Expression analysis of NF1-mutated alleles in a rare compound heterozygous spinal NF1 patient by digital PCR.

BACKGROUD: Neurofibromatosis type 1 (NF1) is a heterogeneous neurocutaneous disorder. Spinal neurofibromatosis (SNF) is a distinct clinical entity of NF1, characterized by bilateral neurofibromas involving all spinal nerve roots. Although both forms are caused by intragenic heterozygous variants of NF1, missense variants have been associated with SNF, according to a dominant inheritance model causing haploinsufficiency. Most patients carry pathogenic variants in one of the NF1 alleles; nevertheless, patients with both NF1-mutated copies have been described. Interestingly, all NF1 variants carried by the known SNF compound heterozygotes were missense/splicing variants or in-frame insertion-deletions. AIMS: To investigate whether there is a differential expression of NF1 variant alleles in an NF1 compound heterozygous SNF patient possibly contributing to clinical phenotype. MATERIALS & METHODS: We performed an allele-specific expression study, by chip-based digital PCR, in an SNF family carrying two NF1 missense variants. We evaluated the expression levels of the two NF1-mutated alleles both carried by the compound heterozygous SNF patient and his relatives. RESULTS: Both alleles were expressed at comparable levels in the patient and hyper-expressed compared to the wild-type alleles of healthy controls. DISCUSSION: Here we provide new insights into expression studies of NF1-mutated transcripts suggesting that a novel pathogenetic mechanism, caused by gain-of-function variants, could be associated with SNF. CONCLUSIONS: Further studies should be performed in larger cohorts, opening new perspectives in the NF1 pathogenesis comprehension.

Clinical relevance of double heterozygosity revealed by next-generation sequencing of homologous recombination repair pathway genes in South African breast cancer patients.

PURPOSE: Genetically predisposed breast cancer (BC) patients represent a minor but clinically meaningful subgroup of the disease, with 25% of all cases associated with actionable variants in BRCA1/2. Diagnostic implementation of next-generation sequencing (NGS) resulted in the rare identification of BC patients with double heterozygosity for deleterious variants in genes partaking in homologous recombination repair of DNA. As clinical heterogeneity poses challenges for genetic counseling, this study focused on the occurrence and clinical relevance of double heterozygous BC in South Africa. METHODS: DNA samples were diagnostically screened using the NGS-based Oncomine™ BRCA Expanded Research Assay. Data was generated on the Ion GeneStudio S5 system and analyzed using the Torrent Suite™ and reporter software. The clinical significance of the variants detected was determined using international variant classification guidelines and treatment implications. RESULTS: Six of 1600 BC patients (0.375%) tested were identified as being bi-allelic for two germline likely pathogenic or pathogenic variants. Most of the variants were present in BRCA1/2, including two founder-related small deletions in three cases, with family-specific variants detected in ATM, BARD1, FANCD2, NBN, and TP53. The scientific interpretation and clinical relevance were based on the clinical and tumor characteristics of each case. CONCLUSION: This study increased current knowledge of the risk implications associated with the co-occurrence of more than one pathogenic variant in the BC susceptibility genes, confirmed to be a rare condition in South Africa. Further molecular pathology-based studies are warranted to determine whether clinical decision-making is affected by the detection of a second pathogenic variant in BRCA1/2 and TP53 carriers.

The characterization and comorbidities of heterozygous Bardet-Biedl syndrome carriers.

Introduction: Bardet-Biedl syndrome (BBS) is a rare autosomal recessive disorder with clinical features of retinal dystrophy, obesity, postaxial polydactyly, renal anomalies, learning disabilities, hypogonadism, and genitourinary abnormalities. Nevertheless, previous studies on the phenotypic traits of BBS heterozygous carriers have generated inconclusive results. The aim of our study was to investigate the impact of BBS heterozygosity on carriers when compared to non-carriers within the Taiwanese population. Materials and Methods: This study follows a hospital-based case-control design. We employed the Taiwan Biobank version 2 (TWBv2) array to identify three specific loci associated with BBS (rs773862084, rs567573386, and rs199910690). In total, 716 patients were included in the case group, and they were compared to a control group of 2,864 patients who lacked BBS alleles. The control group was selected through gender and age matching at a ratio of 1:4. The association between BBS-related loci and comorbidity was assessed using logistic regression models. Results: We found that BBS heterozygous carriers exhibited a significant association with elevated BMI levels, especially the variant rs199910690 in MKS1 (p=0.0037). The prevalence of comorbidities in the carriers' group was not higher than that in the non-carriers' group. Besides, the average values of the biochemistry data showed no significant differences, except for creatinine level. Furthermore, we conducted a BMI-based analysis to identify specific risk factors for chronic kidney disease (CKD). Our findings revealed that individuals carrying the CA/AA genotype of the BBS2 rs773862084 variant or the CT/TT genotype of the MKS1 rs199910690 variant showed a reduced risk of developing CKD, irrespective of their BMI levels. When stratified by BMI level, obese males with the MKS1 rs199910690 variant and obese females with the BBS2 rs773862084 variant exhibited a negative association with CKD development. Conclusion: We found that aside from the association with overweight and obesity, heterozygous BBS mutations did not appear to increase the predisposition of individuals to comorbidities and metabolic diseases. To gain a more comprehensive understanding of the genetic susceptibility associated with Bardet-Biedl Syndrome (BBS), further research is warranted.

The discovery of acatalasemia (lack of catalase in the blood) and its significance in human genetics.

Catalase, a heme-containing antioxidant enzyme, was once considered essential for human survival. It is widely distributed in the human body and is particularly abundant in red blood cells. The term "acatalasemia" first appeared in the Proceedings of the Japan Academy in 1951, drawing global attention to families genetically deficient in catalase. This deficiency not only altered the significance of catalase but also played a pioneering role in human genetics during an era of limited genetic methodology. In this article, we examine the discovery of acatalasemia by an otolaryngologist during surgery on an 11-year-old girl. This remarkable journey led to epoch-making research spanning biochemistry, hematology, and human genetics.

BRCA1 Intragenic Duplication Combined with a Likely Pathogenic TP53 Variant in a Patient with Triple-Negative Breast Cancer: Clinical Risk and Management.

For patients with hereditary breast and ovarian cancer, the probability of carrying two pathogenic variants (PVs) in dominant cancer-predisposing genes is rare. Using targeted next-generation sequencing (NGS), we investigated a 49-year-old Caucasian woman who developed a highly aggressive breast tumor. Our analyses identified an intragenic germline heterozygous duplication in BRCA1 with an additional likely PV in the TP53 gene. The BRCA1 variant was confirmed by multiplex ligation probe amplification (MLPA), and genomic breakpoints were characterized at the nucleotide level (c.135-2578_442-1104dup). mRNA extracted from lymphocytes was amplified by RT-PCR and then Sanger sequenced, revealing a tandem duplication r.135_441dup; p.(Gln148Ilefs*20). This duplication results in the synthesis of a truncated and, most likely, nonfunctional protein. Following functional studies, the TP53 exon 5 c.472C > T; p.(Arg158Cys) missense variant was classified as likely pathogenic by the Li-Fraumeni Syndrome (LFS) working group. This type of unexpected association will be increasingly identified in the future, with the switch from targeted BRCA sequencing to hereditary breast and ovarian cancer (HBOC) panel sequencing, raising the question of how these patients should be managed. It is therefore important to record and investigate these rare double-heterozygous genotypes.

Risk of cancer in heterozygous relatives of patients with Fanconi anemia.

PURPOSE: Fanconi anemia (FA) is a cancer-prone inherited bone marrow failure syndrome caused by biallelic pathogenic variants in one of >22 genes in the FA/BRCA DNA repair pathway. A major concern is whether the risk of cancer is increased in individuals with a single pathogenic FA gene variant. METHODS: We evaluated the risk of cancer in the relatives of patients with FA in the National Cancer Institute Inherited Bone Marrow Failure Syndrome cohort. We genotyped all available relatives and determined the rates, types of cancer and the age of patients at cancer diagnosis. We calculated the observed-to-expected (O/E) cancer ratios using data from the Surveillance, Epidemiology, and End Results Program adjusted for age, sex, and birth cohort. RESULTS: The risk of cancer was not increased among all FA relatives and FA heterozygotes (O/E ratios of 0.78 and 0.79, respectively). In particular, the risk of cancer was not increased among FANCA or FANCC heterozygotes (O/E ratios of 0.92 and 0.71, respectively). Relatives did not have typical FA cancers, and age at cancer diagnosis was not younger than expected. CONCLUSION: Understanding the risk of cancer in individuals with single pathogenic FA variants is critical for counseling and management. We did not find increased risk of cancer in these individuals. These findings do not extend to the known cancer predisposition autosomal dominant FA genes, namely BRCA1, BRCA2, PALB2, BRIP1, and RAD51C.

A simple screening method for heterozygous female patients with ornithine transcarbamylase deficiency.

Ornithine transcarbamylase deficiency (OTCD), caused by X-linked OTC mutations, is characterized by life-threatening hyperammonemia. Heterozygous female patients are often asymptomatic and usually have milder disease than affected male patients, but can have higher morbidity and mortality rates if the disease progresses prior to diagnosis. Our purpose was to establish a screening method for female heterozygotes with OTCD. We retrospectively identified female patients who underwent plasma amino acid analysis at the National Center for Child Health and Development, using data from electronic medical records from March 2002 to September 2021. We extracted patient age, medical history, and biochemical data, including plasma amino acid levels. Patients were categorized into several groups according to their underlying diseases; those with underlying diseases that could potentially affect plasma amino acid levels, such as mitochondrial disease or short bowel syndrome, were excluded, except for untreated OTCD. Biochemical values were compared between OTCD patients and others using the Mann-Whitney U test. The receiver operator characteristic analysis was performed to assess the diagnostic capability for detecting OTCD in each subject. For patients with multiple test data, the most recent of the measurement dates was used in the analysis. The data sets of 976 patients were included. There were significant differences in values of glutamine, citrulline, arginine, and ammonia, but the diagnostic capacity of each alone was inadequate. By contrast, the (glutamine + glycine)/(citrulline + arginine) ratio was appropriate for discriminating heterozygous female patients with OTCD, with a sensitivity of 100% and specificity of 98.6% when the cutoff level was 15.8; the AUC for this discrimination was 0.996 (95% confidence interval, 0.992 to 1.000). These findings could help identify heterozygous female patients with OTCD before the onset of clinical disease.

Pitfalls of X-chromosome inactivation testing in females with Fabry disease.

Fabry disease (FD) is an X-linked lysosomal storage disorder caused by mutations in the GLA gene encoding alpha-galactosidase A (AGAL). The impact of X-chromosome inactivation (XCI) on the phenotype of female FD patients remains unclear. In this study we aimed to determine pitfalls of XCI testing in a cohort of 35 female FD patients. XCI was assessed by two methylation-based and two allele-specific expression assays. The results correlated, although some variance among the four assays was observed. GLA transcript analyses identified crossing-over in three patients and detected mRNA instability in three out of four analyzed null alleles. AGAL activity correlated with XCI pattern and was not influenced by the mutation type or by reduced mRNA stability. Therefore, AGAL activity may help to detect crossing-over in patients with unstable GLA alleles. Tissue-specific XCI patterns in six patients, and age-related changes in two patients were observed. To avoid misinterpretation of XCI results in female FD patients we show that (i) a combination of several XCI assays generates more reliable results and minimizes possible biases; (ii) correlating XCI to GLA expression and AGAL activity facilitates identification of cross-over events; (iii) age- and tissue-related XCI specificities of XCI patterning should be considered.

Increased Co-Occurrence of Pathogenic Variants in Hereditary Breast and Ovarian Cancer and Lynch Syndromes: A Consequence of Multigene Panel Genetic Testing?

The probability of carrying two pathogenic variants (PVs) in dominant cancer-predisposing genes for hereditary breast and ovarian cancer and lynch syndromes in the same patient is uncommon, except in populations where founder effects exist. Two breast cancer women that are double heterozygotes (DH) for both BRCA1/BRCA2, one ovarian cancer case DH for BRCA1/RAD51C, and another breast and colorectal cancer who is DH for BRCA2/PMS2 were identified in our cohort. Ages at diagnosis and severity of disease in BRCA1/BRCA2 DH resembled BRCA1 single-carrier features. Similarly, the co-existence of the BRCA2 and PMS2 mutations prompted the development of breast and colorectal cancer in the same patient. The first BRCA1/BRCA2 DH was identified by HA-based and Sanger sequencing (1 of 623 families with BRCA PVs). However, this ratio has increased up to 2.9% (1 DH carrier vs. 103 single PV carriers) since using a custom 35-cancer gene on-demand panel. The type of cancer developed in each DH patient was consistent with the independently inherited condition, and the clinical outcome was no worse than in patients with single BRCA1 mutations. Therefore, the clinical impact, especially in patients with two hereditary syndromes, lies in genetic counseling tailor-made for each family based on the clinical guidelines for each syndrome. The number of DH is expected to be increased in the future as a result of next generation sequencing routines.

Decreased Penetrance of Parkinson's Disease in Elderly Carriers of Glucocerebrosidase Gene L444P/R Mutations: A Community-Based 10-Year Longitudinal Study.

BACKGROUND: Heterozygous mutations in the glucocerebrosidase gene (GBA) have been shown to be an important genetic risk factor for Parkinson's disease (PD) worldwide. However, the penetrance of GBA heterozygote for L444P, the common mutation for Asian population, is not known in older Chinese people. OBJECTIVES: To assess the conversion rate to PD in identified carriers of GBA L444P/R mutations in Chinese community-dwelling older adults. METHODS: The GBA gene was sequenced for mutations at position 444 in 8405 people older than 55 years who participated in the Beijing Longitudinal Study on Aging II cohort. Nine subjects were identified as heterozygous carriers of GBA L444P or L444R mutations at baseline and clinically followed up from 2009 to 2019 to investigate their PD conversion, motor and nonmotor symptoms, and change of vesicular monoamine transporter type 2 using tracer of [18 F]9-fluoropropyl-(+)-dihydrotetrabenazine (18 F-DTBZ, also known as 18 F-AV-133). RESULTS: Eight heterozygous GBA L444P and 1 L444R mutation carriers were identified without PD at baseline, and none of them developed clinical parkinsonism after a 10-year follow-up. CONCLUSIONS: Although GBA mutations may lead to an earlier onset PD, the majority of GBA L444P heterozygotes in older adults may not convert to PD. Further studies are warranted to identify factors that modify the risk of conversion. © 2020 International Parkinson and Movement Disorder Society.

Diversity of ATM gene variants: a population-based genome data analysis for precision medicine.

BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.

Alu-mediated Xq24 deletion encompassing CUL4B, LAMP2, ATP1B4, TMEM255A, and ZBTB33 genes causes Danon disease in a female patient.

Cullin 4B (CUL4B), lysosomal-associated membrane protein Type 2 (LAMP2), ATP1B4, TMEM255A, and ZBTB33 are neighboring genes on Xq24. Mutations in CUL4B result in Cabezas syndrome (CS). Male CS patients present with dysmorphic, neuropsychiatric, genitourinary, and endocrine abnormalities. Heterozygous CS females are clinically asymptomatic. LAMP2 mutations cause Danon disease (DD). Cardiomyopathy is a dominant feature of DD present in both males and heterozygous females. No monogenic phenotypes have been associated with mutations in ATP1B4, TMEM255A, and ZBTB33 genes. To facilitate diagnostics and counseling in CS and DD families, we present a female DD patient with a de novo Alu-mediated Xq24 rearrangement causing a deletion encompassing CUL4B, LAMP2, and also the other three neighboring genes. Typical to females heterozygous for CUL4B mutations, the patient was CS asymptomatic, however, presented with extremely skewed X-chromosome inactivation (XCI) ratios in peripheral white blood cells. As a result of the likely selection against CUL4B deficient clones, only minimal populations (~3%) of LAMP2 deficient leukocytes were identified by flow cytometry. On the contrary, myocardial LAMP2 protein expression suggested random XCI. We demonstrate that contiguous CUL4B and LAMP2 loss-of-function copy number variations occur and speculate that male patients carrying similar defects could present with features of both CS and DD.

Heterozygous FXII deficiency is not associated with an increased incidence of thrombotic events: Results of a long term study.

OBJECTIVE: To investigate the incidence of thrombotic events in patients heterozygous for FXII deficiency during a long observation period. PATIENTS AND METHODS: 103 heterozygotes for FXII deficiency, 49 female and 54 male were followed for 19.6 years (range 5-32 years). As controls 103 unaffected family members of same sex and similar age (±5 years) were enrolled. The thrombotic end points were: myocardial infarction, deep vein thrombosis and ischemic stroke. The mean Factor XII level in the heterozygotes was 48.5%: range (35-60%) that of control was 96.5% (range 70-155%). The heterozygotes showed one myocardial infarction, two deep vein thromboses and no ischemic stroke. The unaffected family members observed 2 myocardial infarctions, one deep vein thrombosis and one ischemic stroke. There were seven deliveries (five women) among the heterozygotes and six (five women) among the controls. Furthermore, four and five surgical procedures were carried out in the patient and in the control group, respectively. Immobilization times for surgical procedures or pregnancies were 50 days and 57 days for the heterozygotes and the unaffected family members, respectively. Heterozygotes for FXII deficiency did not show an increased incidence of thrombotic events as compared with unaffected family members during a long follow up.

A comprehensive multiplex PCR based exome-sequencing assay for rapid bloodspot confirmation of inborn errors of metabolism.

BACKGROUND: Tandem mass spectrometry (MS MS) and simple fluorometric assays are currently used in newborn screening programs to detect inborn errors of metabolism (IEM). The aim of the study was to evaluate the clinical utility of exome sequencing as a second tier screening method to assist clinical diagnosis of the newborn. METHODS: A novel PCR-exome amplification and re-sequencing (PEARS) assay was designed and used to detect mutations in 122 genes associated with 101 IEM. Newborn bloodspots positive by biochemical testing were analysed by PEARS assay to detect pathogenic mutations relevant to the IEM. RESULTS: In initial validation studies of genomic DNA samples, PEARS assay correctly detected 25 known mutations associated with 17 different IEM. Retrospective gene analysis of newborns with clinical phenylketonuria (PKU), identified compound heterozygote phenylalanine hydroxylase (PAH) gene mutations in eight of nine samples (89%). Prospective analysis of 211 bloodspots correctly identified the two true PKU samples, yielding positive and negative predictive values of 100%. Testing of 8 true positive MS MS samples correctly identified potentially pathogenic compound heterozygote genotypes in 2 cases of citrullinemia type 1 and one case each of methylmalonic acidemia, isobutyryl-CoA dehydrogenase deficiency, short chain acyl-CoA dehydrogenase deficiency and glutaric acid type II and heterozygous genotypes in 2 cases of autosomal dominant methioninemia. Analysis of 11 of 12 false positive MS MS samples for other IEM identified heterozygous carriers in 8 cases for the relevant genes associated with the suspected IEM. In the remaining 3 cases, the test revealed compound heterozygote mutations in other metabolic genes not associated with the suspected IEM, indicating a misinterpretation of the original MS MS data. CONCLUSIONS: The PEARS assay has clinical utility as a rapid and cost effective second-tier test to assist the clinician to accurately diagnose newborns with a suspected IEM.

Impact of ZBTB7A hypomethylation and expression patterns on treatment response to hydroxyurea.

BACKGROUND: We aimed to clarify the emerging epigenetic landscape in a group of genes classified as "modifier genes" of the ß-type globin genes (HBB cluster), known to operate in trans to accomplish the two natural developmental switches in globin expression, from embryonic to fetal during the first trimester of conception and from fetal to adult around the time of birth. The epigenetic alterations were determined in adult sickle cell anemia (SCA) homozygotes and SCA/ß-thalassemia compound heterozygotes of Greek origin, who are under hydroxyurea (HU) treatment. Patients were distinguished in HU responders and HU non-responders (those not benefited from the HU) and both, and in vivo and in vitro approaches were implemented. RESULTS: We examined the CpG islands' DNA methylation profile of BCL11A, KLF1, MYB, MAP3K5, SIN3A, ZBTB7A, and GATA2, along with γ-globin and LRF/ZBTB7A expression levels. In vitro treatment of hematopoietic stem cells (HSCs) with HU induced a significant DNA hypomethylation pattern in ZBTB7A (p*, 0.04) and GATA2 (p*, 0.03) CpGs exclusively in the HU non-responders. Also, this group of patients exhibited significantly elevated baseline methylation patterns in ZBTB7A, before the HU treatment, compared to HU responders (p*, 0.019) and to control group of healthy individuals (p*, 0.021), which resembles a potential epigenetic barrier for the γ-globin expression. γ-Globin expression in vitro matched with detected HbF levels during patients' monitoring tests (in vivo) under HU treatment, implying a good reproducibility of the in vitro HU epigenetic effect. LRF/ZBTB7A expression was elevated only in the HU non-responders under the influence of HU. CONCLUSIONS: This is one of the very first pharmacoepigenomic studies indicating that the hypomethylation of ZBTB7A during HU treatment enhances the LRF expression, which by its turn suppresses the HbF resumption in the HU non-responders. Its role as an epigenetic regulator of hemoglobin switching is also supported by the wide distribution of ZBTB7A-binding sites within the 5' CpG sequences of all studied human HBB cluster "modifier genes." Also, the baseline methylation level of selective CpGs in ZBTB7A and GATA2 could be an indicator of the negative HU response among the ß-type hemoglobinopathy patients.

Lipid profile and genetic status in a familial hypercholesterolemia pediatric population: exploring the LDL/HDL ratio.

Background Familial hypercholesterolemia (FH) is a genetic disorder caused by mutations in genes involved in low-density lipoprotein (LDL) uptake (LDLR, APOB and PCSK9). Genetic diagnosis is particularly useful in asymptomatic children allowing for the detection of definite FH patients. Furthermore, defining their genetic status may be of considerable importance as the compound heterozygous status is much more severe than the heterozygous one. Our study aims at depicting the genetic background of an Italian pediatric population with FH focusing on the correlation between lipid profile and genetic status. Methods Out of 196 patients with clinically suspected FH (LDL-cholesterol [LDL-C] levels above 3.37 mmol/L, cholesterol level above 6.46 mmol/L in a first-degree relative or the presence of premature cardiovascular acute disease in a first/second-degree relative), we screened 164 index cases for mutations in the LDLR, APOB and PCSK9 genes. Results Patients with mutations (129/164) showed increased levels of LDL-C, 95th percentile-adjusted LDL-C and LDL/high-density lipoprotein (HDL) ratio and decreased levels of HDL-C, adjusted HDL-C. The association of the LDL/HDL ratio with the presence of mutations was assessed independently of age, (body mass index) BMI, parental hypercholesterolemia, premature coronary artery disease (CAD), triglycerides by multivariate logistic regression (odds ratio [OR]=1.701 [1.103-2.621], p=0.016). The LDL/HDL ratio gradually increased from patients without mutations to patients with missense mutations, null mutations and compound heterozygotes. Conclusions In conclusion, the LDL/HDL ratio proved to be a better parameter than LDL-C for discriminating patients with from patients without mutations across different genetic statuses.

LAMP2 exon-copy number variations in Danon disease heterozygote female probands: Infrequent or underdetected?

Danon disease (DD) is an X-linked disorder caused by mutations in the lysosomal-associated membrane protein 2 (LAMP2) gene (Xq24). DD is characterized by cognitive deficit, myopathy, and cardiomyopathy in male patients. The phenotype is variable and mitigated in females. The timely identification of de-novo LAMP2 mutated family members, many of whom are heterozygous females, remains critical for their treatment and family counseling. DD laboratory testing builds on minimally invasive quantification of the LAMP2 protein in white blood cells and characterization of the specific mutation. This integrative approach is particularly helpful when assessing suspect female heterozygotes. LAMP2 exon-copy number variations (eCNVs) were so far reported only in X-hemizygous male DD probands. In heterozygous female DD probands, the wild-type allele may hamper the identification of an eCNV even if it results in the complete abolition of LAMP2 transcription and/or translation. To document the likely underappreciated rate of occurrence and point out numerous potential pitfalls of detection of the LAMP2 eCNVs, we present the first two DD heterozygote female probands who harbor novel multi-exon LAMP2 deletions. Critical for counseling and recurrence prediction, we also highlight the need to search for somatic-germinal mosaicism in DD families.

Validation of high-resolution melting analysis as a diagnostic tool for endothelin receptor B mutation in American Paint horses and allele frequency estimation.

Overo lethal white foal syndrome (OLWFS) is a genetic disorder caused by a dinucleotide mutation in the endothelin receptor type B (EDNRB) gene leading to the death of affected foals shortly after birth. The use of rapid and reliable genetic testing is imperative for the early diagnosis of the mutation avoiding, therefore, either additional suffering or the production of affected animals. In the present study, we developed and validated a high-resolution melting (HRM) genotyping assay to detect the OLWFS causative mutation, and we also determined the frequency of heterozygotes among American Paint horses in Brazil. The HRM genotyping assay resulted in a high sensitivity, specificity, and positive and negative predictive values. The overall estimated frequency of heterozygotes was 21.6%; however, this frequency increased to 89.5% when considering only overo horses. The HRM assay optimized here was a reliable and suitable method for the detection of the dinucleotide mutation observed in the EDNRB gene resulting in a fast, accurate, and precise diagnostic tool. The causative gene mutation of OLWFS is present in heterozygosity in the American Paint Horse population in Brazil and is highly frequent among overo horses.

Plasma LysoGb3: A useful biomarker for the diagnosis and treatment of Fabry disease heterozygotes.

BACKGROUND: Fabry disease (FD) is a rare X-linked lysosomal storage disorder due to mutations in the α-galactosidase A gene (GLA) that result in absent or markedly reduce α-galactosidase A (α-GalA) enzymatic activity. As a result, the major glycosphingolipid substrates, globotriaosylceramide (Gb3) and globotriaosylsphingosine (LysoGb3) accumulate in plasma, urine and tissue lysosomes. In females, the diagnosis can be complicated by the fact that 40-50% of GLA-mutation confirmed heterozygotes have normal or only slightly decreased leukocyte α-GalA activities. Recently, LysoGb3 has been appreciated as a novel FD biomarker, especially for therapeutic monitoring. METHODS: Among our GLA-mutation proven FD patients, we screened 18 heterozygotes whose leukocyte α-GalA activity was determined at initial diagnosis. For these females, we measured their serum LysoGb3 levels using highly-sensitive electrospray ionization liquid chromatography tandem mass spectrometry. RESULTS: We identified three unrelated females in whom the accumulating LysoGb3 was increased, whereas their leukocyte α-GalA activities were in the normal range. CONCLUSION: LysoGb3 serves as an useful biomarker to improve the diagnosis of FD heterozygotes and for therapeutic evaluation and monitoring.

X-chromosome inactivation in female patients with Fabry disease.

Fabry disease (FD) is an X-linked genetic disorder caused by the deficient activity of lysosomal α-galactosidase (α-Gal). While males are usually severely affected, clinical presentation in female patients may be more variable ranging from asymptomatic to, occasionally, as severely affected as male patients. The aim of this study was to evaluate the existence of skewed X-chromosome inactivation (XCI) in females with FD, its concordance between tissues, and its contribution to the phenotype. Fifty-six females with FD were enrolled. Clinical and biological work-up included two global scores [Mainz Severity Score Index (MSSI) and DS3], cardiac magnetic resonance imaging, measured glomerular filtration rate, and measurement of α-Gal activity. XCI was analyzed in four tissues using DNA methylation studies. Skewed XCI was found in 29% of the study population. A correlation was found in XCI patterns between blood and the other analyzed tissues although some punctual variability was detected. Significant differences in residual α-Gal levels, severity scores, progression of cardiomyopathy and deterioration of kidney function, depending on the direction and degree of skewing of XCI were evidenced. XCI significantly impacts the phenotype and natural history of FD in females.