Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain.

CONTEXT: Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. OBJECTIVE: The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. RESULTS: A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. CONCLUSIONS: Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

Familial hypocalciuric hypercalcemia: new mutation in the CASR gene converting valine 697 to methionine.

Familial hypocalciuric hypercalcemia is an uncommon cause of hypercalcemia that arises from mutations in the calcium-sensing receptor gene. Inactivation of this receptor leads to a decreased receptor sensitivity to calcium, determining that higher concentrations of calcium are needed to inhibit the release of parathormone in the parathyroid glands. Patients usually are asymptomatic. Diagnosis is usually made casually after a routine blood analysis. The syndrome is characterized by mild or moderate hypercalcemia, hypocalciuria, and normal or slightly increased levels of parathormone. The degree of hypercalcemia depends on the type of mutation. The accurate diagnosis is important since it is a benign disorder that does not require medical or surgical treatment. We report a 9-year-old female with persistent hypercalcemia in several routine blood analyses, who was diagnosed with familial hypocalciuric hypercalcemia after genetic studies were performed. A new mutation determining a nucleotide change c.2089G>A in the calcium-sensing receptor gene (exon 7) was detected. This mutation was also found in the patient's mother and brother.

ACTH-dependent precocious pseudopuberty in an infant with DAX1 gene mutation.

DAX1 gene (Xp21) expression is involved in the development of the hypothalamo-pituitary-gonadal and adrenal axes, and acts as a negative regulator of steroidogenesis. Mutations of this gene determine adrenal hypoplasia congenita (AHC) and hypogonadotropic hypogonadism. We report the case of a 9-month-old boy referred for the study of macrogenitosomia and pubic hair development. He had presented acute adrenal crises in the neonatal period and, later, a clinical picture of peripheral precocious puberty. A mutation in the DAX1 gene was found (Trp291Arg) and a diagnosis of AHC was made. Replacement doses of hydrocortisone (HC) (10 mg/m2/day) failed to produce a feedback inhibition of adrenocorticotropic hormone (ACTH), and testosterone levels remained high. Testosterone and ACTH values normalized after HC was progressively increased to 18 mg/m2/day. In conclusion, peripheral precocious puberty in patients with DAX1 gene mutations appears to be secondary to the stimulus exerted by ACTH on melanocortin receptors in Leydig cells and to the overexpression of testicular steroidogenesis activators by the loss of transcriptional repression.

New mutation type in pseudohypoparathyroidism type Ia.

CONTEXT: The GNAS gene encodes the alpha-subunit of the stimulatory G proteins, which play a crucial role in intracellular signal transduction of peptide and neurotransmitter receptors. Heterozygous inactivating maternally inherited mutations of GNAS (including translation initiation mutations, amino acid substitutions, nonsense mutations, splice site mutations and small insertions or deletions) lead to a phenotype in which Albright hereditary osteodystrophy is associated with pseudohypoparathyroidism type Ia. OBJECTIVE: We sought to identify the molecular defect in a patient who was thought to have PHP-Ia. METHODS AND RESULTS: The GNAS gene of a 5-year-old boy with brachydactily, mental retardation, pseudohypoparathyroidism and congenital hypothyroidism was investigated. We found a heterozygous inversion of exon 2 and part of intron 1 of de novo origin. Molecular studies of cDNA from blood RNA demonstrated that both the normal and the mutant variants were stable and that new splice-sites were generated. CONCLUSION: This report demonstrates the first evidence for an inversion at the GNAS gene responsible of pseudohypoparathyroidism type Ia.

Haploinsufficiency at GCK gene is not a frequent event in MODY2 patients.

OBJECTIVE: The aim of this study was to characterize glucokinase (GCK) alterations in maturity-onset diabetes of the young 2 (MODY2)-suspected patients and to investigate their clinical characteristics in relation to the parental origin of the mutation. PATIENTS AND METHODS: We studied a group of 57 unrelated Spanish patients presenting with MODY2 phenotype. Patients without mutation in the coding region of the GCK gene were screened for rearrangements by Multiplex Ligation-dependent Probe Amplification (MLPA). After classification according to the parental origin of the mutation, clinical characteristics were compared between the groups. RESULTS: We detected a point mutation or small deletion or insertion of the GCK gene in 47 patients (82.5%); 19 mutations were novel. In addition, we found a whole-gene deletion by MLPA. Patients carrying a GCK gene defect and those with MODY of unknown genetic origin shows similar phenotypes. Comparison of clinical parameters according to the origin of the mutation did not show any differences in the birth weight (BW) nor in age at diagnosis. Patients who inherited the mutation from the father had higher fasting glucose levels at diagnosis. CONCLUSION: Although the presence of haploinsufficiency of GCK is not a common cause of MODY2, gene dose analysis should be performed when no mutation is found. Strict maternal euglycaemia can contribute to intrauterine growth restriction and low BW when the foetus has inherited the GCK mutation from the mother. As foetal genotype in generally is not known, serial foetal abdominal scans may act as a surrogate for this.

Pseudohypoparathyroidism type Ib associated with novel duplications in the GNAS locus.

CONTEXT: Pseudohypoparathyroidism type 1b (PHP-Ib) is characterized by renal resistance to PTH (and, sometimes, a mild resistance to TSH) and absence of any features of Albright's hereditary osteodystrophy. Patients with PHP-Ib suffer of defects in the methylation pattern of the complex GNAS locus. PHP-Ib can be either sporadic or inherited in an autosomal dominant pattern. Whereas familial PHP-Ib is well characterized at the molecular level, the genetic cause of sporadic PHP-Ib cases remains elusive, although some molecular mechanisms have been associated with this subtype. OBJECTIVE: The aim of the study was to investigate the molecular and imprinting defects in the GNAS locus in two unrelated patients with PHP-Ib. DESIGN: We have analyzed the GNAS locus by direct sequencing, Methylation-Specific Multiplex Ligation-dependent Probe Amplification, microsatellites, Quantitative Multiplex PCR of Short Fluorescent fragments and array-Comparative Genomic Hybridization studies in order to characterize two unrelated families with clinical features of PHP-Ib. RESULTS: We identified two duplications in the GNAS region in two patients with PHP-Ib: one of them, comprising ∼ 320 kb, occurred 'de novo' in the patient, whereas the other one, of ∼ 179 kb in length, was inherited from the maternal allele. In both cases, no other known genetic cause was observed. CONCLUSION: In this article, we describe the to-our-knowledge biggest duplications reported so far in the GNAS region. Both are associated to PHP-Ib, one of them occurring 'de novo' and the other one being maternally inherited.

Clinical and molecular characterization of five Spanish kindreds with X-linked adrenal hypoplasia congenita: atypical findings and a novel mutation in NR0B1.

BACKGROUND: X-linked adrenal hypoplasia congenita (AHC) is caused by NR0B1 (DAX1) gene mutations. Affected male children suffer from adrenal insufficiency, leading to a salt-wasting crisis in early infancy and hypogonadotropic hypogonadism in adulthood. OBJECTIVE: To characterize clinically and at the molecular level a cohort of Spanish patients with AHC. PATIENTS AND METHODS: Nine boys (from five families) with AHC were screened for NR0B1 mutations. Clinical and endocrine evaluations were recorded. RESULTS: NR0B1 gene mutations were found in all analyzed patients, one of them being novel (p.Gln305*). One patient presented with preserved hypothalamic-pituitary-gonadal axis. Salt-wasting episodes, delayed puberty, and hypogonadotropic hypogonadism were common, although no association was observed between AHC phenotype and genetic mutations. None of the patients has had descendants. CONCLUSIONS: AHC phenotype cannot be predicted based on genetic results as there is no definite genotype-phenotype relationship, including intrafamilial variability. Nevertheless, genetic testing for NR0B1 mutations is indicated if there is a suspicion of an X-linked adrenal insufficiency in order to proceed with the appropriate therapy and genetic counseling.

Detection of hypomethylation syndrome among patients with epigenetic alterations at the GNAS locus.

CONTEXT: Genomic imprinting is the modification of the genome so that genes from only one (rather than two) of the parental alleles are expressed. The mechanism underlying imprinting is epigenetic, occurring via changes in DNA methylation and histone modifications rather than through alterations in the DNA sequence. To date, nine different imprinting disorders have been clinically and genetically identified and a considerable research effort has been focused on determining the cause of the corresponding methylation defects. OBJECTIVE: Our objective was to identify multilocus imprinting defects and characterize any mutations in trans-acting genes in patients with pseudohypoparathyroidism (PHP) caused by epigenetic alterations at GNAS locus. DESIGN: We have investigated multilocus imprinting defects in 22 PHP patients with aberrant methylation at the GNAS locus not due to previously described deletions or to paternal uniparental disomy (UPD) of chromosome 20. RESULTS: We found that, in contrast to what has been described in growth disorders, multilocus hypomethylation is an uncommon event in PHP patients. We were also unable to identify any genetic alteration causative of the epigenetic defects in the currently known methylation regulatory genes. CONCLUSION: Our work suggests that a trans-acting gene regulating the establishment or maintenance of imprinting at GNAS locus, if it exists, should be specific to PHP cases caused by epigenetic defects at GNAS.

Exclusion of the GNAS locus in PHP-Ib patients with broad GNAS methylation changes: evidence for an autosomal recessive form of PHP-Ib?

Most patients with autosomal dominant pseudohypoparathyroidism type Ib (AD-PHP-Ib) carry maternally inherited microdeletions upstream of GNAS that are associated with loss of methylation restricted to GNAS exon A/B. Only few AD-PHP-Ib patients carry microdeletions within GNAS that are associated with loss of all maternal methylation imprints. These epigenetic changes are often indistinguishable from those observed in patients affected by an apparently sporadic PHP-Ib form that has not yet been defined genetically. We have now investigated six female patients affected by PHP-Ib (four unrelated and two sisters) with complete or almost complete loss of GNAS methylation, whose healthy children (11 in total) showed no epigenetic changes at this locus. Analysis of several microsatellite markers throughout the 20q13 region made it unlikely that PHP-Ib is caused in these patients by large deletions involving GNAS or by paternal uniparental isodisomy or heterodisomy of chromosome 20 (patUPD20). Microsatellite and single-nucleotide variation (SNV) data revealed that the two affected sisters share their maternally inherited GNAS alleles with unaffected relatives that lack evidence for abnormal GNAS methylation, thus excluding linkage to this locus. Consistent with these findings, healthy children of two unrelated sporadic PHP-Ib patients had inherited different maternal GNAS alleles, also arguing against linkage to this locus. Based on our data, it appears plausible that some forms of PHP-Ib are caused by homozygous or compound heterozygous mutation(s) in an unknown gene involved in establishing or maintaining GNAS methylation.

Two cases of deletion 2q37 associated with segregation of an unbalanced translocation 2;21: choanal atresia leading to misdiagnosis of CHARGE syndrome.

CONTEXT: The phenotypic variability of patients with syndromes presenting with dysmorphism makes clinical diagnosis difficult, leading to an exhaustive genetic study to determine the underlying mechanism so that a proper diagnosis could be established. OBJECTIVE: To genetically characterize siblings, the older sister diagnosed with Albright hereditary osteodystrophy and the younger one with CHARGE syndrome. DESIGN: Clinical case report. METHODS: Clinical, biochemical, and radiological studies were performed on the family. In addition, molecular genetic studies including sequencing of GNAS, typing of microsatellites on 2q and 21q, and multiplex ligation-dependent probe amplification of subtelomeric regions were performed, as well as confirmatory fluorescent in situ hybridization analysis. RESULTS: The genetic analysis revealed that both sisters presented a 2q37 deletion due to the maternal unbalanced segregation of a 2;21 translocation. CONCLUSIONS: This is the first report of a 2q37 deletion where differential diagnosis of CHARGE syndrome is needed due to the appearance of choanal atresia.

MICA response to gliadin in intestinal mucosa from celiac patients.

MHC class I chain-related gene A (MICA), a putative independent susceptibility gene in autoimmune diseases, encodes a surface protein present in epithelial cells that binds to NKG2D, an activating receptor of NK, alphabeta and gammadelta T cells, and could function as a stress-inducible activator of the innate immune response. There is no evidence of a long-term implication of MICA in the celiac autoimmune process. However, it could be that gliadin activation of MICA occurs only during the initial stages of the disease. In order to determine whether MICA is activated in response to gliadin in patients with celiac disease (CD), small intestinal mucosa biopsy samples from ten long-standing celiac patients on a gluten-free diet and from five non-celiac individuals were incubated with and without gliadin for 4 h. Total RNA was purified and MICA, IFNG and NKG2D mRNA were quantified by fluorescent real-time RT-PCR. Expression levels were calculated relative to GAPDH. MICA expression was detected in both patients and controls, but incubation with gliadin induced a strong increase in samples from the treated CD group compared with the non-CD controls (P=0.028), while no differences were observed for IFNG or NKG2D mRNA levels. The gliadin-provoked over-expression of MICA in "normalized" tissues from CD patients suggests a role for this stress-induced activator of the immune response in the early stages of organ-specific autoimmune destruction, probably preceding the onset of inflammation.

Genetic and metabolic determinants of increased plasma plasminogen activator inhibitor-1 activity in children with renal transplants.

Recent studies have shown that activity of plasminogen activator inhibitor-1 (PAI-1), a prothrombotic protein, may be increased in transplanted patients. The aim of the present investigation was to determine PAI-1 activity in pediatric recipients of renal transplants and to establish the relative contribution of both genetic and metabolic factors. In 29 children and adolescents with stable renal transplants, we related plasma PAI-1 activity to an indicator of inflammatory status [plasma concentration of C-reactive protein (CRP)] and to elements of the insulin resistance syndrome [body mass index (BMI), fasting insulinemia, HOMA index and plasma triglyceride, HDL-cholesterol, apolipoproteins A-1 and B concentrations]. Polymorphisms of PAI-1, apolipoprotein E (apoE) and angiotensin-converting enzyme (ACE) genes were also investigated. In all patients the study was repeated 1 year later. PAI-1 activity remained constantly elevated (23.4+/-22.8 and 18.6+/-7.8 U/ml in the first and second study, respectively, P=NS). Plasma PAI-1 activity correlated positively with CRP ( P=0.001), BMI z score ( P=0.02), fasting insulinemia ( P=0.009), and HOMA index ( P=0.006). No significant correlations were found in this population between plasma PAI-1 activity and age, gender, time elapsed after transplantation and plasma homocysteine, total cholesterol, LDL-cholesterol, HDL-cholesterol, apolipoprotein B, and apolipoprotein A-1. Plasma PAI-1 activity was not related to the cumulative dose of prednisone, cyclosporin A, or tacrolimus. Plasma PAI-1 activity was significantly higher in 5 children with apoE3/apoE4 genotype. No apparent influences of the PAI-1 4G/4G and ACE I/D genotypes were observed. In a multiple stepwise regression model, fasting insulinemia and apoE3/apoE4 genotype accounted for 45% of the observed plasma PAI-1 variability. We conclude that increased PAI-1 activity in children with stable renal transplants is determined both by genetic factors and by metabolic factors, the latter mainly linked to the insulin resistance syndrome.

Hyperhomocysteinemia in children with renal transplants.

Many studies have demonstrated a strong association between elevated plasma total homocysteine (tHcys) levels and vascular disease. The aim of the present study was to determine the plasma levels of tHcys in pediatric recipients of renal transplants, to establish possible correlations with renal function, lipid profile, and folate and vitamin B12 status, and to assess whether the C677T and A1298C polymorphisms in the 5, l0-methylenetetrahydrofolate reductase (MTHFR) gene were associated with a particular risk. A total of 26 transplanted children and adolescents were investigated. tHcys levels were elevated in transplanted patients (12.9+/-4.8 micro mol/l) and 73% of these displayed values above the 97th percentile of healthy children. Plasma tHcys correlated negatively with creatinine clearance ( r=-0.58, P<0.001) and plasma vitamin B(12) ( r=-0.40, P<0.05) and positively with plasma triglycerides ( r=0.53, P<0.005). No significant correlations were found between plasma tHcys level and age, gender, time elapsed after transplantation and plasma values of glucose, insulin, folic acid, total cholesterol, low-density lipoprotein-cholesterol, high-density lipoprotein-cholesterol, apolipoprotein B, and apolipoprotein A-1. Plasma tHcys level was clearly increased in 3 patients with a MTHFR 677TT/1298AA genotype. In a multiple stepwise regression model plasma creatinine and triglyceride levels and MTHFR 677TT/1298 AA genotype accounted for 60% of the observed plasma tHcys variability. The MTHFR 677CT/1298 AC genotype was not a significant predictor of tHcys plasma levels. We conclude that a moderate degree of hyperhomocysteinemia is often present in renal transplant children and that folate supplementation must be considered in this population.