RESUMEN
Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.
RESUMEN
Grasslands are vital ecosystems that play a crucial role in providing numerous services to both humans and the environment. Healthy grasslands are characterized by diverse vegetation, efficient soil, and abundant microbial communities, which enable them to function effectively. However, these ecosystems are at risk of degradation due to various factors, such as overgrazing, land conversion for agriculture, climate change, and rodent activities. Rodents, in particular, are known to have a significant impact on grassland ecosystems. Moderate and low rodent density can be beneficial for grassland dynamics by acting as ecological engineers, and playing a role in the food chain, while heavy rodent density and outbreaks can have detrimental effects. The rodent's activities are associated with and influenced by other driving factors of grassland degradation. Depending on their density and habitat, rodents can have either beneficial or detrimental effects on the dynamics of grasslands by altering the microbial communities, edaphic factors, and vegetation. This review focuses on rodent activities as one of the potential drivers of grassland degradation on vegetation, soil physicochemical dynamics, and microbial communities. This work also deciphers the interplay between rodent activities and other driving factors of grassland degradation. It also discusses potential strategies for mitigating the impact of rodent disturbance on degraded grasslands. Additionally, suggestions for future research directions are provided to explore the role of rodent activities in shaping the structure and functions of grassland ecosystems. The exact influence of rodent activities on grasslands is still not fully understood, and further manipulative research is needed to determine its impact on grassland dynamics.
RESUMEN
Plants communicate with insects and other organisms through the release of volatile organic compounds (VOCs). Using Boolean operators, we retrieved 1093 articles from the Web of Science and Scopus databases, selecting 406 for detailed analysis, with approximately 50% focusing on herbivore-induced plant volatiles (HIPVs). This review examines the roles of VOCs in direct and indirect plant defense mechanisms and their influence on complex communication networks within ecosystems. Our research reveals significant functions of VOCs in four principal areas: activating insect antennae, attracting adult insects, attracting female insects, and attracting natural enemies. Terpenoids like α-pinene and ß-myrcene significantly alter pest behavior by attracting natural enemies. ß-ocimene and ß-caryophyllene are crucial in regulating aboveground and belowground interactions. We emphasize the potential applications of VOCs in agriculture for developing novel pest control strategies and enhancing crop resilience. Additionally, we identify research gaps and propose new directions, stressing the importance of comparative studies across ecosystems and long-term observational research to better understand VOCs dynamics. In conclusion, we provide insights into the multifunctionality of VOCs in natural ecosystems, their potential for future research and applications, and their role in advancing sustainable agricultural and ecological practices, contributing to a deeper understanding of their mechanisms and ecological functions.
RESUMEN
Seven species of the genus Toxorhina Loew, 1850 have been recorded from China, of which three are known to occur in Yunnan Province. Herein, all known species from Yunnan, China are reviewed with more detailed descriptions and illustrations of the male hypopygium. A species of Toxorhina belonging to the subgenus Ceratocheilus Wesché, 1910 from Yunnan, T. (C.) pianmicasp. nov., is described and illustrated as new to science.
RESUMEN
Grasshoppers pose a significant threat to both natural grassland vegetation and crops. Therefore, comprehending the relationship between environmental factors and grasshopper occurrence is of paramount importance. This study integrated machine learning models (Maxent) using the kuenm package to screen MaxEnt models for grasshopper species selection, while simultaneously fitting remote sensing data of major grasshopper breeding areas in Inner Mongolia, China. It investigated the spatial distribution and key factors influencing the occurrence of typical grasshopper species in grassland ecosystems. The modelling results indicate that a typical steppe has a larger suitable area. The soil type, above biomass, altitude, and temperature, predominantly determine the grasshopper occurrence in typical steppes. This study explicitly delineates the disparate impacts of key environmental factors (meteorology, vegetation, soil, and topography) on grasshopper occurrence in typical steppes. Furthermore, it provides a methodology to guide early warning and precautions for grasshopper pest prevention. The findings of this study will be instrumental in formulating future management measures to guarantee grass ecological environment security and the sustainable development of grassland.
RESUMEN
Introduction: Weeds are significant factors that detrimentally affect crop health and hinder optimal herbage yield. Rhizosphere microorganisms play crucial roles in plant growth, development, and nutrient uptake. Therefore, research focusing on weed control through the lens of microorganisms has emerged as a prominent area of study. The oil-producing fungus Mortierella, which is known for its numerous agricultural benefits, has garnered significant attention in recent years. Methods: In this study, we conducted inoculation experiments in a controlled artificial culture climate chamber to investigate the effects of differential hormones and differentially expressed genes in the stems and leaves of Digitaria sanguinalis using Liquid Chromatography Tandem Mass Spectrometry and RNA-seq techniques, respectively. Additionally, Pearson's correlation analysis was used to establish correlations between differential hormones and growth indicators of Digitaria sanguinalis. Results and discussion: The results demonstrated that inoculation with Mortierella sp. MXBP304 effectively suppressed aboveground biomass and plant height in Digitaria sanguinalis. Furthermore, there was significant upregulation and downregulation in the expression of genes involved in the synthesis and metabolism of phenylalanine and L-phenylalanine. Conversely, the expression of genes related to tryptophan, L-tryptophan, and indole was significantly downregulated. The addition of Mortierella sp. MXBP304 can influence the gene expression associated with phenylalanine and tryptophan synthesis and metabolism during Digitaria sanguinalis growth, subsequently reducing the relative contents of phenylalanine and tryptophan, thereby directly inhibiting Digitaria sanguinalis growth.
RESUMEN
Background: The genus Helius Lepeletier & Serville, 1828 is globally distributed with 232 species and subspecies, of which 25 have been known to occur in China. Amongst the Chinese Helius crane flies, 24 species are distributed in southern China. The species diversity of Helius in other Chinese regions may be severely underestimated due to a lack of investigation. Some investigations on crane flies in Inner Mongolia, China have been initiated by the authors together with other entomologists, with Helius being one of the key targets of attention. New information: Two Helius species, H. (Helius) flavus (Walker, 1856) and H. (H.) gracillimus Alexander, 1938, are added to the Chinese fauna. The two newly-recorded species also represent the first records of the crane fly tribe Elephantomyiini in Inner Mongolia. Re-descriptions and illustrations of the two newly-recorded species are presented.
RESUMEN
Platypalpus Macquart is reported in Inner Mongolia, China for the first time. Four new species are found: P.flavipilosussp. nov., P.longussp. nov., P.shengisp. nov. and P.shuimogouanussp. nov. This paper provides a description of the four species and a key to the genus in Inner Mongolia.
RESUMEN
Smooth bromegrass (Bromus inermis Leyss.) is an important forage crop in northern China. In July 2021, leaf spot symptoms were observed on smooth bromegrass in Ewenki Banner, Hulunbuir, Inner Mongolia. In an area of approximately 0.12 hectares, 95% disease incidence was observed. Ten diseased plants were collected for pathogen isolation. Leaf tissues near the lesions were cut into 5 × 5 mm pieces, surface-disinfested in 75% ethanol for 3 min, and rinsed with sterile distilled water. The pieces were placed on water agar in petri plates and incubated at 25â for three days. The resulting colonies were flushed with sterile water and a spore suspension was serially diluted and plated on potato dextrose agar (PDA). A single-spore colony was obtained. Ten isolates were obtained and designated HE1 to HE10. The colony morphology was identical for all isolates, grayish white in color on the upper surface and light black on the underside. The mycelia were light gray and velvety. Conidia were light brown to brown in color and oblate, oblong or oval. The conidial dimensions were typically between 15 to 43 µm by 8 to 9 µm in size. The conidia possessed one to six transverse septa, with slight to distinct constrictions at each division, and zero to two longitudinal septa. These morphological characteristics resembled Alternaria alternata (Fr.) Keissl.. DNA was extracted from three isolates, HE3, HE4 and HE5, using the CTAB method. Polymerase chain reaction (PCR) was performed on the extracted DNA with a set of primers ITS1/ITS4, H31a/H31b, gpd1/gpd2, TEF1-728F/TEF1-986R, and RPB2-5F2/fRPB2-7cR. The amplicon sequences from the three isolates were analyzed using the BLAST in GenBank (https://www.ncbi.nlm.nih.gov/). The results showed a high sequence identity, ranging from 99 to 100%, with the A. alternata strain YTMZ-20-2 across all the genetic markers tested. The strong match reinforced the identification of the strains as A. alternata. The sequences were deposited in GenBank (Table S1). The three fungal isolates were identified as A. alternata based on their morphological and genetic data. To conduct Koch's postulates, the representative isolate HE4 was used. Smooth bromegrass seed was soaked in water for four days and sown in potting soil contained in plastic pots (10 cm diameter × 15 cm height, five seeds/pot) in a greenhouse under a 16-h photoperiod at temperatures between 20 to 25°C and 60% relative humidity. When the plants reached a height of approximately 20 cm, the plants in three pots (replicates) were sprayed with a spore suspension (106 conidial/ml) at 10 ml/pot, and three pots were sprayed with sterile water for control. Five days after inoculation, the plants exhibited leaf spot symptoms similar to those previously described, while the control plants remained unaffected. The causative fungus was successfully re-isolated from the diseased plants and confirmed morphologically and molecularly on its identity as described above. This experiment was independently conducted three times. This is the first report of A. alternata causing leaf spot on smooth bromegrass in China. Since there is risk that the disease could seriously reduce the yield of the forage crop smooth bromegrass, further research is needed.
RESUMEN
Rodents are essential to the balance of the grassland ecosystem, but their population outbreak can cause major economic and ecological damage. Rodent monitoring is crucial for its scientific management, but traditional methods heavily depend on manual labor and are difficult to be carried out on a large scale. In this study, we used UAS to collect high-resolution RGB images of steppes in Inner Mongolia, China in the spring, and used various object detection algorithms to identify the holes of Brandt's vole (Lasiopodomys brandtii). Optimizing the model by adjusting evaluation metrics, specifically, replacing classification strategy metrics such as precision, recall, and F1 score with regression strategy-related metrics FPPI, MR, and MAPE to determine the optimal threshold parameters for IOU and confidence. Then, we mapped the distribution of vole holes in the study area using position data derived from the optimized model. Results showed that the best resolution of UAS acquisition was 0.4 cm pixel-1, and the improved labeling method improved the detection accuracy of the model. The FCOS model had the highest comprehensive evaluation, and an R2 of 0.9106, RMSE of 5.5909, and MAPE of 8.27%. The final accuracy of vole hole counting in the stitched orthophoto was 90.20%. Our work has demonstrated that UAS was able to accurately estimate the population of grassland rodents at an appropriate resolution. Given that the population distribution we focus on is important for a wide variety of species, our work illustrates a general remote sensing approach for mapping and monitoring rodent damage across broad landscapes for studies of grassland ecological balance, vegetation conservation, and land management.
RESUMEN
Fusarium root rot, caused by Fusarium spp. in alfalfa (Medicago sativa L.), adversely impacts alfalfa by diminishing plant quality and yield, resulting in substantial losses within the industry. The most effective strategy for controlling alfalfa Fusarium root rot is planting disease-resistant varieties. Therefore, gaining a comprehensive understanding of the mechanisms underlying alfalfa's resistance to Fusarium root rot is imperative. In this study, we observed the infection process on alfalfa seedling roots infected by Fusarium acuminatum strain HM29-05, which is labeled with green fluorescent protein (GFP). Two alfalfa varieties, namely, the resistant 'Kangsai' and the susceptible 'Zhongmu No. 1', were examined to assess various physiological and biochemical activities at 0, 2, and 3 days post inoculation (dpi). Transcriptome sequencing of the inoculated resistant and susceptible alfalfa varieties were conducted, and the potential functions and signaling pathways of differentially expressed genes (DEGs) were analyzed through gene ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Meanwhile, a DEG co-expression network was constructed though the weighted gene correlation network analysis (WGCNA) algorithm. Our results revealed significant alterations in soluble sugar, soluble protein, and malondialdehyde (MDA) contents in both the 'Kangsai' and 'Zhongmu No. 1' varieties following the inoculation of F. acuminatum. WGCNA analysis showed the involvement of various enzyme and transcription factor families related to plant growth and disease resistance, including cytochrome P450, MYB, ERF, NAC, and bZIP. These findings not only provided valuable data for further verification of gene functions but also served as a reference for the deeper explorations between plants and pathogens.
RESUMEN
Lepidopteran insects mainly rely on sex pheromones to complete sexual communications. Pheromone receptors (PRs) are expressed on the olfactory receptor neurons (ORNs) of the sensilla trichodea and play an essential role in sexual communication. Despite extensive investigations into the mechanisms of peripheral recognition of sex pheromones in Lepidoptera, knowledge about these mechanisms in L. sticticalis remains limited. In this study, five candidate LstiPRs were analyzed in a phylogenetic tree with those of other Lepidopteran insects. Electroantennography (EAG) assays showed that the major sex pheromone component E11-14:OAc elicited a stronger antennal response than other compounds in male moths. Moreover, two types of neurons in sensilla trichodea were classified by single sensillum recordings, of which the "a" neuron specifically responded to E11-14:OAc. Five candidate PRs were functionally assayed by the heterologous expression system of Xenopus oocytes, and LstiPR2 responded to the major sex pheromone E11-14:OAc. Our findings suggest that LstiPR2 is a PR sensitive to L. sticticalis's major sex pheromone compound, E11-14:OAc. Furthermore, this study offers valuable insights into the sexual communication behavior of L. sticticalis, forming a foundation for further analysis of the species' central nervous system.
RESUMEN
Smooth bromegrass (Bromus inermis Leyss.) is an excellent forage species widely distributed in Gansu, Qinghai, Inner Mongolia, and other provinces of China (Gong et al. 2019). In July 2021, typical leaf spot symptoms were observed on the leaves of smooth bromegrass plants in Ewenki Banner of Hulun Buir, China (49°5'8â³N, 119°44'28â³E, alt. 622.5 m). Approximately 90% of plants were affected, with symptoms apparent throughout the plant but mainly concentrated on the lower middle leaves. We collected 11 plants to identify the causal pathogen of leaf spot on smooth bromegrass. Samples (5×5 mm) of symptomatic leaves were excised and surface-sanitized with 75% ethanol for 3 min, rinsed three times with sterile distilled water, and incubated on water agar (WA) at 25â for three days. The lumps were cut along the edges and transplanted to potato dextrose agar (PDA) for subculture. After two purification cultures, ten strains, termed HE2 to HE11, were collected. The front side of the colony morphology was cottony or woolly, the center was greyish-green, circled with greyish-white color, with reddish pigmentation on the reverse. The conidia were globose or subglobose, yellow-brown or dark brown, with surface verrucae, and 23.89±3.76×20.28±3.23 µm (n = 50) in size. The morphological characteristics of the mycelia and conidia of the strains mtched those of Epicoccum nigrum (El-Sayed et al. 2020). The primers ITS1/ITS4 (White et al. 1991), LROR/LR7 (Rehner and Samuels 1994), 5F2/7cR (Sung et al. 2007), and TUB2Fd/TUB4Rd (Woudenberg et al. 2009) were used to amplify and sequence four phylogenic loci (ITS, LSU, RPB2 and ß-tubulin), respectively. The sequences of ten strains have been deposited in GenBank, and the detailed accession numbers were shown in Table S1. BLAST analysis of these sequences showed 99-100%, 96-98%, 97-99% and 99-100% homology with the E. nigrum strain in the ITS, LSU, RPB2 and TUB sequenced regions, respectively. The sequences of ten test strains and other Epicoccum spp. strains obtained from GenBank were aligned by ClustalW by MEGA (version 11.0) software. After a series of alignment, cutting and splicing, the phylogenetic tree was constructed by the neighbor-joining method with 1000 bootstrap replicates based on the ITS, LSU, RPB2, and TUB sequences. The test strains were clustered together with E. nigrum, with branch support rate of 100%. Combined with morphological and molecular biological characteristics, ten strains were identified as E. nigrum. For the pathogenicity test, the seeds of smooth bromegrass were soaked for four days and then sown into six pots (10 cm diameter × 15 cm height) and kept in a greenhouse under a 16-h photoperiod with temperatures of 20-25°C and 60% relative humidity. Microconidia of the strain produced on wheat bran medium after 10 days were washed with sterile deionized water, filtered through three layers of sterile cheese cloth, quantified, and the concentration adjusted to 1 × 106 microconidia/ml with a hemocytometer. When the plants had grown to a height of about 20 cm, the leaves of plants in three pots were sprayed with the spore suspension, 10 mL per pot, while the remaining three pots were inoculated with sterile water and served as controls (LeBoldus and Jared 2010). The inoculated plants were cultured in an artificial climate box under a 16-h photoperiod with temperatures of 24°C and 60% relative humidity. Brown spots were apparent on the leaves of the treated plants after five days, whereas the leaves of the controls remained healthy. The same E. nigum strain were re-isolated from the inoculated plants and identified by the morphological and molecular techniques described above. To our knowledge, this is the first report of leaf spot disease caused by E. nigrum on smooth bromegrass in China, as well as in the world. Infection with this pathogen could reduce the yield and quality of smooth bromegrass production. For this reason, strategies for the management and control of this disease should be developed and implemented.
RESUMEN
The Inner Mongolia Autonomous Region ranks first among the five major pastoral areas in terms of lamb breeding of China. The Inner Mongolia Autonomous Region has a vast territory, with many famous grasslands and thousands of forage plants and multiple local high-quality lamb breeds. After hundreds of years of artificial breeding and improvement, Mongolian sheep have developed many varieties. Different diets, feeding and treatment methods have effects on the production performance, lipid deposition and flavor composition of mutton sheep. Therefore, understanding the relationship among Inner Mongolian lamb, meat quality, and flavor will improve the production of high-quality mutton. The regulation of meat quality and flavor will have a profound impact on the deep processing and income-generating capabilities of mutton. Non-genetic factors affect the quality and flavor of mutton, which are more intuitive than genetic factors. In this review, we cover the contributions made by scientists to explore and improve the quality and flavor of Inner Mongolia lambs through non-genetic means, compare the differences between grazing and drylot-feeding in detail, and summarize some feed additives. We hope that based on our review, we can provide some inspiration to improve the meat quality of Mongolian sheep.
RESUMEN
Oedaleus asiaticus (Bey-Bienko) is an economically devastating locust species found in grassland and pastoral areas of the Inner Mongolia region of northern China. In this study, resistance to three frequently used insecticides (beta-cypermethrin, matrine, and azadirachtin) was investigated in six field populations of O. asiaticus using the leaf-dip bioassay method. The inhibitory effects of synergists and the activities of detoxification enzyme activities in the different populations were determined to explore potential biochemical resistance mechanisms. The results showed that the field populations SB (resistance ratio [RR]â =â 7.85), ZB (RRâ =â 5.64), and DB (RRâ =â 6.75) had developed low levels of resistance to beta-cypermethrin compared with a susceptible control strain. Both the SB (RRâ =â 5.92) and XC (RRâ =â 6.38) populations had also developed low levels of resistance against matrine, with the other populations remaining susceptible to both beta-cypermethrin and matrine. All field populations were susceptible to azadirachtin. Synergism analysis showed that triphenyl phosphate (TPP) and diethyl-maleate (DEM) increased the toxicity of beta-cypermethrin significantly in the SB population, while the synergistic effects of TPP, piperonyl butoxide (PBO), and DEM on the toxicity of matrine were higher in SB (SR 3.86, 4.18, and 3.07, respectively) than in SS (SR 2.24, 2.86, and 2.29, respectively), but no synergistic effects of TPP, PBO, and DEM on azadirachtin were found. Biochemical assays showed that the activities of carboxylesterases (CarEs) and glutathione-S-transferases (GSTs) were significantly raised in all field populations of O. asiaticus, with a significant positive correlation observed between beta-cypermethrin resistance and CarE activity. The activities of cytochrome P450 monooxygenases (P450) and multi-function oxidases (MFO) were elevated in all six field populations, and P450 activity displayed strong positive correlations with the three insecticides. Our findings suggest that resistance to beta-cypermethrin in O. asiaticus may be mainly attributed to elevated CarE and GST activities, while P450 plays an important role in metabolizing matrine and azadirachtin. Our study provides insights that will help improve insecticide resistance management strategies.
Asunto(s)
Saltamontes , Insecticidas , Piretrinas , Animales , Insecticidas/farmacología , Piretrinas/farmacología , Resistencia a los Insecticidas , China , MatrinasRESUMEN
The beet webworm (Loxostege sticticalis L.) is an important agricultural pest and can tolerate harsh environmental conditions by entering diapause. The diapause mechanism of beet webworm is unknown. Therefore, we conducted a transcriptomic study of the process from diapause induction to diapause release in beet webworms. The results revealed 393 gene modules closely related to the diapause of beet webworm. The hub gene of the red module was the HDACI gene, which acts through histone deacetylase (HDAC) enzymes. HDAC enzyme activity was regulated by the light duration and influenced the JH content under induced beet webworm diapause conditions (12 h light:12 h dark). In addition, transcriptomic data suggested that circadian genes may not be the key genes responsible for beet webworm diapause. However, we showed that the photoperiod affects HDAC enzyme activity, and HDAC can regulate the involvement of JH in beet webworm diapause. This study provided a new module for studying insect diapause and links histone acetylation and diapause at the transcriptome level.
RESUMEN
The oriental fruit moth, Grapholita molesta, is a worldwide pest that damages Rosaceae fruit trees. Sex pheromones play an important role in controlling this pest; however, the corresponding chemosensation mechanism is currently unknown. In this study, 60 candidate odorant receptors, including eight pheromone receptors (PRs), were identified by antennal transcriptome analysis. Expression profiles indicated that most PRs were highly expressed in the males, except GmolOR21 and GmolOR22, which were specifically expressed in the females. Among them, GmolOR2 was identified in response to the main sex pheromone Z8-12:OAc and E8-12:OAc, and its in vivo function was confirmed by RNA interference analysis. Electrophysiological analysis showed that the males had a significantly reduced sensitivity to the main pheromones after the knockdown of GmolOR2. Our research makes a better understanding of pheromone chemoreception and provides a theoretical basis to developing novel, efficient, and environmentally friendly insect attractants.
Asunto(s)
Mariposas Nocturnas , Receptores Odorantes , Atractivos Sexuales , Animales , Femenino , Frutas/genética , Frutas/metabolismo , Masculino , Mariposas Nocturnas/metabolismo , Receptores Odorantes/genética , Receptores Odorantes/metabolismo , Receptores de Feromonas/genética , Receptores de Feromonas/metabolismo , Atractivos Sexuales/metabolismo , Atractivos Sexuales/farmacologíaRESUMEN
Leymus chinensis (Trin.) Tzvel. is a rhizomatous grass widely grown in the grasslands of Eurasia. With strong fertility and stress resistance, L. chinensis makes an excellent pasture and mowing grass, contributing to animal husbandry and thus playing an important role in the local economy of the northern grassland area in China (Baoyin et al. 2014). During August to September 2019, diseased roots of L. chinensis were collected from an artificially planted grassland (40°47'44" N, 111°43'58â³ E, alt. 1049 m) in Shaerqin County, Hohhot, China. Infected plants were scattered across the field with disease incidence up to 2%. Symptoms observed were wilted plants and rotten roots. In order to identify the causal pathogen of root rot on L. chinensis, symptomatic pieces (5 × 5 mm) of grass roots were excised and surface sterilized with 75% ethanol for 3-5 s followed by 1% NaClO for 2-3 min, rinsed three times with sterile distilled water, and placed on water agar and incubated at 25°C for 3 days. The mycelia were cut and transferred onto potato dextrose agar (PDA) for subculture. A fungus was consistently isolated, and a strain, named LCH054, was obtained by hyphal tip culture. Culture developed as white and fluffy aerial mycelia, with diffused pink pigment on the reverse side of PDA after culturing at 25â for 7 days. A culture of LCH054 was transferred to carnation leaf agar (CLA) (Li et al. 2014) and incubated at 25°C for 10 days. Microconidia were absent but macroconidia were produced. Macroconidia were hyaline, sickle-shaped, and had 4 to 7 septa, 19.8 to 63.6 (mean 43.8) × 1.8 to 5.7 (mean 3.2) µm (n = 100). Chlamydospores were ellipsoidal or subglobose, with thick walls in clumps or chains. All morphological characteristics of LCH054 resembled Fusarium equiseti (Leslie and Summerell 2006). The primers of the internal transcribed spacer (ITS) region (White et al. 1990) and translation elongation factor 1α gene (TEF-1α) (O'Donnell et al. 1998) were used to amplify the isolate, and the fragments were sequenced. BLASTn search in the NCBI database using the ITS and TEF-1α sequences revealed 99 to 100% similarities with F. equiseti. BLAST analysis of the ITS and TEF-1α sequencies in the FUSARIUM-ID database showed them to have 99.21% (500 bp out of 504 bp) and 99.52% (622 bp out of 625 bp) similarities with the Fusarium incarnatum-equiseti species complex (FIESC) (strain NRRL 45997) (O'Donnell et al. 2009), respectively. The ITS and TEF1-α sequences were deposited in GenBank as accession numbers MT937067 and MT947530, respectively. The strain LCH054 was identified as a member of the FIESC based on morphological and molecular characteristics. For the pathogenicity test, one hundred of L. chinensis seeds were planted into five pots (12 cm [diameter]) × 15 cm [high]) and kept in a greenhouse under a 16-h photoperiod with temperatures of 20-25°C and 40% relative humidity. The conidial suspension of LCH054 was prepared by washing 7-day old fungal culture grown on CLA medium using sterile deionized water. Conidia were filtered through three layers of sterile cheese cloth, counted, and adjusted to 1 × 105 conidia/ml with a hemocytometer. Forty 1-month-old healthy plants (four pots) were inoculated with 400 ml of conidia suspension using the root drenching method, whereas the inoculum was replaced with 100 ml sterile water on control plants (one pot). Fourteen days after inoculation, all inoculated plants showed the typical symptoms of root rot identical to those observed in the field, whereas the control plants remained healthy. LCH054 was re-isolated from the inoculated plants and identified by the morphological and molecular approaches as described above. To the best of our knowledge, this is the first report of root rot caused by F. incarnatum-equiseti on L. chinensis in China as well as worldwide. The presence of the pathogen could cause significant economic losses in L. chinensis production. For this reason, strategies for the management and control of this disease should be developed and implemented.
RESUMEN
Sex pheromones serve a critical role in Lepidopterans finding mates. Male moths perceive and react to sex pheromones emitted by conspecific females through a delicate pheromone communication system. Pheromone receptors (PRs) are the key sensory elements at the beginning of that process. The codling moth (Cydia pomnonella) is an important pome fruit pest globally and a serious invasive species in China. Pheromone-based techniques have been used successfully in monitoring and controlling this species. We conducted ribonucleic acid sequencing analysis of the codling moth antennal transcriptome and identified 66 odorant receptors (ORs) in a population from Xinjiang province, China, of which 14 were PRs, including two novel PRs (CpomOR2e and CpomOR73). Four PRs that contain full-length open reading frames (CpomOR1, OR2a, OR5, OR7) and four PRs with ligands that have not been reported previously (CpomOR1, OR2a, OR5, OR7) were selected to deorphanize in the heterologous Xenopus oocyte expression system. Specifically, we found that CpomOR2a and CpomOR5 responded to (E,E)-8, 10-dodecadien-1-yl acetate (codlemone acetate). Furthermore, CpomOR5 (EC50 = 1.379 × 10-8 mol/L) was much more sensitive to codlemone acetate than CpomOR2a (EC50 = 1.663 × 10-6 mol/L). Since codlemone acetate is an important component of C. pomonella sex pheromone, our results improve the current understanding of pheromone communication in codling moths and will be helpful for the development of pest management strategies.
Asunto(s)
Antenas de Artrópodos/metabolismo , Proteínas de Insectos/genética , Mariposas Nocturnas/genética , Receptores de Feromonas/genética , Secuencia de Aminoácidos , Animales , Femenino , Proteínas de Insectos/química , Proteínas de Insectos/metabolismo , Masculino , Mariposas Nocturnas/metabolismo , Filogenia , Receptores de Feromonas/química , Receptores de Feromonas/metabolismo , Alineación de SecuenciaRESUMEN
The codling moth Cydia pomonella, a major invasive pest of pome fruit, has spread around the globe in the last half century. We generated a chromosome-level scaffold assembly including the Z chromosome and a portion of the W chromosome. This assembly reveals the duplication of an olfactory receptor gene (OR3), which we demonstrate enhances the ability of C. pomonella to exploit kairomones and pheromones in locating both host plants and mates. Genome-wide association studies contrasting insecticide-resistant and susceptible strains identify hundreds of single nucleotide polymorphisms (SNPs) potentially associated with insecticide resistance, including three SNPs found in the promoter of CYP6B2. RNAi knockdown of CYP6B2 increases C. pomonella sensitivity to two insecticides, deltamethrin and azinphos methyl. The high-quality genome assembly of C. pomonella informs the genetic basis of its invasiveness, suggesting the codling moth has distinctive capabilities and adaptive potential that may explain its worldwide expansion.