Three M syndrome 2 in two Indian patients.

3-M syndrome is a rare autosomal recessive disorder, characterized by short stature, characteristic facies and absence of microcephaly and intellectual disability. 3-M syndrome 2 (MIM# 612921) is caused by biallelic disease causing variants in OBSL1. In this study, we identified two probands from two families with homozygous, c.1534 + 5G > T and compound heterozygous variants, c.35dup and c.1273dup in OBSL1, respectively. We herein highlight the clinical and molecular findings of the first reported cases from Indian ethnicity.

A rare cause of syndromic short stature: 3M syndrome in three families.

3M syndrome is a rare autosomal recessive genetic disorder characterized by severe growth retardation, dysmorphic facial features, skeletal dysplasia, and normal intelligence. Variants in CUL7, OBSL1, and CCDC8 genes have been reported to be responsible for this syndrome. In this study, the clinical and molecular findings of four 3M syndrome cases from three families are presented. All cases had growth retardation, relative macrocephaly, and typical dysmorphic facial features. Their neurological developments were normal. Sequencing of CUL7, OBSL1, and CCDC8 genes revealed two different novel homozygous variants in CUL7 in Families 1 and 3 and a previously reported homozygous pathogenic variant in OBSL1 in Family 2. In conclusion, a comprehensive dysmorphological evaluation should be obtained in individuals presenting with short stature and in such individuals with typical facial and skeletal findings, 3M syndrome should be considered. Our report expands the genotype of 3M syndrome and emphasizes the importance of thorough physical and dysmorphological examination.

Molecular basis of a new ovine model for human 3M syndrome-2.

BACKGROUND: Brachygnathia, cardiomegaly and renal hypoplasia syndrome (BCRHS, OMIA 001595-9940 ) is a previously reported recessively inherited disorder in Australian Poll Merino/Merino sheep. Affected lambs are stillborn with various congenital defects as reflected in the name of the disease, as well as short stature, a short and broad cranium, a small thoracic cavity, thin ribs and brachysternum. The BCRHS phenotype shows similarity to certain human short stature syndromes, in particular the human 3M syndrome-2. Here we report the identification of a likely disease-causing variant and propose an ovine model for human 3M syndrome-2. RESULTS: Eight positional candidate genes were identified among the 39 genes in the approximately 1 Mb interval to which the disease was mapped previously. Obscurin like cytoskeletal adaptor 1 (OBSL1) was selected as a strong positional candidate gene based on gene function and the resulting phenotypes observed in humans with mutations in this gene. Whole genome sequencing of an affected lamb (BCRHS3) identified a likely causal variant ENSOARG00000020239:g.220472248delC within OBSL1. Sanger sequencing of seven affected, six obligate carrier, two phenotypically unaffected animals from the original flock and one unrelated control animal validated the variant. A genotyping assay was developed to genotype 583 animals from the original flock, giving an estimated allele frequency of 5%. CONCLUSIONS: The identification of a likely disease-causing variant resulting in a frameshift (p.(Val573Trpfs*119)) in the OBSL1 protein has enabled improved breeding management of the implicated flock. The opportunity for an ovine model for human 3M syndrome and ensuing therapeutic research is promising given the availability of carrier ram semen for BCRHS.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Further expanding the mutational spectrum and investigation of genotype-phenotype correlation in 3M syndrome.

3M syndrome is characterized by severe pre- and postnatal growth retardation, typical facial features, and normal intelligence. Homozygous or compound heterozygous mutations in either CUL7, OBSL1, or CCDC8 have been identified in the etiology so far. Clinical and molecular features of 24 patients (23 patients and a fetus) from 19 unrelated families with a clinical diagnosis of 3M syndrome were evaluated and genotype-phenotype correlations were investigated with the use of DNA sequencing, chromosomal microarray, and whole exome sequencing accordingly. A genetic etiology could be established in 20 patients (n = 20/24, 83%). Eleven distinct CUL7 or OBSL1 mutations, among which eight was novel, were identified in 18 patients (n = 18/24, 75%). Ten patients had CUL7 (n = 10/18, 56%) while eight had OBSL1 (n = 8/18, 44%) mutations. Birth weight and height standard deviation scores at admission were significantly (p < 0.05) lower in patients with CUL7 mutation compared to that of patients with OBSL1 mutation. Two patients with a similar phenotype had a de novo 20p13p deletion involving BMP2. No genetic etiology could be established in four patients (n = 4/28, 17%). This study yet represents the largest cohort of 3M syndrome patients from a single center in Turkey. Microdeletions involving BMP2 may cause a phenotype similar to 3M syndrome with some distinctive features. Larger cohort of patients are required to establish genotype-phenotype correlations in 3M syndrome.

Gonadal Failure in a Male With 3-M Syndrome.

OMIM 273750 (3-M) syndrome is a rare cause of severe short stature with variable dysmorphic features caused by pathogenic variants in several genes including cullin7 gene (CUL7). Hypogonadism and hypospadias have been described in only a few males. We report a patient with CUL7 pathogenic variant who had bifid scrotum and perineal hypospadias at birth. He entered puberty spontaneously at age 12 years and appropriately completed pubertal development by 15 years. Subsequently, a regression of testicular volumes, increased gonadotropin levels, and reduced (although normal) testosterone levels were observed. This case highlights the importance of careful pubertal monitoring as pubertal dysfunction may be associated with 3-M syndrome.

Novel OBSL1 Variant in a Chinese Patient with 3M Syndrome and the c.458dupG Mutation May Be a Potential Hotspot Mutation in the Chinese Population.

3M syndrome is an autosomal recessive disorder characterized by short stature and skeletal developmental abnormalities. In this study, a Chinese patient with 3M syndrome was presented. A novel OBSL1 (obscurin-like 1 gene) variant was found. The patient is a 2-year-old girl who presented with short stature and had intrauterine growth retardation and low birth weight. Gene analysis revealed compound heterozygote mutations in the OBSL1 gene: c.458dupG (p.L154Pfs*100) and c.427dupG (p.A143Gfs*111). The c.427dupG mutation is novel. The c.458dupG mutation has been documented in 5 cases, occurring only in Chinese individuals, indicating ethnic specificity. In cases of short-statured children presenting intrauterine growth retardation, low birth weight, and skeletal developmental abnormalities, 3M syndrome should be considered. The c.458dupG mutation might be a hotspot mutation in the Chinese population.

Longitudinal skeletal growth and growth plate morphological characteristics of chondro-tissue specific CUL7 knockout mice.

BACKGROUND: 3 M syndrome is first reported in 1975，which characterized by severe pre- and postnatal growth retardation, skeletal malformation and facial dysmorphism. These three genes (CUL7, OBSL1 and CCDC8) have been identified to be respond for 3 M syndrome, of which CUL7 is accounting for approximately 70%. To date, the molecular mechanism underlying the pathogenesis of 3 M syndrome remains poorly understood. Previous studies showed that no Cul7-/- mice could survive after birth, because of growth retardation at late gestational stage and respiratory distress after birth. The establishment of the animal model of cartilage specific Cul7 knockout mice (Cul7fl/fl;Col2a1-CreERT2 mice) has confirmed that Cul7fl/fl;Col2a1-CreERT2 mice can be selective in a time- and tissue-dependent manner, which can provide an experimental basis for further research on severe genetic diseases related to growth plates. OBJECTIVE: To establish a model of Cul7fl/fl;Col2a1-CreERT2 mice based on Cre/LoxP system, and to further observe its phenotype and morphological changes in growth plate. METHODS: The Cul7fl/fl;Col2a1-CreERT2 mice were taken as the experimental group, while the genotype of Cul7fl/+;Col2a1-CreERT2 mice were used as the control group. The gross morphological features and X-ray films of limbs in the two groups were observed every week for 3-6 consecutive weeks, and the length of the mice from nose to the tail, the length of femur and tibia were recorded. In the meantime, The histological morphology of tibial growth plates was compared between the two groups. RESULTS: A preliminary model of Cul7fl/fl;Col2a1-CreERT2 mice was established. The Cul7fl/fl;Col2a1-CreERT2 mice had abnormally short and deformed limbs (P<0.05), increased thickness of growth plate, the disorderly arranged chondrocyte columns, decreased number of cells in the proliferation zone, changes in the shape from flat to round, obviously expanded extracellular matrix, and disordered arrangement, thickening and loosening of bone trabecula at the proximal metaphysis of the femur. CONCLUSIONS: The knockout of Cul7 gene may affect both the proliferation of chondrocytes and the endochondral osteogenesis, confirming that Cul7 is essential for the normal development of bone in the body.

Prenatal diagnosis and preimplantation genetics testing of 3M syndrome in a Chinese family with novel biallelic variants of CUL7.

BACKGROUND: 3M syndrome is a rare autosomal recessive developmental disorder characterized by pre and postnatal growth deficiency, dysmorphic facial features, and normal intelligence. 3M syndrome should be suspected in a proband with a combination of characteristic or recognizable dysmorphic features. The diagnosis of 3M syndrome could be confirmed by identifying biallelic variants in CUL7, OBSL1, or CCDC8. METHODS: Whole-exome sequencing (WES) was performed to identify genetic causes. Reverse-transcription polymerase chain reaction (RT-PCR) was performed to detect aberrant splicing events. Haplotypes were constructed using multiplex PCR and sequencing. Variants of the parental haplotype and target likely pathogenic variants were detected by PCR and Sanger sequencing from the embryos. Copy number variant (CNV) detection was performed by next-generation sequencing. RESULTS: We present the case of a nonconsanguineous Chinese couple with one abnormal pregnancy, where the fetus showed 3M phenotypes of shortened long bones. WES identified two novel heterozygous mutations in CUL7: NM_014780.5:c.354del (p.Gln119ArgfsTer52) and NM_014780.5:c.1373-15G>A. RT-PCR from RNA of the mother's peripheral blood leucocytes showed that c.1373-15G>A caused the insertion of a 13-bp extra intron sequence and encoded the mutant p.Leu459ProfsTer25. Both variants were classified as likely pathogenic according to ACMG/AMP guidelines and Clinical Genome Resource specifications. During genetic counseling, the options of prenatal diagnosis through chorionic villus sampling or amniocentesis, adoption, sperm donation, and electing not to reproduce, as well as preimplantation genetic testing for monogenic disorders (PGT-M), were discussed. The couple hopes to conceive a child of their own and refused to accept the 25% risk during the next pregnancy and opted for PGT-M. They finally successfully delivered a healthy baby through PGT-M. CONCLUSION: This study expanded the mutation spectrum of CUL7, detected the aberrant splicing event of CUL7 via RT-PCR, constructed the haplotype for PGT-M, and demonstrated the successful delivery of a healthy baby using PGT-M.

3M syndrome patient with a novel mutation: A case report.

BACKGROUND: A rare autosomal recessive genetic disorder, 3M syndrome, is characterized by severe intrauterine and postnatal growth retardation. Children with 3M syndrome typically exhibit short stature, facial deformities, long tubular bones, and high vertebral bodies but generally lack mental abnormalities or other organ damage. Pathogenic genes associated with 3M syndrome include CUL7, OBSL1 and CCDC8. The clinical and molecular characteristics of patient with 3M syndrome are unique and serve as important diagnostic indicators. CASE SUMMARY: In this case, the patient displayed square shoulders, scoliosis, long slender tubular bones, and normal neurological development. Notably, the patient did not exhibit the typical dysmorphic facial features, relative macrocephaly, or growth retardation commonly observed in individuals with 3M syndrome. Whole exon sequencing revealed a novel heterozygous c.56681+1G>C (Splice-3) variant and a previously reported nonsense heterozygous c.3341G>A (p.Trp1114Ter) variant of OBSL1. Therefore, it is important to note that the clinical features of 3M syndrome may not always be observable, and genetic confirmation is often required. Additionally, the identification of the c.5683+1G>C variant in OBSL1 is noteworthy because it has not been previously reported in public databases. CONCLUSION: Our study identified a new variant (c.5683+1G>C) of OBSL1 that contributes to expanding the molecular profile of 3M syndrome.

Chinese patients with 3M syndrome: clinical manifestations and two novel pathogenic variants.

Background: 3M syndrome is a rare autosomal recessive disease, characterized by intrauterine and postnatal growth retardation, facial dysmorphism, large head circumference, and skeletal changes, has rarely been reported in the Chinese population. Methods: We describe the clinical manifestations and gene variants in four sporadic cases of 3M syndrome in Chinese individuals from different families. Results: All cases had significant growth retardation, relative macrocephaly, and typical facial features. Exome sequencing revealed that two patients with 3M syndrome had homozygous variants of the CUL7 gene: one novel pathogenic variant and one previously reported pathogenic variant; the other two patients were heterozygous for variants in OBSL1, one of which had not been reported previously. Clinical evaluation indicated that these Chinese patients with 3M syndrome shared similar recognizable features with those reported in patients of other ethnic backgrounds, but not all patients with 3M syndrome in this study had normal development milestones. Two patients underwent recombinant human growth hormone (rhGH) therapy and showed accelerated growth in the first 2 years; however, the growth rate slowed in the third year in one case. There were no obvious adverse reactions during rhGH treatment. Conclusion: We report one novel CUL7 and one novel OBSL1 mutation in patients with 3M syndrome. Children with short stature, specific facial features, and physical symptoms should be referred for genetic testing to obtain precise diagnosis and appropriate treatment. The effects of rhGH treatment on adult height requires long-term observation and study in a large sample.

3M syndrome: Evaluating the clinical and laboratory features and the response of the growth hormone treatment: Single center experience.

INTRODUCTION & OBJECTIVE: 3 M Syndrome is a rarely encountered autosomal recessive syndrome characterized by low birth weight, severe postnatal growth deficiency, and minor dysmorphic abnormalities. 3 M-related short stature has been attributed to the resistance to growth hormone (GH) to a certain extent rather than to GH deficiency. The resistance to GH, on the other hand, has been associated with impaired protein scaffolding, transport, and p53-mediated apoptosis at the IGF-1 post-receptor pathway. In this context, the objective of this study is to evaluate the clinical, laboratory, and genetic characteristics of the patients with 3 M syndrome, detect the mutations frequently observed in these patients, and assess their response to GH treatment. MATERIAL&METHODS: The sample of this single-center study consisted of patients diagnosed with 3 M syndrome based on genetic tests between 2007 and 2021. Patients' clinic, laboratory, and genetic characteristics pertaining to the time of admission and follow-up were recorded. All patients except one underwent a growth hormone stimulation test (GHST) (Levo-dopa or insulin tolerance test). Insulin-like growth factor (IGF) generation test was performed on those with sufficient GHST results (0.1 mg/kg/day for four days). RESULTS: The median age of the patients, five females and three males, was 2.8 (0.25-8.12) years at admission. All but one patient were small for gestational age (SGA). The patient with normal birth weight was the baby of a diabetic mother. Obscurin-like 1 (OBSL1) variant was detected in all cases. The median height standard deviation score (SDS) at admission was -4.94 ((-5.63)- (-3.27)) SDS, and the median midparenteral height SDS was -1.27 SDS ((-3.1)- (0.34)). All patients were prepubertal at admission. The GHST response was sufficient in five cases. IGF generation test was performed in three cases. Seven patients received GH therapy (35-57 µg/kg/day). Five of these patients discontinued GH therapy since their growth velocity (GV) fell below normal during treatment. In addition, one case discontinued GH therapy because her IGF-1 value was>2 SDS, and another case received gonadotropin-releasing hormone (GnRH) analogs together with GH therapy. The median age and height SDS of the patients were 10.1 (1.79-18) years and -5.09 SDS ((-7.11)- (2.45)), respectively, as of the last follow-up visit. The height SDS values of the two cases that reached the final height were -7.11 SDS and -3.39 SDS. There were no side effects of GH treatment. CONCLUSION: The study findings indicated a good GV during the early stages of the long-term GH treatment administered to patients with 3 M syndrome. However, response to GH therapy decreased in the following years, and the desired improvement in height SDS could not be achieved in patients who reached their final heights. Taken together with the literature data, it has been concluded that initiating GH therapy in the prepubertal period provided better outcomes than after puberty.

Typical Face, Developmental Delay, and Hearing Loss in a Patient with 3M Syndrome: The Co-Occurrence of Two Rare Conditions.

Introduction: 3M syndrome is an autosomal recessive disorder characterized by characteristic facial features, severe pre- and postnatal growth restriction (<-4 SDS), and normal mental development. 3M syndrome is genetically heterogeneous. Up to date, causative mutations have been demonstrated in 3 genes, cullin-7 (CUL7), obscurin-like 1 (OBSL1), and coiled coil domain containing protein 8 (CCDC8). Case presentation: Here, we report a patient who was referred to our clinic due to short stature and developmental delay. Physical examination revealed prenatal onset short stature, low birth weight, and normal head circumference. She displayed several dysmorphic facial features in addition to developmental delay and bilateral sensorineural hearing loss. The physical findings were suggestive of 3M syndrome. Genetic assessment revealed a novel homozygous frameshift c.418_419delAC (p.Thr140Cysfs*11) variant in the CUL7 gene and a previously reported pathogenic nonsense homozygous c.942C>A (p.Cys314Ter) variant in the ILDR1 gene. The parents were heterozygous for the same variant. Discussion: 3M syndrome should be considered in the differential diagnosis of patients with short stature and typical facial features even if in the presence of other inconsistent features such as developmental delay. In addition, it is important to take into account the co-occurrence of rare autosomal recessive genetic disorders especially in countries with a high consanguineous marriage rate.

Case report: Artemis deficiency and 3M syndrome-coexistence of two distinct genetic disorders.

The presence of two different genetic conditions in the same individual is possible, especially in populations with consanguinity. In this case report, we present the coexistence of Artemis deficiency (OMIM 602450) and Three M (3M) syndrome (OMIM 273750). A 10-months-old male patient with neuromotor developmental delay was evaluated for immunodeficiency due to recurrent respiratory infections diarrhea and oral moniliasis from the age of 1.5 months. He had facial dysmorphism with rotated ears, flat nose and hypertelorism. Neurological examination revealed generalized hypotonia and mental motor delay. Immunological screening of the patient demonstrated mild lymphopenia, hypogammaglobulinemia, reduced number of CD3+ T cells (980 cells/mm3) and CD19+ B cells (35 cells/mm3). He was diagnosed with leaky T-B-NK+ SCID. Exome sequence analysis showed the presence of a homozygous pathogenic DCLRE1C variant [c.194C > T; p.T65I (NM_001033855)] and a homozygous pathogenic variant in OBSL1, a gene associated with 3M syndrome [c.3922C > T; p.R1308X (NM_001173431)]. Our proband died of sepsis and multiple organ failure. This case illustrates that different clinical findings in patients might not be explained with a single genetic defect, and consanguinity increases the change for coexistence of autosomal recessive diseases. Clinicians should consider exome sequencing to identify disease-causing mutations in patients with heterogeneity of clinical findings.

Structural and functional insights into a novel homozygous missense pathogenic variant in CUL7 identified in consanguineous Pakistani family.

3M syndrome is a rare genetic familial disorder characterized by short stature, growth retardation, facial dysmorphism, skeletal abnormalities, fleshy protruding heels, and normal intelligence, caused by mutations in the CUL7, OBSL1 and CCDC8 genes. In the present study, a novel homozygous missense variant of CUL7 (NP_001161842.1, c.4493T > C, p.L1498P) has been identified in a consanguineous Pakistani family by whole exome sequencing. In silico structural evaluation, molecular docking and simulation studies of mutant CUL7 provides substantial evidence about its crucial role in the progression of discussed ailment. The newly discovered variant significantly altered the protein's three dimensional structure, leading to abnormal interaction with binding proteins. This computational and experimental investigation provides useful information to drug developers for the synthesis of novel therapeutics against the discussed ailment.Communicated by Ramaswamy H. Sarma.

3-M syndrome - a primordial short stature disorder with novel CUL7 mutation in two Indian patients.

OBJECTIVE: To evaluate the cause of short stature in children. CASE PRESENTATION: Two children with suspected skeletal dysplasia and short stature were evaluated. CONCLUSIONS: The 3-M syndrome is a primordial growth disorder manifesting severe postnatal growth restriction, skeletal anomalies and prominent fleshy heels. The 3-M syndrome is a genetically heterogeneous disorder and the phenotype is similar. This is a rare autosomal recessive disorder with normal intellect. Two affected children have been identified by whole-exome sequencing. One patient harboured a compound heterozygous variant and the other was a homozygous missense variant. The genetic diagnosis helped in counselling the families and facilitated prenatal diagnosis in one (case 1) family.

3M syndrome: A Tunisian seven-cases series.

3M syndrome (3MS) is a rare autosomal recessive primordial growth disorder characterized by a severe pre- and post-natal growth deficiency, minor dysmorphisms and skeletal abnormalities, contrasting with normal intellect and endocrine function. Three different genes have been so far involved in the disease, with mutations in CUL7, OBSL1 and CCDC8. The CUL7 gene mutations are accountable for 77,5% of the genetically confirmed patients, with a founder mutation identified in exon 24 for the Maghreb families. The follow up is mainly orthopedic with possible GH-based treatment. The objective of this report was to carry out a clinical analysis of a series of Tunisian patients with features evoking 3MS and to perform a molecular analysis of the CLU7 exon 24. We carried out a descriptive retrospective study including Tunisian patients who consulted at the congenital disorders and hereditary diseases department of Charles Nicolle's hospital, Tunis, Tunisia, for intra-uterine onset growth retardation with normal intellect. We selected the patients having characteristic 3MS facial dysmorphia. The molecular analysis of the CUL7 exon 24 was performed using PCR and Sanger sequencing searching the founder mutation c.4451_4452delTG. Seven patients were included in this study. Consanguinity was noted for four families. The mean age at the first consult was 2.5 years. All the patients had an intra-uterine onset growth retardation with a preserved head circumference. All patients presented facial dysmorphia of 3MS, with a prominent forehead (7/7), a triangular face (6/7), an underdeveloped midface (7/7), a fleshy tipped nose (5/7), anteverted nares (6/7), a long philtrum (7/7) and full lips (4/7). All the patients presented skeletal abnormalities with various severities such as lumbar lordosis, hyperextensible joints, short thorax, square shoulders, hip dislocation, and prominent heels. Less frequent features were noted such as spina bifida occulta in one case, and single transverse palmar crease in 4 cases. One GH treatment response was reported. The molecular genetic analysis of the CUL7 gene (exon 24) revealed the founder mutation for all the patients which reinforces the hypothesis of founder effect for 3MS in the Tunisian population.

Natural history of facial and skeletal features from neonatal period to adulthood in a 3M syndrome cohort with biallelic CUL7 or OBSL1 variants.

3M syndrome is characterized by severe pre- and post-natal growth restriction, typical face, slender tubular bones, tall vertebral bodies, prominent heels and normal intelligence. It is caused by biallelic variants of CUL7, OBSL1 and, more rarely, CCDC8. The aim of this study is to evaluate facial and skeletal findings in 3M patients from neonatal period to adulthood. A total of 19 patients with a median age of diagnosis of 9.2 months were included in this study and were followed for two to 20 years. CUL7 and OBSL1 variants were found in 57.9% and 42.1% of patients, respectively, five of which are novel. Most of patients had triangular face, frontal bossing, short fleshy nose, full fleshy lower lip, transverse groove of rib cage, hyperlordosis and prominent heels. Three new early-diagnostic signs were observed in infants; two were infraorbital swelling of the lower lid and facial infantile hemangioma, both of which became less pronounced with aging. The third was the central tubercle of the upper lip that became more prominent with in time. While slender long bones did not change with aging, the tall vertebral bodies became more prominent radiologically. The mean birth length in patients was -4.3 SDS. Eight patients reached a mean final height of -4.9 SDS. Despite described growth hormone (GH) insensitivity in 3M syndrome, 12 patients either with GH deficiency or with normal GH levels were treated with GH; seven patients responded with an increase in height SDS. This study not only provided early diagnostic signs of the syndrome, but also presented important follow-up findings.

The Effect of Combined Growth Hormone and a Gonadotropin-Releasing Hormone Agonist Therapy on Height in Korean 3-M Syndrome Siblings.

3-M syndrome is a rare autosomal recessive growth disorder characterized by severe growth retardation, low birth weight, characteristic facial features, and skeletal anomalies, for which three causative genes (CUL7, OBSL1, and CCDC8) have been identified. We herein report two Korean siblings with 3-M syndrome caused by two novel OBSL1 mutations, and describe the effect of a combined treatment with growth hormone (GH) and a gonadotropin-releasing hormone (GnRH) agonist. A 7-year-old girl with short stature (-3.37 standard deviation score, SDS) and breast budding presented with subtle dysmorphic features, including macrocephaly, frontal bossing, a triangular face, prominent philtrum, full lips, a short neck, and fifth-finger clinodactyly. GnRH stimulation test revealed a pubertal pattern and advanced bone age of 8 years and 10 months. Her older sister, aged 10 years and 9 months, had experienced an early menarche, and had an advanced bone age (13.5 years) and predicted adult height of 142 cm (-4.04 SDS). Targeted exome sequencing identified that the siblings had two heteroallelic mutations in OBSL1. Both siblings underwent a combination therapy with GH and a GnRH agonist. A height gain was noted in both siblings even after short-term treatment. To fully elucidate the effects of the combined therapy, a larger cohort should be analyzed following a longer treatment period. However, such an analysis would be challenging due to the rarity of this disease.

Effect of recombinant human insulin-like growth factor 1 therapy in a child with 3-M syndrome-1 with CUL7 gene mutation.

OBJECTIVE: 3-M syndrome is characterized by severe short stature, syndromic features, and characteristic radiographic findings. Growth hormone (GH) has been used with variable success. Recombinant human insulin like growth factor-1 (rhIGF-1) has never been utilized. CASE PRESENTATION: We describe a child with severe growth retardation, macrocephaly, and skeletal abnormalities with evidence of GH insensitivity subsequently treated with rhIGF-1. He developed morbid obesity and comorbidities including voracious appetite, acanthosis nigricans, tonsillar hypertrophy, and severe obstructive sleep apnea with minimal height improvement. Genetic testing done at 11.5 years revealed a compound heterozygous mutation (c.2112G>A(p.W704X) and c.2559delC) in the CUL7 gene consistent with 3-M syndrome-1. rhIGF-1 therapy was discontinued. CONCLUSIONS: This case highlights the novel use of rhIGF-1 therapy on a child with 3-M syndrome-1 with minimal height benefit but accelerated weight gain and serves as a reminder of the importance of re-evaluating therapy efficacy and side effect profile.