity or mortality. In a real-world setting, there is comparable long-term iron chelation effectiveness between the three available iron chelators for patients with mild-to-moderate iron overload.
Assuntos
Transfusão de Sangue , Deferasirox , Deferiprona , Desferroxamina , Quelantes de Ferro , Ferro , Piridonas , Talassemia beta , Humanos , Quelantes de Ferro/uso terapêutico , Talassemia beta/mortalidade , Talassemia beta/terapia , Talassemia beta/tratamento farmacológico , Talassemia beta/complicações , Feminino , Masculino , Adulto , Estudos Retrospectivos , Desferroxamina/uso terapêutico , Deferiprona/uso terapêutico , Ferro/metabolismo , Deferasirox/uso terapêutico , Piridonas/uso terapêutico , Sobrecarga de Ferro/etiologia , Sobrecarga de Ferro/tratamento farmacológico , Benzoatos/uso terapêutico , Ferritinas/sangue , Adolescente , Triazóis/uso terapêutico , Adulto Jovem , Criança , Resultado do Tratamento , Pessoa de Meia-Idade , Fígado/metabolismo , Fígado/efeitos dos fármacos , Fígado/patologia , Estudos de CoortesRESUMO
The genetic regulation of hemoglobin is complex and there are a number of genetic abnormalities that result in clinically important hemoglobin disorders. Here, we review the molecular pathophysiology of hemoglobin disorders and review both old and new methods of diagnosing these disorders. Timely diagnosis of hemoglobinopathies in infants is essential to coordinate optimal life-saving interventions, and accurate identification of carriers of deleterious mutations allows for genetic counseling and informed family planning. The initial laboratory workup of inherited disorders of hemoglobin should include a complete blood count (CBC) and peripheral blood smear, followed by carefully selected tests based on clinical suspicion and available methodology. We discuss the utility and limitations of the various methodologies to fractionate hemoglobin, including cellulose acetate and citrate agar hemoglobin electrophoresis, isoelectric focusing, high-resolution high-performance liquid chromatography, and capillary zone electrophoresis. Recognizing that most of the global burden of hemoglobin disorders exists in low- and middle-income countries, we review the increasingly available array of point-of-care-tests (POCT), which have an increasingly important role in expanding early diagnosis programs to address the global burden of sickle cell disease, including Sickle SCAN, HemoTypeSC, Gazelle Hb Variant, and Smart LifeLC. A comprehensive understanding of the molecular pathophysiology of hemoglobin and the globin genes, as well as a clear understanding of the utility and limitations of currently available diagnostic tests, is essential in reducing global disease burden.
Assuntos
Anemia Falciforme , Hemoglobinopatias , Humanos , Hemoglobinopatias/diagnóstico , Hemoglobinopatias/genética , Hemoglobinas/genética , Anemia Falciforme/genética , Focalização Isoelétrica/métodosRESUMO
ß-Thalassemia is a genetic form of anemia due to mutations in the ß-globin gene, that leads to ineffective and extramedullary erythropoiesis, abnormal red blood cells and secondary iron-overload. The severity of the disease ranges from mild to lethal anemia based on the residual levels of globins production. Despite being a monogenic disorder, the pathophysiology of ß-thalassemia is multifactorial, with different players contributing to the severity of anemia and secondary complications. As a result, the identification of effective therapeutic strategies is complex, and the treatment of patients is still suboptimal. For these reasons, several models have been developed in the last decades to provide experimental tools for the study of the disease, including erythroid cell lines, cultures of primary erythroid cells and transgenic animals. Years of research enabled the optimization of these models and led to decipher the mechanisms responsible for globins deregulation and ineffective erythropoiesis in thalassemia, to unravel the role of iron homeostasis in the disease and to identify and validate novel therapeutic targets and agents. Examples of successful outcomes of these analyses include iron restricting agents, currently tested in the clinics, several gene therapy vectors, one of which was recently approved for the treatment of most severe patients, and a promising gene editing strategy, that has been shown to be effective in a clinical trial. This review provides an overview of the available models, discusses pros and cons, and the key findings obtained from their study.
Assuntos
Talassemia beta , Animais , Humanos , Talassemia beta/genética , Talassemia beta/terapia , Eritropoese/genética , Ferro/metabolismo , Globinas/genética , Modelos Animais de DoençasRESUMO
Several syndromes affecting the red cell that mimic those induced by germline mutations may result from a somatic mutation that accompanies a myeloid malignancy. These syndromes are most notable in cases of myelodysplastic syndrome, but they are not limited to any one category of myeloid neoplasm. Their occurrence in males exceed the male predominance that is evident in myeloid neoplasms. The syndromes include disorders of globin chain synthesis (α- and ß-thalassemia), heme synthesis (erythropoietic porphyria and erythropoietic uroporphyria), red cell membrane structure (elliptocytosis and spherocytosis), red cell enzyme activity (pyruvate kinase deficiency, glucose-6-phosphate dehydrogenase deficiency) and lowered expression of red cell ABO blood group antigens. This historical review describes the path to uncovering these acquired syndromes and their causal somatic mutations, where known. These syndromes often go unrecognized because of the dominant concern of the primary neoplasm. They may add to the healthcare needs of the patient.
Assuntos
Anemia Hemolítica Congênita não Esferocítica , Síndromes Mielodisplásicas , Neoplasias , Humanos , Masculino , Feminino , Hematopoiese Clonal , Eritrócitos/patologia , Síndromes Mielodisplásicas/patologia , Mutação , HematopoeseRESUMO
In eukaryotic RNA, N6-methyladenosine (m6A) is a prevalent form of methylation modification. The m6A modification process is reversible and dynamic, written by m6A methyltransferase complex, erased by m6A demethylase, and recognized by m6A binding proteins. Through mediating RNA stability, decay, alternative splicing, and translation processes, m6A modification regulates gene expression at the post-transcriptional level. Erythropoiesis is the process of hematopoietic stem cells undergoing proliferation, a series of differentiation and maturation to form red blood cells (RBCs). Thalassemia is a common monogenic disease characterized by excessive production of ineffective RBCs in the peripheral circulation, resulting in hemolytic anemia. Increasing evidence suggests that m6A modification plays a crucial role in erythropoiesis. In this review, we comprehensively summarize the function of m6A modification in erythropoiesis and further generalize the mechanism of m6A modification regulating ineffective erythropoiesis and fetal hemoglobin expression. The purpose is to improve the understanding of the pathogenesis of erythroid dysplasia and offer new perspectives for the diagnosis and treatment of thalassemia.
Assuntos
Adenosina , Eritropoese , Talassemia , Humanos , Eritropoese/genética , Adenosina/análogos & derivados , Adenosina/metabolismo , Adenosina/genética , Talassemia/genética , Talassemia/patologia , Metilação , Regulação da Expressão Gênica , Metiltransferases/genética , Metiltransferases/metabolismoRESUMO
BACKGROUND AND AIM: Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) affects most of the cells involved in cardiac fibrosis like inflammatory cells, cardiomyocytes and fibroblasts. CD163, the receptor of TWEAK on the surface of type 2 macrophages, is shed into plasma upon macrophages activation. This work aimed to evaluate serum TWEAK and its decoy receptor CD163 as probable biomarkers to monitor myocardial iron overload (MIO) in transfusion dependent thalassemia major (TDTM) patients and to predict iron-induced cardiac decompensation (IICD). METHODS: A total of 140 TDTM patients were enrolled. Patients were categorized into two groups; group I (n = 70) diagnosed with IICD while group II (n = 70) had no evidence of IICD. sTWEAK and sCD163 were quantitated utilizing Enzyme-linked-immunosorbent- assay. RESULTS: sTWEAK was evidently lower in group I than group II (medians, 412 and 1052 pg/mL respectively). sCD163 was higher in group I than group II (medians, 615.5 and 323.5 ng/mL respectively). sTWEAK positively correlated with cardiac MRI-T2 mapping and ventricular ejection fractions and negatively correlated with B-Natriuretic peptide and cardiac troponin. An inverse relationship between TWEAK and CD163 was documented throughout the study. sTWEAK, sCD163 and TWEAK/CD163 ratio proved to be significant predictors of IICD in TDTM patients. TWEAK/CD163 ratio < 1.04 discriminated IICD in TDTM patients with 100 % clinical sensitivity and specificity. CONCLUSION: Circulating TWEAK and CD163 appears to be promising biomarkers for monitoring MIO and predicting IICD in TDTM patients.
Assuntos
Insuficiência Cardíaca , Talassemia beta , Humanos , Ferro , Citocina TWEAK , Biomarcadores , Fatores de Necrose TumoralRESUMO
Genetic manipulation of hematopoietic stem cells (HSCs) is being developed as a therapeutic strategy for several inherited disorders. This field is rapidly evolving with several novel tools and techniques being employed to achieve desired genetic changes. While commercial products are now available for sickle cell disease, transfusion-dependent ß-thalassemia, metachromatic leukodystrophy and adrenoleukodystrophy, several challenges remain in patient selection, HSC mobilization and collection, genetic manipulation of stem cells, conditioning, hematologic recovery and post-transplant complications, financial issues, equity of access and institutional and global preparedness. In this report, we explore the current state of development of these therapies and provide a comprehensive assessment of the challenges these therapies face as well as potential solutions.
RESUMO
BACKGROUND AIMS: Gene therapy using lentiviral vectors (LVs) that harbor a functional ß-globin gene provides a curative treatment for hemoglobinopathies including beta-thalassemia and sickle cell disease. Accurate quantification of the vector copy number (VCN) and/or the proportion of transduced cells is critical to evaluate the efficacy of transduction and stability of the transgene during treatment. Moreover, commonly used techniques for LV quantification, including real-time quantitative polymerase chain reaction (PCR) or fluorescence-activated cell sorting, require either a standard curve or expression of a reporter protein for the detection of transduced cells. In the present study, we describe a digital droplet PCR (ddPCR) technique to measure the lentiviral VCN in transduced hematopoietic stem and progenitor cells (HSPCs). METHODS: After HSPCs were transduced with an LV encoding the therapeutic ß-globin (ßA-T87Q) gene, the integrated lentiviral sequence in the host genome was amplified with primers that targeted a sequence within the vector and the human RPP30 gene. The dynamic range of ddPCR was between 5 × 10-3 ng and 5 × 10-6 ng of target copy per reaction. RESULTS: We found that the ddPCR-based approach was able to estimate VCN with high sensitivity and a low standard deviation. Furthermore, ddPCR-mediated quantitation of lentiviral copy numbers in differentiated erythroblasts correlated with the level of ßA-T87Q protein detected by reverse-phase high-performance liquid chromatography. CONCLUSIONS: Taken together, the ddPCR technique has the potential to precisely detect LV copy numbers in the host genome, which can be used for VCN estimation, calculation of infectious titer and multiplicity of infection for HSPC transduction in a clinical setting.
Assuntos
Terapia Genética , Vetores Genéticos , Células-Tronco Hematopoéticas , Lentivirus , Transdução Genética , Globinas beta , Humanos , Lentivirus/genética , Células-Tronco Hematopoéticas/metabolismo , Vetores Genéticos/genética , Globinas beta/genética , Transdução Genética/métodos , Terapia Genética/métodos , Talassemia beta/terapia , Talassemia beta/genética , Reação em Cadeia da Polimerase/métodos , Dosagem de Genes/genéticaRESUMO
BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.