A Deep Neural Network for Predicting and Engineering Alternative Polyadenylation.

Alternative polyadenylation (APA) is a major driver of transcriptome diversity in human cells. Here, we use deep learning to predict APA from DNA sequence alone. We trained our model (APARENT, APA REgression NeT) on isoform expression data from over 3 million APA reporters. APARENT's predictions are highly accurate when tasked with inferring APA in synthetic and human 3'UTRs. Visualizing features learned across all network layers reveals that APARENT recognizes sequence motifs known to recruit APA regulators, discovers previously unknown sequence determinants of 3' end processing, and integrates these features into a comprehensive, interpretable, cis-regulatory code. We apply APARENT to forward engineer functional polyadenylation signals with precisely defined cleavage position and isoform usage and validate predictions experimentally. Finally, we use APARENT to quantify the impact of genetic variants on APA. Our approach detects pathogenic variants in a wide range of disease contexts, expanding our understanding of the genetic origins of disease.

Rewards and dangers of regulatory innovation.

Adaptive evolution often involves structural variation affecting genes or cis-regulatory changes that engender novel and favorable gain-of-function gene regulation. Such mutation could result in a favorable dominant trait. At the same time, the gene product could be dosage sensitive if its change in concentration disrupts another trait. As a result, the mutant allele would display dosage-sensitive pleiotropy (DSP). By minimizing imbalance while conserving the favorable dominant effect, heterozygosity can increase fitness and result in heterosis. The properties of these alleles are consistent with evidence from multiple studies that indicate increased fitness of heterozygous regulatory mutations. DSP can help explain mysterious properties of heterosis as well as other effects of hybridization.

Alternative polyadenylation quantitative trait methylation mapping in human cancers provides clues into the molecular mechanisms of APA.

Genetic variants are involved in the orchestration of alternative polyadenylation (APA) events, while the role of DNA methylation in regulating APA remains unclear. We generated a comprehensive atlas of APA quantitative trait methylation sites (apaQTMs) across 21 different types of cancer (1,612 to 60,219 acting in cis and 4,448 to 142,349 in trans). Potential causal apaQTMs in non-cancer samples were also identified. Mechanistically, we observed a strong enrichment of cis-apaQTMs near polyadenylation sites (PASs) and both cis- and trans-apaQTMs in proximity to transcription factor (TF) binding regions. Through the integration of ChIP-signals and RNA-seq data from cell lines, we have identified several regulators of APA events, acting either directly or indirectly, implicating novel functions of some important genes, such as TCF7L2, which is known for its involvement in type 2 diabetes and cancers. Furthermore, we have identified a vast number of QTMs that share the same putative causal CpG sites with five different cancer types, underscoring the roles of QTMs, including apaQTMs, in the process of tumorigenesis. DNA methylation is extensively involved in the regulation of APA events in human cancers. In an attempt to elucidate the potential underlying molecular mechanisms of APA by DNA methylation, our study paves the way for subsequent experimental validations into the intricate biological functions of DNA methylation in APA regulation and the pathogenesis of human cancers. To present a comprehensive catalog of apaQTM patterns, we introduce the Pancan-apaQTM database, available at https://pancan-apaqtm-zju.shinyapps.io/pancanaQTM/.

Multi-level regulation of even-skipped stripes by the ubiquitous factor Zelda.

The zinc-finger protein Zelda (Zld) is a key activator of zygotic transcription in early Drosophila embryos. Here, we study Zld-dependent regulation of the seven-striped pattern of the pair-rule gene even-skipped (eve). Individual stripes are regulated by discrete enhancers that respond to broadly distributed activators; stripe boundaries are formed by localized repressors encoded by the gap genes. The strongest effects of Zld are on stripes 2, 3 and 7, which are regulated by two enhancers in a 3.8 kb genomic fragment that includes the eve basal promoter. We show that Zld facilitates binding of the activator Bicoid and the gap repressors to this fragment, consistent with its proposed role as a pioneer protein. To test whether the effects of Zld are direct, we mutated all canonical Zld sites in the 3.8 kb fragment, which reduced expression but failed to phenocopy the abolishment of stripes caused by removing Zld in trans. We show that Zld also indirectly regulates the eve stripes by establishing specific gap gene expression boundaries, which provides the embryonic spacing required for proper stripe activation.

Advances in computational and experimental approaches for deciphering transcriptional regulatory networks: Understanding the roles of cis-regulatory elements is essential, and recent research utilizing MPRAs, STARR-seq, CRISPR-Cas9, and machine learning has yielded valuable insights.

Understanding the influence of cis-regulatory elements on gene regulation poses numerous challenges given complexities stemming from variations in transcription factor (TF) binding, chromatin accessibility, structural constraints, and cell-type differences. This review discusses the role of gene regulatory networks in enhancing understanding of transcriptional regulation and covers construction methods ranging from expression-based approaches to supervised machine learning. Additionally, key experimental methods, including MPRAs and CRISPR-Cas9-based screening, which have significantly contributed to understanding TF binding preferences and cis-regulatory element functions, are explored. Lastly, the potential of machine learning and artificial intelligence to unravel cis-regulatory logic is analyzed. These computational advances have far-reaching implications for precision medicine, therapeutic target discovery, and the study of genetic variations in health and disease.

Shared cis-regulatory modules control expression of the tandem paralogs midline and H15 in the follicular epithelium.

The posterior end of the follicular epithelium is patterned by midline (MID) and its paralog H15, the Drosophila homologs of the mammalian Tbx20 transcription factor. We have previously identified two cis-regulatory modules (CRMs) that recapitulate the endogenous pattern of mid in the follicular epithelium. Here, using CRISPR/Cas9 genome editing, we demonstrate redundant activity of these mid CRMs. Although the deletion of either CRM alone generated marginal change in mid expression, the deletion of both CRMs reduced expression by 60%. Unexpectedly, the deletion of the 5' proximal CRM of mid eliminated H15 expression. Interestingly, expression of these paralogs in other tissues remained unaffected in the CRM deletion backgrounds. These results suggest that the paralogs are regulated by a shared CRM that coordinates gene expression during posterior fate determination. The consistent overlapping expression of mid and H15 in various tissues may indicate that the paralogs could also be under shared regulation by other CRMs in these tissues.

Exploring plant cis-regulatory elements at single-cell resolution: overcoming biological and computational challenges to advance plant research.

Cis-regulatory elements (CREs) are important sequences for gene expression and for plant biological processes such as development, evolution, domestication, and stress response. However, studying CREs in plant genomes has been challenging. The totipotent nature of plant cells, coupled with the inability to maintain plant cell types in culture and the inherent technical challenges posed by the cell wall has limited our understanding of how plant cell types acquire and maintain their identities and respond to the environment via CRE usage. Advances in single-cell epigenomics have revolutionized the field of identifying cell-type-specific CREs. These new technologies have the potential to significantly advance our understanding of plant CRE biology, and shed light on how the regulatory genome gives rise to diverse plant phenomena. However, there are significant biological and computational challenges associated with analyzing single-cell epigenomic datasets. In this review, we discuss the historical and foundational underpinnings of plant single-cell research, challenges, and common pitfalls in the analysis of plant single-cell epigenomic data, and highlight biological challenges unique to plants. Additionally, we discuss how the application of single-cell epigenomic data in various contexts stands to transform our understanding of the importance of CREs in plant genomes.

Regulatory roles of long non-coding RNAs in short-term heat stress in adult worker bees.

Long non-coding RNAs (lncRNAs) are crucial modulators of post-transcriptional gene expression regulation, cell fate determination, and disease development. However, lncRNA functions during short-term heat stress in adult worker bees are poorly understood. Here, we performed deep sequencing and bioinformatic analyses of honeybee lncRNAs. RNA interference was performed by using siRNA targeting the most highly expressed lncRNA. The silencing effect on lncRNA and the relative expression levels of seven heat shock protein (HSP) genes, were subsequently examined. Overall, 7,842 lncRNAs and 115 differentially expressed lncRNAs (DELs) were identified in adult worker bees following heat stress exposure. Structural analysis revealed that the overall expression abundance, length of transcripts, exon number, and open reading frames of lncRNAs were lower than those of mRNAs. GO analysis revealed that the target genes were mainly involved in "metabolism," "protein folding," "response to stress," and "signal transduction" pathways. KEGG analysis indicated that the "protein processing in endoplasmic reticulum" and "longevity regulating pathway-multiple species" pathways were most enriched. Quantitative real-time polymerase chain reaction (qRT-PCR) detection of the selected DELs confirmed the reliability of the sequencing data. Moreover, the siRNA experiment indicated that feeding siRNA yielded a silencing efficiency of 77.51% for lncRNA MSTRG.9645.5. Upon silencing this lncRNA, the expression levels of three HSP genes were significantly downregulated (p < 0.05), whereas those of three other HSP genes were significantly upregulated (p < 0.05). Our results provide a new perspective for understanding the regulatory mechanisms of lncRNAs in adult worker bees under short-term heat stress.

Initiation of Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 activity.

During retinal development, a large subset of progenitors upregulates the transcription factor Otx2, which is required for photoreceptor and bipolar cell formation. How these retinal progenitor cells initially activate Otx2 expression is unclear. To address this, we investigated the cis-regulatory network that controls Otx2 expression in mice. We identified a minimal enhancer element, DHS-4D, that drove expression in newly formed OTX2+ cells. CRISPR/Cas9-mediated deletion of DHS-4D reduced OTX2 expression, but this effect was diminished in postnatal development. Systematic mutagenesis of the enhancer revealed that three basic helix-loop-helix (bHLH) transcription factor-binding sites were required for its activity. Single cell RNA-sequencing of nascent Otx2+ cells identified the bHLH factors Ascl1 and Neurog2 as candidate regulators. CRISPR/Cas9 targeting of these factors showed that only the simultaneous loss of Ascl1 and Neurog2 prevented OTX2 expression. Our findings suggest that Ascl1 and Neurog2 act either redundantly or in a compensatory fashion to activate the DHS-4D enhancer and Otx2 expression. We observed redundancy or compensation at both the transcriptional and enhancer utilization levels, suggesting that the mechanisms governing Otx2 regulation in the retina are flexible and robust.

LINC02454 promotes thyroid carcinoma progression via upregulating HMGA2 through CREB1.

Thyroid carcinoma (THCA) is the most common malignancy in the endocrine system. Long intergenic non-coding RNA 2454 (LINC02454) exhibits an HMGA2-like expression pattern, but their relationship and roles in THCA are largely unknown. The present purpose was to delineate the roles of LINC02454 in THCA progression and its molecular mechanisms. We collected THCA tissues from patients and monitored patient survival. THCA cell colony formation, migration, and invasion were evaluated. Metastasis was evaluated by examining EMT markers through Western blotting. Gene interaction was determined with ChIP, RIP, RNA pull-down, and luciferase activity assays. A mouse model of a subcutaneous tumor was used to determine the activity of LINC02454 knockdown in vivo. We found that LINC02454 was highly expressed in THCA, and its upregulation was associated with poor survival. The knockdown of LINC02454 repressed colony formation, migration, and invasion. Moreover, loss of LINC02454 inhibited tumor growth and metastasis in mice. HMGA2 promoted LINC02454 transcription via binding to the LINC02454 promoter, and silencing of HMGA2 suppressed malignant behaviors through downregulation of LINC02454. HMGA2 was a novel functional target of LINC02454 in THCA cells, and knockdown of LINC02454-mediated anti-tumor effects was reversed by HMGA2 overexpression. Mechanically, LINC02454 promoted CREB1 phosphorylation and nuclear translocation, and CREB1 was subsequently bound to the HMGA2 promoter to facilitate its expression. LINC02454 cis-regulates HMGA2 transcription via facilitating CREB1 phosphorylation and nuclear translocation, and, in turn, HMGA2 promotes LINC02454 expression, thus accelerating thyroid carcinoma progression. Our results support therapeutic targets of LINC02454 and HMGA2 for THCA.

The regulatory roles of small nucleolar RNAs within their host locus.

Small nucleolar RNAs (snoRNAs) are a class of conserved noncoding RNAs forming complexes with proteins to catalyse site-specific modifications on ribosomal RNA. Besides this canonical role, several snoRNAs are now known to regulate diverse levels of gene expression. While these functions are carried out in trans by mature snoRNAs, evidence has also been emerging of regulatory roles of snoRNAs in cis, either within their genomic locus or as longer transcription intermediates during their maturation. Herein, we review recent findings that snoRNAs can interact in cis with their intron to regulate the expression of their host gene. We also explore the ever-growing diversity of longer host-derived snoRNA extensions and their functional impact across the transcriptome. Finally, we discuss the role of snoRNA duplications into forging these new layers of snoRNA-mediated regulation, as well as their involvement in the genomic imprinting of their host locus.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Analysis of lncRNA-related studies of ivermectin-sensitive and -resistant strains of Haemonchus contortus.

In this study, 858 novel long non-coding RNAs (lncRNAs) were predicted as sensitive and resistant strains of Haemonchus contortus to ivermectin. These lncRNAs underwent bioinformatic analysis. In total, 205 lncRNAs significantly differed using log2 (difference multiplicity) > 1 or log2 (difference multiplicity) < - 1 and FDR < 0.05 as the threshold for significant difference analysis. We selected five lncRNAs based on significant differences in expression, cis-regulation, and their association with the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathways. These expressions of lncRNAs, namely MSTRG.12610.1, MSTRG.8169.1, MSTRG.6355.1, MSTRG.980.1, and MSTRG.9045.1, were significantly downregulated. These findings were consistent with the results of transcriptomic sequencing. We further investigated the relative expression of target gene mRNAs and the regulation of mRNA and miRNA, starting with lncRNA cis-regulation of mRNA, and constructed a lncRNA-mRNA-miRNA network regulation. After a series of statistical analyses, we finally screened out UGT8, Unc-116, Fer-related kinase-1, GGPP synthase 1, and sart3, which may be involved in developing drug resistance under the regulation of their corresponding lncRNAs. The findings of this study provide a novel direction for future studies on drug resistance targets.

Promoter evolution of mammalian gene duplicates.

BACKGROUND: Gene duplication is thought to be a central process in evolution to gain new functions. The factors that dictate gene retention following duplication as well paralog gene divergence in sequence, expression and function have been extensively studied. However, relatively little is known about the evolution of promoter regions of gene duplicates and how they influence gene duplicate divergence. Here, we focus on promoters of paralog genes, comparing their similarity in sequence, in the sets of transcription factors (TFs) that bind them, and in their overall promoter architecture. RESULTS: We observe that promoters of recent duplications display higher sequence similarity between them and that sequence similarity rapidly declines between promoters of more ancient paralogs. In contrast, similarity in cis-regulation, as measured by the set of TFs that bind promoters of both paralogs, does not simply decrease with time from duplication and is instead related to promoter architecture-paralogs with CpG Islands (CGIs) in their promoters share a greater fraction of TFs, while CGI-less paralogs are more divergent in their TF binding set. Focusing on recent duplication events and partitioning them by their duplication mechanism enables us to uncover promoter properties associated with gene retention, as well as to characterize the evolution of promoters of newly born genes: In recent retrotransposition-mediated duplications, we observe asymmetry in cis-regulation of paralog pairs: Retrocopy genes are lowly expressed and their promoters are bound by fewer TFs and are depleted of CGIs, in comparison with the original gene copy. Furthermore, looking at recent segmental duplication regions in primates enable us to compare successful retentions versus loss of duplicates, showing that duplicate retention is associated with fewer TFs and with CGI-less promoter architecture. CONCLUSIONS: In this work, we profiled promoters of gene duplicates and their inter-paralog divergence. We also studied how their characteristics are associated with duplication time and duplication mechanism, as well as with the fate of these duplicates. These results underline the importance of cis-regulatory mechanisms in shaping the evolution of new genes and their fate following duplication.

Are TaNAC Transcription Factors Involved in Promoting Wheat Yield by cis-Regulation of TaCKX Gene Family?

NAC transcription factors (TFs) are one of the largest TF families in plants, and TaNACs have been known to participate in the regulation of the transcription of many yield-regulating genes in bread wheat. The TaCKX gene family members (GFMs) have already been shown to regulate yield-related traits, including grain mass and number, leaf senescence, and root growth. The genes encode cytokinin (CK) degrading enzymes (CKXs) and are specifically expressed in different parts of developing wheat plants. The aim of the study was to identify and characterize TaNACs involved in the cis-regulation of TaCKX GFMs. After analysis of the initial transcription factor data in 1.5 Kb cis-regulatory sequences of a total of 35 homologues of TaCKX GFMs, we selected five of them, namely TaCKX1-3A, TaCKX22.1-3B, TaCKX5-3D, TaCKX9-1B, and TaCKX10, and identified five TaNAC genes: TaNACJ-1, TaNAC13a, TaNAC94, TaNACBr-1, and TaNAC6D, which are potentially involved in the cis-regulation of selected TaCKX genes, respectively. Protein feature analysis revealed that all of the selected TaNACs have a conserved NAC domain and showed a stable tertiary structure model. The expression profile of the selected TaNACs was studied in 5 day-old seedling roots, 5-6 cm inflorescences, 0, 4, 7, and 14 days-after-pollination (DAP) spikes, and the accompanying flag leaves. The expression pattern showed that all of the selected TaNACs were preferentially expressed in seedling roots, 7 and 14 DAP spikes, and flag leaves compared to 5-6 cm inflorescence and 0 and 4 DAP spikes and flag leaves in Kontesa and Ostka spring wheat cultivars (cvs.). In conclusion, the results of this study highlight the potential role of the selected TaNACs in the regulation of grain productivity, leaf senescence, root growth, and response to various stresses.

Role of lncRNAs in cis- and trans-regulatory responses to salt in Populus trichocarpa.

Long non-coding RNAs (lncRNAs) are emerging as versatile regulators in diverse biological processes. However, little is known about their cis- and trans-regulatory contributions in gene expression under salt stress. Using 27 RNA-seq data sets from Populus trichocarpa leaves, stems and roots, we identified 2988 high-confidence lncRNAs, including 1183 salt-induced differentially expressed lncRNAs. Among them, 301 lncRNAs have potential for positively affecting their neighboring genes, predominantly in a cis-regulatory manner rather than by co-transcription. Additionally, a co-expression network identified six striking salt-associated modules with a total of 5639 genes, including 426 lncRNAs, and in these lncRNA sequences, the DNA/RNA binding motifs are enriched. This suggests that lncRNAs might contribute to distant gene expression of the salt-associated modules in a trans-regulatory manner. Moreover, we found 30 lncRNAs that have potential to simultaneously cis- and trans-regulate salt-responsive homologous genes, and Ptlinc-NAC72, significantly induced under long-term salt stress, was selected for validating its regulation of the expression and functional roles of the homologs PtNAC72.A and PtNAC72.B (PtNAC72.A/B). The transient transformation of Ptlinc-NAC72 and a dual-luciferase assay of Ptlinc-NAC72 and PtNAC72.A/B promoters confirmed that Ptlinc-NAC72 can directly upregulate PtNAC72.A/B expression, and a presence/absence assay was further conducted to show that the regulation is probably mediated by Ptlinc-NAC72 recognizing the tandem elements (GAAAAA) in the PtNAC72.A/B 5' untranslated region (5'-UTR). Finally, the overexpression of Ptlinc-NAC72 produces a hypersensitive phenotype under salt stress. Altogether, our results shed light on the cis- and trans-regulation of gene expression by lncRNAs in Populus and provides an example of long-term salt-induced Ptlinc-NAC72 that could be used to mitigate growth costs by conferring plant resilience to salt stress.

Reporter gene assays and chromatin-level assays define substantially non-overlapping sets of enhancer sequences.

BACKGROUND: Transcriptional enhancers are essential for gene regulation, but how these regulatory elements are best defined remains a significant unresolved question. Traditional definitions rely on activity-based criteria such as reporter gene assays, while more recently, biochemical assays based on chromatin-level phenomena such as chromatin accessibility, histone modifications, and localized RNA transcription have gained prominence. RESULTS: We examine here whether these two types of definitions, activity-based and chromatin-based, effectively identify the same sets of sequences. We find that, concerningly, the overlap between the two groups is strikingly limited. Few of the data sets we compared displayed statistically significant overlap, and even for those, the degree of overlap was typically small (below 40% of sequences). Moreover, a substantial batch effect was observed in which experiment set rather than experimental method was a primary driver of whether or not chromatin-defined enhancers showed a strong overlap with reporter gene-defined enhancers. CONCLUSIONS: Our results raise important questions as to the appropriateness of both old and new enhancer definitions, and suggest that new approaches are required to reconcile the poor agreement among existing methods for defining enhancers.

The transcriptomic landscape of neurons carrying PSEN1 mutations reveals changes in extracellular matrix components and non-coding gene expression.

Alzheimer's disease (AD) is a progressive and irreversible brain disorder, which can occur either sporadically, due to a complex combination of environmental, genetic, and epigenetic factors, or because of rare genetic variants in specific genes (familial AD, or fAD). A key hallmark of AD is the accumulation of amyloid beta (Aß) and Tau hyperphosphorylated tangles in the brain, but the underlying pathomechanisms and interdependencies remain poorly understood. Here, we identify and characterise gene expression changes related to two fAD mutations (A79V and L150P) in the Presenilin-1 (PSEN1) gene. We do this by comparing the transcriptomes of glutamatergic forebrain neurons derived from fAD-mutant human induced pluripotent stem cells (hiPSCs) and their individual isogenic controls generated via precision CRISPR/Cas9 genome editing. Our analysis of Poly(A) RNA-seq data detects 1111 differentially expressed coding and non-coding genes significantly altered in fAD. Functional characterisation and pathway analysis of these genes reveal profound expression changes in constituents of the extracellular matrix, important to maintain the morphology, structural integrity, and plasticity of neurons, and in genes involved in calcium homeostasis and mitochondrial oxidative stress. Furthermore, by analysing total RNA-seq data we reveal that 30 out of 31 differentially expressed circular RNA genes are significantly upregulated in the fAD lines, and that these may contribute to the observed protein-coding gene expression changes. The results presented in this study contribute to a better understanding of the cellular mechanisms impacted in AD neurons, ultimately leading to neuronal damage and death.

Allele-Specific QTL Fine Mapping with PLASMA.

Although quantitative trait locus (QTL) associations have been identified for many molecular traits such as gene expression, it remains challenging to distinguish the causal nucleotide from nearby variants. In addition to traditional QTLs by association, allele-specific (AS) QTLs are a powerful measure of cis-regulation that are concordant with traditional QTLs but typically less susceptible to technical/environmental noise. However, existing methods for estimating causal variant probabilities (i.e., fine mapping) cannot produce valid estimates from asQTL signals due to complexities in linkage disequilibrium (LD). We introduce PLASMA (Population Allele-Specific Mapping), a fine-mapping method that integrates QTL and asQTL information to improve accuracy. In simulations, PLASMA accurately prioritizes causal variants over a wide range of genetic architectures. Applied to RNA-seq data from 524 kidney tumor samples, PLASMA achieves a greater power at 50 samples than conventional QTL-based fine mapping at 500 samples, with more than 17% of loci fine mapped to within five causal variants, compared to 2% by QTL-based fine mapping, and a 6.9-fold overall reduction in median credible set size compared to QTL-based fine mapping when applied to H3K27AC ChIP-seq from just 28 prostate tumor/normal samples. Variants in the PLASMA credible sets for RNA-seq and ChIP-seq were enriched for open chromatin and chromatin looping, respectively, at a comparable or greater degree than credible variants from existing methods while containing far fewer markers. Our results demonstrate how integrating AS activity can substantially improve the detection of causal variants from existing molecular data.

A predominant role of genotypic variation in both expression of sperm competition genes and paternity success in Drosophila melanogaster.

Sperm competition is a crucial aspect of male reproductive success in many species, including Drosophila melanogaster, and seminal fluid proteins (Sfps) can influence sperm competitiveness. However, the combined effect of environmental and genotypic variation on sperm competition gene expression remains poorly understood. Here, we used Drosophila Genetic Reference Panel (DGRP) inbred lines and manipulated developmental population density (i.e. larval density) to test the effects of genotype, environment and genotype-by-environment interactions (GEI) on the expression of the known sperm competition genes Sex Peptide, Acp36DE and CG9997. High larval density resulted in reduced adult body size, but expression of sperm competition genes remained unaffected. Furthermore, we found no significant GEI but genotypic effects in the expression of SP and Acp36DE. Our results also revealed GEI for relative competitive paternity success (second male paternity; P2), with genes' expression positively correlated with P2. Given the effect of genotype on the expression of genes, we conducted a genome-wide association study (GWAS) and identified polymorphisms in putative cis-regulatory elements as predominant factors regulating the expression of SP and Acp36DE. The association of genotypic variation with sperm competition outcomes, and the resilience of sperm competition genes' expression against environmental challenges, demonstrates the importance of genome variation background in reproductive fitness.