Tetrameric c-di-GMP mediates effective transcription factor dimerization to control Streptomyces development.

The cyclic dinucleotide c-di-GMP is a signaling molecule with diverse functions in cellular physiology. Here, we report that c-di-GMP can assemble into a tetramer that mediates the effective dimerization of a transcription factor, BldD, which controls the progression of multicellular differentiation in sporulating actinomycete bacteria. BldD represses expression of sporulation genes during vegetative growth in a manner that depends on c-di-GMP-mediated dimerization. Structural and biochemical analyses show that tetrameric c-di-GMP links two subunits of BldD through their C-terminal domains, which are otherwise separated by ~10 Å and thus cannot effect dimerization directly. Binding of the c-di-GMP tetramer by BldD is selective and requires a bipartite RXD-X8-RXXD signature. The findings indicate a unique mechanism of protein dimerization and the ability of nucleotide signaling molecules to assume alternative oligomeric states to effect different functions.

Influence of core divisome proteins on cell division in Streptomyces venezuelae ATCC 10712.

The sporulating, filamentous soil bacterium Streptomyces venezuelae ATCC 10712 differentiates under submerged and surface growth conditions. In order to lay a solid foundation for the study of development-associated division for this organism, a congenic set of mutants was isolated, individually deleted for a gene encoding either a cytoplasmic (i.e. ftsZ) or core inner membrane (i.e. divIC, ftsL, ftsI, ftsQ, ftsW) component of the divisome. While ftsZ mutants are completely blocked for division, single mutants in the other core divisome genes resulted in partial, yet similar, blocks in sporulation septum formation. Double and triple mutants for core divisome membrane components displayed phenotypes that were similar to those of the single mutants, demonstrating that the phenotypes were not synergistic. Division in this organism is still partially functional without multiple core divisome proteins, suggesting that perhaps other unknown lineage-specific proteins perform redundant functions. In addition, by isolating an ftsZ2p mutant with an altered -10 region, the conserved developmentally controlled promoter was also shown to be required for sporulation-associated division. Finally, microscopic observation of FtsZ-YFP dynamics in the different mutant backgrounds led to the conclusion that the initial assembly of regular Z rings does not per se require the tested divisome membrane proteins, but the stability of Z rings is dependent on the divisome membrane components tested. The observation is consistent with the interpretation that Z ring instability likely results from and further contributes to the observed defects in sporulation septation in mutants lacking core divisome proteins.

Streptomyces venezuelae NRRL B-65442: genome sequence of a model strain used to study morphological differentiation in filamentous actinobacteria.

For over a decade, Streptomyces venezuelae has been used to study the molecular mechanisms that control morphological development in streptomycetes and is now a well-established model strain. Its rapid growth and ability to sporulate in a near-synchronised manner in liquid culture, unusual among streptomycetes, greatly facilitates the application of modern molecular techniques such as ChIP-seq and RNA-seq, as well as time-lapse fluorescence imaging of the complete Streptomyces life cycle. Here we describe a high-quality genome sequence of our isolate of the strain (Northern Regional Research Laboratory [NRRL] B-65442) consisting of an 8.2 Mb chromosome and a 158 kb plasmid, pSVJI1, which had not been reported previously. Surprisingly, while NRRL B-65442 yields green spores on MYM agar, the American Type Culture Collection (ATCC) type strain 10712 (from which NRRL B-65442 was derived) produces grey spores. While comparison of the genome sequences of the two isolates revealed almost total identity, it did reveal a single nucleotide substitution in a gene, vnz_33525, involved in spore pigment biosynthesis. Replacement of the vnz_33525 allele of ATCC 10712 with that of NRRL B-65442 resulted in green spores, explaining the discrepancy in spore pigmentation. We also applied CRISPR-Cas9 to delete the essential parB of pSVJI1 to cure the plasmid from the strain without obvious phenotypic consequences.

Enhanced Oxytetracycline Production by Streptomyces rimosus in Submerged Co-Cultures with Streptomyces noursei.

In the present study, Streptomyces rimosus was confronted with Streptomyces noursei, Penicillium rubens, Aspergillus niger, Chaetomium globosum, or Mucor racemosus in two-species submerged co-cultures in shake flasks with the goal of evaluating the oxytetracycline production and morphological development. The co-culture of S. rimosus with S. noursei exhibited stimulation in oxytetracycline biosynthesis compared with the S. rimosus monoculture, whereas the presence of M. racemosus resulted in a delay in antibiotic production. Different strategies of initiating the "S. rimosus + S. noursei" co-cultures were tested. The improvement in terms of oxytetracycline titers was recorded in the cases where S. noursei was co-inoculated with S. rimosus in the form of spores. As the observed morphological changes were not unique to the co-culture involving S. noursei, there was no evidence that the improvement of oxytetracycline levels could be attributed mainly to morphology-related characteristics.

Efficient production of gamma-aminobutyric acid by engineered Saccharomyces cerevisiae with glutamate decarboxylases from Streptomyces.

Gamma-aminobutyric acid (GABA) is an industrially valuable natural product. This study was aimed to establish an efficient food-grade production process of GABA by engineering Saccharomyces cerevisiae that is generally recognized as safe (GRAS). GABA can be produced by catalytic decarboxylation of l-glutamate (l-Glu) by glutamate decarboxylase (GAD, EC4.1.1.15). Two GADs, SsGAD from Streptomyces sp. MJ654-NF4 and ScGAD from Streptomyces chromofuscus ATCC 49982, were heterologously expressed in S. cerevisiae BJ5464. The engineered yeast strains were used as whole-cell biocatalysts for GABA production. S. cerevisiae BJ5464/SsGAD exhibited significantly higher efficient catalytic activity than that of S. cerevisiae BJ5464/ScGAD. The optimal bioconversion system consisted of a cell density of OD600 30, 0.1 M l-Glu, and 0.28 mM pyridoxal phosphate in 0.2 M Na2 HPO4 -citric acid buffer with pH 5.4, and the reactions were performed at 50 °C for 12 H. S. cerevisiae BJ5464/SsGAD cells can be reused, and the accumulated GABA titer reached 62.6 g/L after 10 batches with an overall molar conversion rate of 60.8 mol%. This work thus provides an effective production process of GABA using engineered yeast for food and pharmaceutical applications.

mycelyso - high-throughput analysis of Streptomyces mycelium live cell imaging data.

BACKGROUND: Streptomycetes are filamentous microorganisms of high biotechnological relevance, especially for the production of antibiotics. In submerged cultures, the productivity of these microorganisms is closely linked to their growth morphology. Microfluidic lab-on-a-chip cultivation systems, coupled with automated time-lapse imaging, generate spatio-temporal insights into the mycelium development of streptomycetes, therewith extending the biotechnological toolset by spatio-temporal screening under well-controlled and reproducible conditions. However, the analysis of the complex mycelial structure formation is limited by the extent of manual interventions required during processing of the acquired high-volume image data. These interventions typically lead to high evaluation times and, therewith, limit the analytic throughput and exploitation of microfluidic-based screenings. RESULTS: We present the tool mycelyso (MYCElium anaLYsis SOftware), an image analysis system tailored to fully automated hyphae-level processing of image stacks generated by time-lapse microscopy. With mycelyso, the developing hyphal streptomycete network is automatically segmented and tracked over the cultivation period. Versatile key growth parameters such as mycelium network structure, its development over time, and tip growth rates are extracted. Results are presented in the web-based exploration tool mycelyso Inspector, allowing for user friendly quality control and downstream evaluation of the extracted information. In addition, 2D and 3D visualizations show temporal tracking for detailed inspection of morphological growth behaviors. For ease of getting started with mycelyso, bundled Windows packages as well as Docker images along with tutorial videos are available. CONCLUSION: mycelyso is a well-documented, platform-independent open source toolkit for the automated end-to-end analysis of Streptomyces image stacks. The batch-analysis mode facilitates the rapid and reproducible processing of large microfluidic screenings, and easy extraction of morphological parameters. The objective evaluation of image stacks is possible by reproducible evaluation workflows, useful to unravel correlations between morphological, molecular and process parameters at the hyphae- and mycelium-levels with statistical power.

Developmental regulator BldD directly regulates lincomycin biosynthesis in Streptomyces lincolnensis.

The regulatory mechanism of lincomycin biosynthesis remains largely unknown, although lincomycin and its derivatives have been of great application in pharmaceutical industry. As a global regulator, BldD is widespread in Streptomyces, and functions as an on-off switch to regulate the transition from morphological differentiation to secondary metabolism, inspiring us to explore scarcely regulatory realm of lincomycin biosynthesis. In this work, deletion of bldD gene (SLCG_1664) in Streptomyces lincolnensis blocked the sporulation and nearly abolished lincomycin production, while the morphological phenotype and lincomycin production were restored when introducing a functional bldD gene into the ΔbldD mutant. S. lincolnensis BldD (BldDSL) was validated to bind to upstream regions of lincomycin biosynthetic structural genes lmbA, lmbC-lmbD, lmbE, lmbV-lmbW, resistant genes lmrA, lmrB, lmrC, and regulatory gene lmbU. Disruption of bldD significantly decreased the transcription of genes in lincomycin biosynthetic cluster, thus resulting in the sharply loss of lincomycin production. These findings indicate that BldDSL, similar to Saccharopolyspora erythraea BldD (BldDSE), directly regulates the biosynthesis of lincomycin. What's more, we discovered that BldDSE could bind to upstream regions of lmbA, lmbV-lmbW, lmrA and lmrC. Corresponding to this, S. lincolnensis BldD can bind to upstream region of eryAI-eryBIV, revealing an interactional regulation of the two BldDs. In summary, our data indicated that the developmental regulator BldD played a vital role in directly regulating the biosynthesis of lincomycin, and expanded the knowledge on lincomycin biosynthetic regulation in S. lincolnensis.

A Novel AdpA Homologue Negatively Regulates Morphological Differentiation in Streptomyces xiamenensis 318.

The pleiotropic transcriptional regulator AdpA positively controls morphological differentiation and regulates secondary metabolism in most Streptomyces species. Streptomyces xiamenensis 318 has a linear chromosome 5.96 Mb in size. How AdpA affects secondary metabolism and morphological differentiation in such a naturally minimized genomic background is unknown. Here, we demonstrated that AdpA Sx , an AdpA orthologue in S. xiamenensis, negatively regulates cell growth and sporulation and bidirectionally regulates the biosynthesis of xiamenmycin and polycyclic tetramate macrolactams (PTMs) in S. xiamenensis 318. Overexpression of the adpASx gene in S. xiamenensis 318 had negative effects on morphological differentiation and resulted in reduced transcription of putative ssgA, ftsZ, ftsH, amfC, whiB, wblA1, wblA2, wblE, and a gene encoding sporulation-associated protein (sxim_29740), whereas the transcription of putative bldD and bldA genes was upregulated. Overexpression of adpASx led to significantly enhanced production of xiamenmycin but had detrimental effects on the production of PTMs. As expected, the transcriptional level of the xim gene cluster was upregulated, whereas the PTM gene cluster was downregulated. Moreover, AdpA Sx negatively regulated the transcription of its own gene. Electrophoretic mobility shift assays revealed that AdpA Sx can bind the promoter regions of structural genes of both the xim and PTM gene clusters as well as to the promoter regions of genes potentially involved in the cell growth and differentiation of S. xiamenensis 318. We report that an AdpA homologue has negative effects on morphological differentiation in S. xiamenensis 318, a finding confirmed when AdpA Sx was introduced into the heterologous host Streptomyces lividans TK24.IMPORTANCE AdpA is a key regulator of secondary metabolism and morphological differentiation in Streptomyces species. However, AdpA had not been reported to negatively regulate morphological differentiation. Here, we characterized the regulatory role of AdpA Sx in Streptomyces xiamenensis 318, which has a naturally streamlined genome. In this strain, AdpA Sx negatively regulated cell growth and morphological differentiation by directly controlling genes associated with these functions. AdpA Sx also bidirectionally controlled the biosynthesis of xiamenmycin and PTMs by directly regulating their gene clusters rather than through other regulators. Our findings provide additional evidence for the versatility of AdpA in regulating morphological differentiation and secondary metabolism in Streptomyces.

AveI, an AtrA homolog of Streptomyces avermitilis, controls avermectin and oligomycin production, melanogenesis, and morphological differentiation.

Streptomyces avermitilis is well known as the producer of anthelmintic agent avermectins, which are widely used in agriculture, veterinary medicine, and human medicine. aveI encodes a TetR-family regulator, which is the homolog of AtrA. It was reported that deletion of aveI caused enhanced avermectin production. In this study, we investigated the regulatory function of the AveI in S. avermitilis. By binding to the 15-nt palindromic sequence in the promoter regions, AveI directly regulates at least 35 genes. AveI represses avermectin production by directly regulating the transcription of the cluster-situated regulator gene aveR and structural genes aveA1, aveA3, and aveD. AveI represses oligomycin production by repressing the CSR gene olmRII and structural genes olmC. AveI activates melanin biosynthesis by activating the expression of melC1C2 operon. AveI activates morphological differentiation by activating the expression of ssgR and ssgD genes, repressing the expression of wblI gene. Besides, AveI regulates many genes involved in primary metabolism, including substrates transport, the metabolism of amino acids, lipids, and carbohydrates. Therefore, AveI functions as a global regulator in S. avermitilis, controls not only secondary metabolism and morphological differentiation, but also primary metabolism.

Global regulator BldA regulates morphological differentiation and lincomycin production in Streptomyces lincolnensis.

Global regulator BldA, the only tRNA for a rare leucine codon UUA, is best known for its ability to affect morphological differentiation and secondary metabolism in the genus Streptomyces. In this study, we confirmed the regulatory function of the bldA gene (Genbank accession no. EU124663.1) in Streptomyces lincolnensis. Disruption of bldA hinders the sporulation and lincomycin production, that can recur when complemented with a functional bldA gene. Western blotting assays demonstrate that translation of the lmbB2 gene which encodes a L-tyrosine hydroxylase is absolutely dependent on BldA; however, mistranslation of the lmbU gene which encodes a cluster-situated regulator (CSR) is observed in a bldA mutant. Intriguingly, when the preferential cognate codon CTG was used, the expression level of LmbU was not the highest compared to the usage of rare codon TTA or CTA, indicating the rare codon in this position is significant for the regulation of lmbU expression. Moreover, replacement of TTA codons in both genes with another leucin codon in the bldA mutant did not restore lincomycin production. Thus, we believe that the bldA gene regulates lincomycin production via controlling the translation of not only lmbB2 and lmbU, but also the other TTA-containing genes. In conclusion, the present study demonstrated the importance of the bldA gene in morphological differentiation and lincomycin production in S. lincolnensis.

SParticle, an algorithm for the analysis of filamentous microorganisms in submerged cultures.

Streptomycetes are filamentous bacteria that produce a plethora of bioactive natural products and industrial enzymes. Their mycelial lifestyle typically results in high heterogeneity in bioreactors, with morphologies ranging from fragments and open mycelial mats to dense pellets. There is a strong correlation between morphology and production in submerged cultures, with small and open mycelia favouring enzyme production, while most antibiotics are produced mainly in pellets. Here we describe SParticle, a Streptomyces Particle analysis method that combines whole slide imaging with automated image analysis to characterize the morphology of submerged grown Streptomyces cultures. SParticle allows the analysis of over a thousand particles per hour, offering a high throughput method for the imaging and statistical analysis of mycelial morphologies. The software is available as a plugin for the open source software ImageJ and allows users to create custom filters for other microbes. Therefore, SParticle is a widely applicable tool for the analysis of filamentous microorganisms in submerged cultures.

Morphology-driven downscaling of Streptomyces lividans to micro-cultivation.

Actinobacteria are prolific producers of secondary metabolites and industrially relevant enzymes. Growth of these mycelial micro-organisms in small culture volumes is challenging due to their complex morphology. Since morphology and production are typically linked, scaling down culture volumes requires better control over morphogenesis. In larger scale platforms, ranging from shake flasks to bioreactors, the hydrodynamics play an important role in shaping the morphology and determining product formation. Here, we report on the effects of agitation on the mycelial morphology of Streptomyces lividans grown in microtitre plates. Our work shows that at the appropriate agitation rates cultures can be scaled down to volumes as small as 100 µl while maintaining the same morphology as seen in larger scale platforms. Using image analysis and principal component analysis we compared the morphologies of the cultures; when agitated at 1400-1600 rpm the mycelial morphology in micro-cultures was similar to that obtained in shake flasks, while product formation was also maintained. Our study shows that the morphology of actinobacteria in micro-cultures can be controlled in a similar manner as in larger scale cultures by carefully controlling the mixing rate. This could facilitate high-throughput screening and upscaling.

Cell-Biological Studies of Osmotic Shock Response in Streptomyces spp.

Most bacteria are likely to face osmotic challenges, but there is yet much to learn about how such environmental changes affect the architecture of bacterial cells. Here, we report a cell-biological study in model organisms of the genus Streptomyces, which are actinobacteria that grow in a highly polarized fashion to form branching hyphae. The characteristic apical growth of Streptomyces hyphae is orchestrated by protein assemblies, called polarisomes, which contain coiled-coil proteins DivIVA and Scy, and recruit cell wall synthesis complexes and the stress-bearing cytoskeleton of FilP to the tip regions of the hyphae. We monitored cell growth and cell-architectural changes by time-lapse microscopy in osmotic upshift experiments. Hyperosmotic shock caused arrest of growth, loss of turgor, and hypercondensation of chromosomes. The recovery period was protracted, presumably due to the dehydrated state of the cytoplasm, before hyphae could restore their turgor and start to grow again. In most hyphae, this regrowth did not take place at the original hyphal tips. Instead, cell polarity was reprogrammed, and polarisomes were redistributed to new sites, leading to the emergence of multiple lateral branches from which growth occurred. Factors known to regulate the branching pattern of Streptomyces hyphae, such as the serine/threonine kinase AfsK and Scy, were not involved in reprogramming of cell polarity, indicating that different mechanisms may act under different environmental conditions to control hyphal branching. Our observations of hyphal morphology during the stress response indicate that turgor and sufficient hydration of cytoplasm are required for Streptomyces tip growth. IMPORTANCE: Polar growth is an intricate manner of growth for accomplishing a complicated morphology, employed by a wide range of organisms across the kingdoms of life. The tip extension of Streptomyces hyphae is one of the most pronounced examples of polar growth among bacteria. The expansion of the cell wall by tip extension is thought to be facilitated by the turgor pressure, but it was unknown how external osmotic change influences Streptomyces tip growth. We report here that severe hyperosmotic stress causes cessation of growth, followed by reprogramming of cell polarity and rearrangement of growth zones to promote lateral hyphal branching. This phenomenon may represent a strategy of hyphal organisms to avoid osmotic stress encountered by the growing hyphal tip.

AvaR2, a pseudo γ-butyrolactone receptor homologue from Streptomyces avermitilis, is a pleiotropic repressor of avermectin and avenolide biosynthesis and cell growth.

Avermectins produced by Streptomyces avermitilis are effective anthelmintic agents. The autoregulatory signalling molecule that triggers avermectin biosynthesis is a novel butenolide-type molecule, avenolide, rather than common γ-butyrolactones (GBLs). We identified AvaR2, a pseudo GBL receptor homologue, as an important repressor of avermectin and avenolide biosynthesis and cell growth. AvaR2 directly repressed transcription of aveR (the ave cluster-situated activator gene), aco (a key gene for avenolide biosynthesis), its own gene (avaR2) and two other GBL receptor homologous genes (avaR1 and avaR3) by binding to their promoter regions. The aveR promoter had the highest affinity for AvaR2. A consensus 18 bp ARE (autoregulatory element)-like sequence was found in the AvaR2-binding regions of these five target genes. Eleven novel AvaR2 targets were identified, including genes involved in primary metabolism, ribosomal protein synthesis, and stress responses. AvaR2 bound and responded to endogenous avenolide and exogenous antibiotics jadomycin B (JadB) and aminoglycosides to modulate its DNA-binding activity. Our findings help to clarify the roles of pseudo GBL receptors as pleiotropic regulators and as receptors for new type autoregulator and exogenous antibiotic signal. A pseudo GBL receptor-mediated antibiotic signalling transduction system may be a common strategy that facilitates Streptomyces interspecies communication and survival in complex environments.

Reduction of selenite to Se(0) nanoparticles by filamentous bacterium Streptomyces sp. ES2-5 isolated from a selenium mining soil.

BACKGROUND: Selenium (Se) is an essential trace element in living systems. Microorganisms play a pivotal role in the selenium cycle both in life and in environment. Different bacterial strains are able to reduce Se(IV) (selenite) and (or) Se(VI) (selenate) to less toxic Se(0) with the formation of Se nanoparticles (SeNPs). The biogenic SeNPs have exhibited promising application prospects in medicine, biosensors and environmental remediation. These microorganisms might be explored as potential biofactories for synthesis of metal(loid) nanoparticles. RESULTS: A strictly aerobic, branched actinomycete strain, ES2-5, was isolated from a selenium mining soil in southwest China, identified as Streptomyces sp. based on 16S rRNA gene sequence, physiologic and morphologic characteristics. Both SEM and TEM-EDX analysis showed that Se(IV) was reduced to Se(0) with the formation of SeNPs as a linear chain in the cytoplasm. The sizes of the SeNPs were in the range of 50-500 nm. The cellular concentration of glutathione per biomass decreased along with Se(IV) reduction, and no SeNPs were observed in different sub-cellular fractions in presence of NADPH or NADH as an electron donor, indicating glutathione is most possibly involved in vivo Se(IV) reduction. Strain ES2-5 was resistant to some heavy metal(loid)s such as Se(IV), Cr(VI) and Zn(II) with minimal inhibitory concentration of 50, 80 and 1.5 mM, respectively. CONCLUSIONS: The reducing mechanism of Se(IV) to elemental SeNPs under aerobic condition was investigated in a filamentous strain of Streptomyces. Se(IV) reduction is mediated by glutathione and then SeNPs synthesis happens inside of the cells. The SeNPs are released via hypha lysis or fragmentation. It would be very useful in Se bioremediation if Streptomyces sp. ES2-5 is applied to the contaminated site because of its ability of spore reproduction, Se(IV) reduction, and adaptation in soil.

[Streptomycetes in the Light of the Concept of Multicellularity of Bacteria.]

The review concerns discussion of certain aspects of growth and development of streptomycetes, that have an adaptation meaning for their existence under natural conditions and reflect our perception of them as procaryotes which have a range of qualities typical of multicellular organisms. At present, the concept of multicellularity is the key idea in investigation of growth processes, differentiation and physiology of streptomycetes. Streptomyces olivocinereus is presented as an effective model that gives the unique opportunities for investigation of different aspects of biology of streptomycetes within laboratory environment as well as in natural environment in suli. S.olivocinereus produces luminescent antibiotic geliomycin (resistomycin). In this review we summarized the results of the many years of investigation of growth, differentiation and behavior of this streptomycete. The investigations were undertaken by a group of scientists of the Moscow State University. The results can be employed as arguments for the multicellular nature of streptomycetes.

Discovery and Total Synthesis of Streptoaminals: Antimicrobial [5,5]-Spirohemiaminals from the Combined-Culture of Streptomyces nigrescens and Tsukamurella pulmonis.

A series of lipidic spirohemiaminals, designated streptoaminals, is reported. These were discovered by surveying the unique molecular signatures identified in the mass spectrometry data of the combined-culture broth of Streptomyces nigrescens HEK616 and Tsukamurella pulmonis TP-B0596. Mass spectrometry analysis showed that streptoaminals appeared as a cluster of ion peaks, which were separated by 14 mass unit intervals, implying the presence of alkyl chains of different lengths. The chemical structures of these compounds were elucidated by spectroscopic analysis and total synthesis. Streptoaminals with globular structures showed broad antimicrobial activities, whereas the planar structures of the 5-alkyl-1,2,3,4-tetrahydroquinolines found in the same combined-culture did not. This work shows the application of microbes as reservoirs for a range of chemical scaffolds.

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

Increasing Avermectin Production in Streptomyces avermitilis by Manipulating the Expression of a Novel TetR-Family Regulator and Its Target Gene Product.

Avermectins produced by Streptomyces avermitilis are commercially important anthelmintic agents. The detailed regulatory mechanisms of avermectin biosynthesis remain unclear. Here, we identified SAV3619, a TetR-family transcriptional regulator designated AveT, to be an activator for both avermectin production and morphological differentiation in S. avermitilis. AveT was shown to indirectly stimulate avermectin production by affecting transcription of the cluster-situated activator gene aveR. AveT directly repressed transcription of its own gene (aveT), adjacent gene pepD2 (sav_3620), sav_7490 (designated aveM), and sav_7491 by binding to an 18-bp perfect palindromic sequence (CGAAACGKTKYCGTTTCG, where K is T or G and Y is T or C and where the underlining indicates inverted repeats) within their promoter regions. aveM (which encodes a putative transmembrane efflux protein belonging to the major facilitator superfamily [MFS]), the important target gene of AveT, had a striking negative effect on avermectin production and morphological differentiation. Overexpression of aveT and deletion of aveM in wild-type and industrial strains of S. avermitilis led to clear increases in the levels of avermectin production. In vitro gel-shift assays suggested that C-5-O-B1, the late pathway precursor of avermectin B1, acts as an AveT ligand. Taken together, our findings indicate positive-feedback regulation of aveT expression and avermectin production by a late pathway intermediate and provide the basis for an efficient strategy to increase avermectin production in S. avermitilis by manipulation of AveT and its target gene product, AveM.