A new geminialphasatellite associated with wheat dwarf virus identified in winter barley in France.

Using a high-throughput sequencing (HTS) approach, we report the discovery of a new alphasatellite identified in a winter barley plant collected in France in 2022 that was also infected by wheat dwarf virus (WDV). The presence of the satellite and of WDV was confirmed by several independent PCR assays, and the complete genome sequence was determined. The circular satellite genome is 1424 nt long and shows typical hallmarks of members of the subfamily Geminialphasatellitinae, including a replication-associated hairpin with a CAGTATTAC sequence and a Rep-encoding open reading frame (ORF). It also possesses a second ORF, embedded in a different frame within the Rep ORF, which is also observed in clecrusatellites and a few other members of the family Alphasatellitidae. Pairwise sequence comparisons and phylogenetic analysis showed that this satellite represents a novel species. Its closest relatives are in the genus Colecusatellite, but it likely represents a new genus given its divergence from other genera of the subfamily Geminialphasatellitinae. Given that WDV was the only virus observed in coinfection with the satellite, the name "wheat dwarf virus-associated alphasatellite" is proposed for this novel agent.

Carrot populations in France and Spain host a complex virome rich in previously uncharacterized viruses.

High-throughput sequencing (HTS) has proven a powerful tool to uncover the virome of cultivated and wild plants and offers the opportunity to study virus movements across the agroecological interface. The carrot model consisting of cultivated (Daucus carota ssp. sativus) and wild carrot (Daucus carota ssp. carota) populations, is particularly interesting with respect to comparisons of virus communities due to the low genetic barrier to virus flow since both population types belong to the same plant species. Using a highly purified double-stranded RNA-based HTS approach, we analyzed on a large scale the virome of 45 carrot populations including cultivated, wild and off-type carrots (carrots growing within the field and likely representing hybrids between cultivated and wild carrots) in France and six additional carrot populations from central Spain. Globally, we identified a very rich virome comprising 45 viruses of which 25 are novel or tentatively novel. Most of the identified novel viruses showed preferential associations with wild carrots, either occurring exclusively in wild populations or infecting only a small proportion of cultivated populations, indicating the role of wild carrots as reservoir of viral diversity. The carrot virome proved particularly rich in viruses involved in complex mutual interdependencies for aphid transmission such as poleroviruses, umbraviruses and associated satellites, which can be the basis for further investigations of synergistic or antagonistic virus-vector-host relationships.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

First report of barley virus G infecting winter barley (Hordeum vulgare L.) in France.

As part of a cereals virome project high throughput sequencing (HTS)-based viral indexing was performed on plants with symptoms of barley yellow dwarf disease collected in June (2017-2020) in the main French cereals production areas. Total RNAs from 32 individual plants were purified (RNeasy Plant Mini Kit, Qiagen, Courtaboeuf, France) and Illumina sequenced (2x150 nt) following ribodepletion (Genewiz-Azenta, Leipzig, Germany). Following quality trimming, reads for each sample were de novo assembled (CLC Genomics Workbench 21, Qiagen) [1] and contigs annotated by BlastX analysis. In four winter barley samples collected in 2018 (18-58, 18-325 and 18-326) and 2019 (19-30A), besides contigs representing diverse viruses such as barley yellow dwarf viruses-PAV and PAS, Hordeum vulgare endornavirus, cereal yellow dwarf virus-RPV (18-326), wheat dwarf virus (18-325 and 18-326) and a novel Polerovirus (18-58 and 18-326), large contigs with high identity to barley virus G (BVG) were identified. BVG, a tentative Polerovirus, was initially reported in barley in South Korea in 2016 [2] and has so far been identified in a few other hosts including wheat, oat, maize, proso and foxtail millets as well as switchgrass. It has been reported from the USA and Australia [3] and, in Europe, from the Netherlands, Germany, Hungary and Greece [4]. Large BVG scaffolds representing near complete genomes could be reconstructed for each sample, integrating a total of 128.339, 7.188, 8.078 and 20.073 reads, for samples 19-30A, 18-58, 18325 and 18-326 respectively. Given that between 17.2 and 20.5 million reads had been obtained per sample, these values translate into between 0.04% (18-58 and 18-325) and 0.6% (19-30A) of total reads, and to average coverages of between 158x (18-58) and 2866x (19-30A) for the genomic scaffolds. The four assembled sequences (5584-5610 nt) have been deposited in GenBank (ON419453-ON419456). They are nearly identical (98.4 to 99.5% nt identity) and share between 97.7% and 98.5% nt identity with a barley reference isolate from the South Korea (NC_029906). To confirm the presence of BVG, a primer pair was designed based on available BVG sequences. Primers BVG-F(5'-CTAGCCCAACGAGTTGCGGG-3') and BVG-R(5'-GGTACAGAAGCTCTACGGTTC-3') amplifying a 394 nt were used in a two-step RT-PCR on new RNA extracts obtained from the 18-325 and 18-326 infected plants. The amplicons were directly sequenced and showed respectively 99.2% (ON419457, 18-325) and 100% (18-326) nt identity with the corresponding de novo scaffolds. The four analyzed samples have been collected respectively in 2018 (18-58, 18-325, 18-326) and 2019 (19-30A) in three different regions of France (Auvergne-Rhône-Alpes, Occitanie and Centre-Val de Loire), indicating a wide distribution and a persistence over time of BVG in France. To our knowledge, this represents the first report of a natural infection of BVG in cultivated winter barley in France. Presence of BVG may have been overlooked in a range of situation, as indicated by its retrospective discovery in a 34 years old Australian sample [3], possibly explaining its broad distribution in France. While the mixed infection status of the analyzed plants precludes any conclusion on its pathogenicity in French cereals, BVG has been reported to be associated with a range of symptoms in various hosts so that further studies to evaluate its prevalence and impact in France and to begin to understand its epidemiology are clearly warranted by the present results.

Host range and molecular variability of the sadwavirus dioscorea mosaic associated virus.

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

Identification of Seven Additional Genome Segments of Grapevine-Associated Jivivirus 1.

Jiviruses are a group of recently described viruses characterized with a tripartite genome and having affinities with Virgaviridae (RNA1 and 2) and Flaviviridae (RNA3). Using a combination of high-throughput sequencing, datamining and RT-PCR approaches, we demonstrate here that in grapevine samples infected by grapevine-associated jivivirus 1 (GaJV-1) up to 7 additional molecules can be consistently detected with conserved 5' and 3' non-coding regions in common with the three previously identified GaJV-1 genomic RNAs. RNA4, RNA5, RNA6, RNA7, RNA8 and RNA10, together with a recombinant RNArec7-8, are all members of a family sharing a previously non recognized conserved protein domain, while RNA9 is part of a distinct family characterized by another conserved motif. Datamining of pecan (Carya illinoinensis) public transcriptomic data allowed the identification of two further jiviviruses and the identification of supplementary genomic RNAs with homologies to those of GaJV-1. Taken together, these results reshape our vision of the divided genome of jiviviruses and raise novel questions about the function(s) of the proteins encoded by jiviviruses supplementary RNAs.

Genome characterization and diversity of trifolium virus 1: identification of a novel legume-infecting capulavirus.

A novel geminivirus was identified in France and Spain in asymptomatic plants of white clover (Trifolium repens) and shrub medick (Medicago arborea). Its genome has the hallmarks of a capulavirus, and its relationship to other capulaviruses was confirmed by phylogenetic analysis. White clover isolates formed a tight cluster in the phylogenetic tree, while shrub medick isolates formed two distinct, more divergent groups with sequence identity values close to the species cutoff. These three groups have likely participated in recombination events involving alfalfa leaf curl virus and French bean severe leaf curl virus. The name "trifolium virus 1" (TrV1) is proposed for this new Capulavirus. Three TrV1 genotypes (TrV1-A, TrV1-B, and TrV1-C) were clearly distinguished.

First report of lettuce necrotic leaf curl virus infecting cultivated lettuce in France.

Lettuce necrotic leaf curl virus (LNLCV, genus Torradovirus, family Secoviridae) has a bipartite single-stranded RNA genome and has so far only been reported in the Netherlands in open field lettuce (Verbeek et al. 2014). It was the first Torradovirus described from non-tomato host and, contrary to whitefly-transmitted tomato torradoviruses, aphids are its natural vectors (Verbeek et al. 2017). In October 2019, a symptomatic lettuce (JG3, cv. "Tregoney") was collected in an open field in southwestern France. Symptoms included stunted and deformed leaves with light necrosis and yellow spotting along minor veins of older leaves. Double-stranded RNAs were purified from JG3 leaves as described (Marais et al. 2018) and a cDNA library prepared and analyzed by Illumina NovaSeq sequencing. Analysis of sequence data identified two nearly fully assembled RNAs integrating respectively 28.9% and 60.9% of the sequencing reads and sharing respectively 85.5% and 83.3% nucleotide (nt) identity with the RNAs 1 and 2 of the LNLCV reference isolate, (NC_035214 and NC_035219, respectively). To confirm the presence of LNLCV in the original JG3 plant, it was used to mechanically inoculate indicator Nicotiana benthamiana, Chenopodium quinoa and C. amaranticolor plants. Only N. benthamiana developed symptoms, in the form of smaller and yellowed leaves. All inoculated plants were tested one month post-inoculation for the presence of LNLCV. Total RNAs were extracted according to Foissac et al. (2005) and used for RT-PCR tests with primers designed from the alignment between NC_035214 and our RNA1 sequence (LNLCV-S 5'-ATATTTTCCAAGTTGGAGGCTC-3' and LNLCV-R 5'-AGTRACAAAGGGACTAACTG-3'). LNLCV was detected in 3 out of 4 inoculated N. benthamiana plants. The full length RNA1 sequence (7577 nt) and the near complete RNA2 (5286 nt, lacking 3 nt at the 5' end as compared to NC_035219) could be assembled from the JG3 sequencing data and have been deposited in GenBank (MW172270 and MW172271, respectively). The lettuce JG3 isolate RNA1 shows 86.5% nt identity with the reference isolate while the taxonomically informative protease-polymerase regions share 96.8% aa identity. JG3 RNA2 shares 84.8% nt identity with NC_035219 while the movement protein and capsid subunits share respectively 92.5% and 98.3% aa identity. The smaller upstream ORF that slightly overlaps with the large MP-CP1/2/3 ORF is also conserved and shows 94.8% aa identity with the reference isolate. To our knowledge, this represents the first report of a natural infection of LNLCV in cultivated lettuce in France and anywhere outside the Netherlands. Since no other viruses were detected in the sequence dataset, LNLCV is most likely responsible for the mild necrosis and leaf deformation symptoms observed on the JG3 plant that appear to be similar to those initially described for LNLCV (Verbeek et al. 2014). While the pathogenicity of LNLCV in lettuce appears to be firmly established, further studies are needed to establish its distribution and prevalence, to understand why this pathogenic and aphid-transmitted virus is not more widely reported and whether it has the potential to increase in impact as a potential emerging agent on field lettuce crops.

Unravelling the virome in birch: RNA-Seq reveals a complex of known and novel viruses.

To unravel the virome in birch trees of German and Finnish origin exhibiting symptoms of birch leaf-roll disease (BRLD), high-throughput sequencing (HTS) was employed. In total five viruses, among which three were so far unknown, were detected by RNAseq. One to five virus variants were identified in the transcriptome of individual trees. The novel viruses were genetically-fully or partially-characterized, belonging to the genera Carlavirus, Idaeovirus and Capillovirus and are tentatively named birch carlavirus, birch idaeovirus, and birch capillovirus, respectively. The recently discovered birch leafroll-associated virus was systematically detected by HTS in symptomatic seedlings but not in symptomless ones. The new carlavirus was detected only in one of the three symptomatic seedlings. The novel putative Capillovirus was detected in all seedlings-irrespective of their BLRD status-while the Idaeovirus was identified in a plant without leaf symptoms at the time of sampling. Further efforts are needed to complete Koch's postulates and to clarify the possible association of the detected viruses with the BLR disease. Our study elucidates the viral population in single birch seedlings and provides a comprehensive overview for the diversities of the viral communities they harbor, to date.

Phytovirome Analysis of Wild Plant Populations: Comparison of Double-Stranded RNA and Virion-Associated Nucleic Acid Metagenomic Approaches.

Metagenomic studies have indicated that the diversity of plant viruses was until recently far underestimated. As important components of ecosystems, there is a need to explore the diversity and richness of the viruses associated with plant populations and to understand the drivers shaping their diversity in space and time. Two viral sequence enrichment approaches, double-stranded RNA (dsRNA) and virion-associated nucleic acids (VANA), have been used and compared here for the description of the virome of complex plant pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. A novel bioinformatics strategy was used to assess viral richness not only at the family level but also by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. A large viral diversity dominated by novel dsRNA viruses was detected in all sites, while a large between-site variability limited the ability to draw a clear conclusion on the impact of cultivation. A trend for a higher diversity of dsRNA viruses was nevertheless detected in unmanaged sites (118 versus 77 unique OTUs). The dsRNA-based approach consistently revealed a broader and more comprehensive diversity for RNA viruses than the VANA approach, whatever the assessment criterion. In addition, dissimilarity analyses indicated both approaches to be largely reproducible but not necessarily convergent. These findings illustrate features of phytoviromes in various ecosystems and a novel strategy for precise virus richness estimation. These results allow us to reason methodological choices in phytovirome studies and likely in other virome studies where RNA viruses are the focal taxa.IMPORTANCE There are today significant knowledge gaps on phytovirus populations and on the drivers impacting them but also on the comparative performance-methodological approaches for their study. We used and compared two viral sequence enrichment approaches, double-stranded RNAs (dsRNA) and virion-associated nucleic acids (VANA), for phytovirome description in complex pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. Viral richness was assessed by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. There is some limited evidence of an impact of cultivation on viral populations. These results provide data allowing us to reason the methodological choices in virome studies. For researchers primarily interested in RNA viruses, the dsRNA approach is recommended because it consistently provided a more comprehensive description of the analyzed phytoviromes, but it understandably underrepresented DNA viruses and bacteriophages.

Genome characterization of a divergent isolate of the mycovirus Botrytis virus F from a grapevine metagenome.

As part of a grapevine metagenome study, total RNA extracted from grapevine phloem scrapings was analyzed by Illumina sequencing. For one 420A rootstock sample, reads mapping against a reference database and BLAST annotation of contigs identified the presence of a divergent isolate of Botrytis virus F (BVF). The full genome sequence of this isolate (IVC-5-77) was determined (6,828 nucleotides [nt], excluding the poly(A) tail) and shown to be collinear with that of the BVF reference isolate, with the two open reading frames encoding a replication-associated protein (REP) and a coat protein (CP). The IVC-5-77 isolate, however, is very divergent, showing only 81.3-81.6% nucleotide sequence identity to the two other sequenced BVF isolates. The internal non-coding region was also found to be highly variable between BVF isolates. Analysis of the RNASeq reads demonstrated that close to 20% of them belong to Botrytis cinerea, the putative host of the IVC-5-77 isolate. These results extend our knowledge of the diversity and variability of BVF and demonstrate its detectability, together with that of its B. cinerea host, in total RNA RNASeq data from grapevine phloem scrapings.

High-Throughput Sequencing Reveals Further Diversity of Little Cherry Virus 1 with Implications for Diagnostics.

Little cherry virus 1 (LChV1, Velarivirus, Closteroviridae) is a widespread pathogen of sweet or sour cherry and other Prunus species, which exhibits high genetic diversity and lacks a putative efficient transmission vector. Thus far, four distinct phylogenetic clusters of LChV1 have been described, including isolates from different Prunus species. The recent application of high throughput sequencing (HTS) technologies in fruit tree virology has facilitated the acquisition of new viral genomes and the study of virus diversity. In the present work, several new LChV1 isolates from different countries were fully sequenced using different HTS approaches. Our results reveal the presence of further genetic diversity within the LChV1 species. Interestingly, mixed infections of the same sweet cherry tree with different LChV1 variants were identified for the first time. Taken together, the high intra-host and intra-species diversities of LChV1 might affect its pathogenicity and have clear implications for its accurate diagnostics.

Complete genome sequence of lettuce chordovirus 1 isolated from cultivated lettuce in France.

Double-stranded RNAs purified from cultivated (Lactuca sativa) or wild (L. serriola) lettuce from southwest France were analyzed by high-throughput sequencing. For both samples, BLAST annotation revealed contigs with homology to Betaflexiviridae family members. The full genome sequence of the isolate from cultivated lettuce (JG1) was completed (8,536 nucleotides [nt], excluding the poly(A) tail). The sequence of the 3' half of the genome (4,800 nt) of a wild lettuce isolate (P22) was determined and found to share 95.1% nt sequence identity with the JG1 isolate. The JG1 genome contains four open reading frames, encoding a replicase, a movement protein, a capsid protein, and a protein of unknown function, respectively. Based on genome organization and phylogenetic relationships, the lettuce virus is most closely related to the recently described carrot chordoviruses 1 and 2 in the family Betaflexiviridae. Considering the species demarcation criteria in this family, the two lettuce viruses represent isolates of a new chordovirus species for which the name "lettuce chordovirus 1" (LeCV1) is proposed.

Complete genomic sequence of Raphanus sativus cryptic virus 4 (RsCV4), a novel alphapartitivirus from radish.

The present work reports the discovery and complete genome sequencing of a virus from symptomless radish seedlings, classifiable as a novel member of the genus Alphapartitivirus, family Partitiviridae. Total RNA extracted from germinating seedlings was sequenced using Illumina technology. Bioinformatic analysis of the RNA-seq data revealed two contigs representing the near full-length genomic sequences of two genomic RNAs representing a new virus. Analysis of the genome sequence (excluding the polyA tail, RNA1: 1976 nt and RNA2: 1751 nt, respectively) showed a genomic organization typical of viruses classed within the Partitiviridae, with each genomic RNA encoding a single open reading frame (ORF). Phylogenetic analysis of the RNA dependent RNA polymerase (RNA1 ORF) and of the capsid protein (RNA2 ORF) clearly showed the new virus can be classified within the genus Alphapartitivirus, but sequence divergence establishes it as a new species, for which the name "Raphanus sativus cryptic virus 4" is proposed.

Adaptation of lettuce mosaic virus to Catharanthus roseus involves mutations in the central domain of the VPg.

An isolate of Lettuce mosaic virus (LMV, a Potyvirus) infecting Madagascar periwinckle (Catharanthus roseus) was identified and characterized by Illumina deep sequencing. LMV-Cr has no close affinities to previously sequenced LMV isolates and represents a novel, divergent LMV clade. Inoculation experiments with other representative LMV isolates showed that they are unable to infect C. roseus, which was not known to be a host for LMV. However, three C. roseus variants of one of these isolates, LMV-AF199, could be selected and partially or completely sequenced. These variants are characterized by the accumulation of mutations affecting the C-terminal part of the cylindrical inclusion (CI) helicase and the central part of the VPg. In particular, a serine to proline mutation at amino acid 143 of the VPg was observed in all three independently selected variants and is also present in the LMV-Cr isolate, making it a prime candidate as a host-range determinant. Other mutations at VPg positions 65 and 144 could also contribute to the ability to infect C. roseus. Inoculation experiments involving a recombinant LMV expressing a permissive lettuce eukaryotic translation initiation factor 4E (eIF4E) suggest that eIF4E does not contribute to the interaction of most LMV isolates with C. roseus.

Distribution of Barley yellow dwarf virus-PAV in the Sub-Antarctic Kerguelen Islands and Characterization of Two New Luteovirus Species.

A systematic search for viral infection was performed in the isolated Kerguelen Islands, using a range of polyvalent genus-specific PCR assays. Barley yellow dwarf virus (BYDV) was detected in both introduced and native grasses such as Poa cookii. The geographical distribution of BYDV and its prevalence in P. cookii were analyzed using samples collected from various sites of the archipelago. We estimate the average prevalence of BYDV to be 24.9% in P. cookii, with significant variability between sites. BYDV genetic diversity was assessed using sequence information from two genomic regions: the P3 open reading frame (ORF) (encoding the coat protein) and the hypervariable P6 ORF region. The phylogenetic analysis in the P3 region showed that BYDV sequences segregate into three major lineages, the most frequent of which (Ker-I cluster) showed close homology with BYDV-PAV-I isolates and had very low intra-lineage diversity (0.6%). A similarly low diversity was also recorded in the hypervariable P6 region, suggesting that Ker-I isolates derive from the recent introduction of BYDV-PAV-I. Divergence time estimation suggests that BYDV-PAV-I was likely introduced in the Kerguelen environment at the same time frame as its aphid vector, Rhopalosiphum padi, whose distribution shows good overlap with that of BYDV-Ker-I. The two other lineages show more than 22% amino acid divergence in the P3 region with other known species in the BYDV species complex, indicating that they represent distinct BYDV species. Using species-specific amplification primers, the distribution of these novel species was analyzed. The high prevalence of BYDV on native Poaceae and the presence of the vector R. padi, raises the question of its impact on the vulnerable plant communities of this remote ecosystem.

Further characterization of a new recombinant group of Plum pox virus isolates, PPV-T, found in orchards in the Ankara province of Turkey.

Sixteen Plum pox virus (PPV) isolates collected in the Ankara region of Turkey were analyzed using available serological and molecular typing assays. Surprisingly, despite the fact that all isolates except one, which was a mix infection, were typed as belonging to the PPV-M strain in four independent molecular assays, nine of them (60%) reacted with both PPV-M specific and PPV-D specific monoclonal antibodies. Partial 5' and 3' genomic sequence analysis on four isolates demonstrated that irrespective of their reactivity towards the PPV-D specific monoclonal antibody, they were all closely related to a recombinant PPV isolate from Turkey, Ab-Tk. All three isolates for which the relevant genomic sequence was obtained showed the same recombination event as Ab-Tk in the HC-Pro gene, around position 1566 of the genome. Complete genomic sequencing of Ab-Tk did not provide evidence for additional recombination events in its evolutionary history. Taken together, these results indicate that a group of closely related PPV isolates characterized by a unique recombination in the HC-Pro gene is prevalent under field conditions in the Ankara region of Turkey. Similar to the situation with the PPV-Rec strain, we propose that these isolates represent a novel strain of PPV, for which the name PPV-T (Turkey) is proposed. Given that PPV-T isolates cannot be identified by currently available typing techniques, it is possible that their presence has been overlooked in other situations. Further efforts should allow a precise description of their prevalence and of their geographical distribution in Turkey and, possibly, in other countries.