The biological functions and signaling mechanisms of the p75 neurotrophin receptor.

The p75 neurotrophin receptor (p75(NTR)) regulates a wide range of cellular functions, including programmed cell death, axonal growth and degeneration, cell proliferation, myelination, and synaptic plasticity. The multiplicity of cellular functions governed by the receptor arises from the variety of ligands and co-receptors which associate with p75(NTR) and regulate its signaling. P75(NTR) promotes survival through interactions with Trk receptors, inhibits axonal regeneration via partnerships with Nogo receptor (Nogo-R) and Lingo-1, and promotes apoptosis through association with Sortilin. Signals downstream of these interactions are further modulated through regulated intramembrane proteolysis (RIP) of p75(NTR) and by interactions with numerous cytosolic partners. In this chapter, we discuss the intricate signaling mechanisms of p75(NTR), emphasizing how these signals are differentially regulated to mediate these diverse cellular functions.

Prognostic significance of lymphovascular invasion in patients with salivary duct cell carcinoma of the head and neck.

The purpose of this study was to evaluate the treatment outcomes of patients who underwent surgery with curative intention after the diagnosis of salivary duct cell carcinoma (SDC) in the head and neck area and to analyse the prognostic factors and treatment failure pattern. Fifty-nine patients treated between March 2003 and December 2018 were enrolled in the study. The mean follow-up period was 45.5 months (range 12-189 months). The 5-year overall survival rate was 54.7% and the 5-year disease-free survival rate was 56.8%. Nineteen recurrences occurred during the study period: four loco-regional recurrences and 15 distant metastases. During the study period, 10 patients died of disease relapse and 5 patients died of other medical caused. On univariate analysis, lymphovascular invasion (LVI) (P=0.031) showed the most significant correlation with mortality. On multivariate Cox regression analysis, LVI showed the most significant correlation with patient survival (P = 0.027). LVI was the most significant prognostic factor related to the 5-year overall survival rate of SDC patients. The development of novel therapeutic agents is necessary to improve the survival rate of these patients with LVI.

Consequences of Metabolic Disruption in Alzheimer's Disease Pathology.

Alzheimer's disease (AD) is an irreversible, progressive disease that slowly destroys cognitive function, such as thinking, remembering, and reasoning, to a level that one cannot carry out a daily living. As people live longer, the risk of developing AD has increased to 1 in 10 among people who are older than 65 and to almost 1 in 2 among those who are older than 85 according to a 2019 Alzheimer's Association report. As a most common cause of dementia, AD accounts for 60-80% of all dementia cases. AD is characterized by amyloid plaques and neurofibrillary tangles, composed of extracellular aggregates of amyloid-ß peptides and intracellular aggregates of hyperphosphorylated tau, respectively. Besides plaques and tangles, AD pathology includes synaptic dysfunction including loss of synapses, inflammation, brain atrophy, and brain hypometabolism, all of which contribute to progressive cognitive decline. Recent genetic studies of sporadic cases of AD have identified a score of risk factors, as reported by Hollingworth et al. (Nat Genet 43:429-435, 2001) and Lambert et al. (Nat Genet 45:1452-1458, 2013). Of all these genes, apolipoprotein E4 (APOE4) still presents the biggest risk factor for sporadic cases of AD, as stated in Saunders et al. (Neurology 43:1467-1472, 1993): depending on whether you have 1 or 2 copies of APOE4 allele, the risk increases from 3- to 12-fold, respectively, in line with Genin et al. (Mol Psychiatry 16:903-907, 2011). Besides these genetic risk factors, having type 2 diabetes (T2D), a chronic metabolic disease, is known to increase the AD risk by at least 2-fold when these individuals age, conforming to Sims-Robinson et al. (Nat Rev Neurol 6:551-559, 2010). Diabetes is reaching a pandemic scale with over 422 million people diagnosed worldwide in 2014 according to World Health Organization. Although what proportion of these diabetic patients develop AD is not known, even if 10% of diabetic patients develop AD later in their life, it would double the number of AD patients in the world. Better understanding between T2D and AD is of paramount of importance for the future. The goal of this review is to examine our current understanding on metabolic dysfunction in AD, so that a potential target can be identified in the near future.

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.

MYC translocation and an increased copy number predict poor prognosis in adult diffuse large B-cell lymphoma (DLBCL), especially in germinal centre-like B cell (GCB) type.

AIMS: Diffuse large B-cell lymphoma (DLBCL) is a heterogeneous disease with various genetic alterations. The aim was to investigate MYC, Bcl-2 and Bcl-6 translocations and copy number changes in adult DLBCLs to evaluate their clinicopathological features and prognostic implications. METHODS AND RESULTS: Gene status was examined using fluorescence in situ hybridization (FISH), and the results were analysed in the context of germinal centre B-cell (GCB) and non-GCB type of DLBCL based on immunohistochemistry. MYC translocation was observed in 9% (14 of 156), and an increased copy number (ICN) in 7.1% (11 of 156). MYC translocation was more common in GCB type (22%) than in non-GCB type (4.9%), and associated with advanced International Prognostic Index (IPI). MYC aberration, i.e. translocation or increased copy number (ICN), was significantly associated with shorter overall survival, especially for the GCB type. Bcl-2 translocation was rare (3.4%, five of 145), and ICN was observed in 11.7% (17 of 145), more frequently in non-GCB type (16%) than in GCB type (2.5%). Bcl-2 aberration tended to have an adverse effect on survival. In multivariate analysis, MYC ICN was an independent poor prognostic factor. CONCLUSIONS: Analyses of MYC and Bcl-2 status, i.e. translocation and ICN, in the context of DLBCL phenotype might help predict prognosis and determine therapeutic strategies.

ERK-dependent IL-6 autocrine signaling mediates adaptive resistance to pan-PI3K inhibitor BKM120 in head and neck squamous cell carcinoma.

Hyperactivation of phosphatidylinositol 3-kinase (PI3K) pathway occurs frequently in head and neck squamous cell carcinoma (HNSCC). However, clinical outcomes of targeting the PI3K pathway have been underwhelming. In present study, we investigated the resistant mechanisms and potential combination therapeutic strategy to overcome adaptive resistance to PI3K inhibitor in HNSCC. Treatment of NVP-BKM120, a pan-PI3K inhibitor, led to upregulation of interleukin-6 (IL-6) and subsequent activation of either extracellular signal-regulated kinase (ERK) or signal transducers and activators of transcription 3 (STAT3), causing modest antitumor effects on the growth of HNSCC cells. Blockade of autocrine IL-6 signaling with siRNA or neutralizing antibody for IL-6 receptor (IL-6R) completely abolished NVP-BKM120-induced activation of ERK and STAT3 as well as expression of c-Myc oncogene, which resulted in enhanced sensitivity to NVP-BKM120. Moreover, when compared with a pharmacologic inhibitor or silencing of STAT3, trametinib, a MEK inhibitor, in combination with NVP-BKM120 yielded more potent anti-proliferative effects by inhibiting S phase transition, arresting cells at G0/G1 phase, and downregulating IL-6 and c-Myc expression. Furthermore, as compared with either agent alone, combination of NVP-BKM120 with trametinib or tocilizumab, a humanized anti-IL-6R antibody, significantly suppressed tumor growth in NVP-BKM120-resistant patient-derived tumor xenograft (PDTX) models, which was also confirmed in PDTX-derived cell lines. Collectively, these results suggested that IL-6/ERK signaling is closely involved in adaptive resistance of NVP-BKM120 in HNSCC cells, providing a rationale for a novel combination therapy to overcome resistance to PI3K inhibitors.

Polyamine synthesis in plants: isolation and characterization of spermidine synthase from soybean (Glycine max) axes.

Spermidine synthase (EC 2.5.1.16) was purified to homogeneity for the cytosol of soybean (Glycine max) axes using ammonium sulfate fractionation and chromatography on DEAE-Sephacel, Sephacryl S-300, omega-aminooctyl-Sepharose and ATPA-Sepharose. The molecular mass of the enzyme estimated by gel filtration and SDS-PAGE is 74 kDa. Cadaverin and 1,6-diaminohexane could not replace putrescine as the aminopropyl acceptor. Kinetic behaviors of the substrate are consistent with a ping pong mechanism. The kinetic mechanism is further supported by direct evidence confirming the presence of an aminopropylated enzyme and identification of product, 5'-deoxy-5'-methylthioadenosine, prior to adding putrescine. The Km values for decarboxylated S-adenosylmethionine and putrescine are 0.43 microM and 32.45 microM, respectively. Optimum pH and temperature for the enzyme reaction are 8.5 and 37 degrees C, respectively. The enzyme activity is inhibited by N-ethylmaleimide and DTNB, but stimulated by Co2+, Cu2+ and Ca2+ significantly, suggesting that these metal ions could be the cellular regulators in polyamine biosynthesis.

ZBP-89-induced apoptosis is p53-independent and requires JNK.

ZBP-89 induces apoptosis in human gastrointestinal cancer cells through a p53-independent mechanism. To understand the apoptotic pathway regulated by ZBP-89, we identified downstream signal transduction targets. Ectopic expression of ZBP-89 induced apoptosis through the mitochondrial pathway and was accompanied by activation of all three MAP kinase subfamilies: JNK1/2, ERK1/2 and p38 MAP kinase. ZBP-89-induced apoptosis was markedly enhanced by ERK inhibition with U0126. In contrast, inhibiting JNK with a JNK1-specific peptide inhibitor or dominant-negative JNK2 expression abrogated ZBP-89-mediated apoptosis. The p38 inhibitor SB202190 had no effect on ZBP-89-induced cell death. Protein dephosphorylation assays revealed that ZBP-89 activates JNK via repression of JNK dephosphorylation. Oligonucleotide microarray analyses revealed that ectopic expression of ZBP-89 downregulated expression of the dual-specificity phosphatase MKP6. Overexpression of MKP6 blocked ZBP-89-induced JNK phosphorylation and PARP cleavage. In addition, ectopic expression of ZBP-89 repressed Bcl-xL and Mcl-1 expression, but had no effect on Bcl-2. Silencing ZBP-89 with small interfering RNA enhanced both Bcl-xL and Mcl-1 expression. Taken together, ZBP-89-mediated apoptosis occurs via a p53-independent mechanism that requires JNK activation.

Se-methylselenocysteine induces apoptosis mediated by reactive oxygen species in HL-60 cells.

Recent studies have implicated apoptosis as one of the most plausible mechanisms of the chemopreventive effects of selenium compounds, and reactive oxygen species (ROS) as important mediators in apoptosis induced by various stimuli. In the present study, we demonstrate that Se-methylselenocysteine (MSC), one of the most effective selenium compounds at chemoprevention, induced apoptosis in HL-60 cells and that ROS plays a crucial role in MSC-induced apoptosis. The uptake of MSC by HL-60 cells occurred quite early, reaching the maximum within 1 h. The dose-dependent decrease in cell viability was observed by MSC treatment and was coincident with increased DNA fragmentation and sub-G(1) population. 50 microM of MSC was able to induce apoptosis in 48% of cell population at a 24 h time point. Moreover, the release of cytochrome c from mitochondria and the activation of caspase-3 and caspase-9 were also observed. The measurement of ROS by dichlorofluorescein fluorescence revealed that dose- and time-dependent increase in ROS was induced by MSC. N-acetylcysteine, glutathione, and deferoxamine blocked cell death, DNA fragmentation, and ROS generation induced by MSC. Moreover, N-acetylcysteine effectively blocked caspase-3 activation and the increase of the sub-G(1) population induced by MSC. These results imply that ROS is a critical mediator of the MSC-induced apoptosis in HL-60 cells.

Effects of priming a bipolar attribute concept on dimension versus concept-specific accessibility of semantic memory.

In Experiment 1, participants received behavioral information about a person that could be interpreted as either honest or unkind. Priming a concept along 1 dimension (e.g., honesty) increased the likelihood of spontaneously describing the target along this dimension (i.e., as honest), regardless of whether the primed concept was directly applicable for interpreting the target's behavior ("honest") or was its bipolar opposite ("dishonest"). Experiment 2 replicated this finding in a different, product domain. It further demonstrated that when information is ambiguous, primed concepts can influence not only the dimension along which the target is described but also the value it is assigned along this dimension. The effect of priming in both experiments was reflected in participants' overall evaluations of the targets as well as in their spontaneous descriptions of it. Results were consistent with the assumption that bipolar attributes are associatively linked in memory but are stored as separate concepts rather than as values along a bipolar continuum.

Glycogen synthase kinase-3ß positively regulates protein synthesis and cell proliferation through the regulation of translation initiation factor 4E-binding protein 1.

Protein synthesis has a key role in the control of cell proliferation, and its deregulation is associated with pathological conditions, notably cancer. Rapamycin, an inhibitor of mammalian target of rapamycin complex 1 (mTORC1), was known to inhibit protein synthesis. However, it does not substantially inhibit protein synthesis and cell proliferation in many cancer types. We were interested in finding a novel target in rapamycin-resistant cancer. The rate-limiting factor for translation is eukaryotic translation initiation factor 4E (eIF4E), which is negatively regulated by eIF4E-binding protein 1 (4E-BP1). Here, we provide evidence that glycogen synthase kinase (GSK)-3ß promotes cell proliferation through positive regulation of protein synthesis. We found that GSK-3ß phosphorylates and inactivates 4E-BP1, thereby increasing eIF4E-dependent protein synthesis. Considering the clinical relevance of pathways regulating protein synthesis, our study provides a promising new strategy and target for cancer therapy.

Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.

Sequences that direct rat tyrosine hydroxylase gene expression.

Investigation of neuroendocrine genes has revealed that transcription is regulated via multiple DNA binding sites, including the cyclic AMP response element (CRE). We show here that for the neuronal and chromaffin-specific gene tyrosine hydroxylase (TH), a 70-bp region (-229 to -160) lacking the CRE is sufficient, in either orientation, to confer levels of chloramphenicol acetyltransferase reporter expression equivalent to or greater than that conferred by 4.8 kb of the rat TH enhancer/promoter region. The 70-bp region contains potential binding sites for AP2, AP1, E2A/MyoD, and POU transcription factors, and functions when linked to the TH promoter, but not when joined to a heterologous RSV promoter. This demonstrates that promoter as well as enhancer elements are important for TH expression. In gel-shift assays, the 70-bp fragment forms a cell type-specific complex with nuclear extracts from TH-expressing cells. which is effectively competed by an oligonucleotide containing AP2, AP1, and E2A/MyoD (E box) sites, but not by one containing the POU site. These data suggest that the AP2, AP1, and/or E box sites may be involved in forming the cell-specific complex. Although it lacks an authentic CRE, the 70-bp region also mediated a twofold transcriptional response to forskolin, equivalent to that found with the endogenous gene. A different region (-60 to -29) bearing a consensus CRE mediated a sixfold increase in transcription in response to forskolin, but only minimally activated basal transcription from the TH promoter in the absence of forskolin.

A dominant role of the juxtamembrane region of the TrkA nerve growth factor receptor during neuronal cell differentiation.

All receptor tyrosine kinases share a common intracellular signaling machinery, including ras activation, whereas cellular responses vary from mitogenesis to cell differentiation. To investigate the structural basis for receptor tyrosine kinase action for nerve growth factor, the juxtamembrane region of TrkA was transferred to a corresponding region of the epidermal growth factor (EGF) receptor. The resulting chimeric receptor contains an additional Shc site, Tyr490, in the juxtamembrane region. In transfected PC12 cell lines, neuronal differentiation was observed with EGF treatment, as evidenced by increased neurite extension. The action of the chimeric receptor was correlated with prolonged activation of MAP kinases and a 3-4-fold increase in phosphatidylinositol 3-kinase activity. The effect of the juxtamembrane chimera was dependent upon the Shc site at Tyr490, because expression of a chimeric receptor containing a Y490F mutation resulted in a complete loss of neuritogenesis by EGF treatment. These findings indicate that the juxtamembrane region of the TrkA receptor serves as a key functional domain that can confer a dominant effect upon neuronal differentiation.

Inhibitory effect of selenite on invasion of HT1080 tumor cells.

Selenium, an essential biological trace element, has been shown to reduce and prevent the incidence of cancer. Our previous studies have shown that selenite is involved in the chemoprevention of cancer and induction of apoptosis of cancer cells. In this study, we demonstrate that selenite also inhibits the invasion of tumor cells. Cancer cell invasion requires coordinated processes, such as changes in cell-cell and cell-matrix adhesion, degradation of the extracellular matrix, and cell migration. We found that selenite inhibited invasion of HT1080 human fibrosarcoma cells. Adhesion of HT1080 cells to the collagen matrix was also inhibited by treatment with selenite, but cell-cell interaction and cell motility were not affected by selenite. Moreover, selenite reduced expression of matrix metalloproteinase-2 and -9 and urokinase-type plasminogen activator, which are involved in matrix degradation, but increased a tissue inhibitor of metalloproteinase-1. This inhibitory effect of selenite on the protease expressions was mediated by the suppression of transcription factors, NF-kappaB and AP-1. However, selenate showed no remarkable effect on all the steps of cancer cell invasion.

The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice.

Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at -45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the AP1/dyad (AD) element at -205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at -91 or -95. However, in its native context at -205, the AD could not support expression. In contrast, a CRE, moved from its normal position at -45 to -206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context-and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines.

Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival.

In addition to its role as a survival factor, nerve growth factor (NGF) has been implicated in initiating apoptosis in restricted cell types both during development and after terminal cell differentiation. NGF binds to the TrkA tyrosine kinase and the p75 neurotrophin receptor, a member of the tumor necrosis factor cytokine family. To understand the mechanisms underlying survival versus death decisions, the TrkA receptor was introduced into oligodendrocyte cell cultures that undergo apoptosis in a p75-dependent manner. Here we report that activation of the TrkA NGF receptor in oligodendrocytes negates cell death by the p75 receptor. TrkA-mediated rescue from apoptosis correlated with mitogen-activated protein kinase activation. Concurrently, activation of TrkA in oligodendrocytes resulted in suppression of c-jun kinase activity initiated by p75, whereas induction of NFkappaB activity by p75 was unaffected. These results indicate that TrkA-mediated rescue involves not only activation of survival signals but also simultaneous suppression of a death signal by p75. The selective interplay between tyrosine kinase and cytokine receptors provides a novel mechanism that achieves alternative cellular responses by merging signals from different ligand-receptor systems.

Neurotrophin receptors: mediators of life and death.

The mechanism of action of NGF has continued to provide a challenging and formidable problem in signal transduction. NGF can bind independently to two different receptors, the trkA tyrosine kinase receptor and the p75 neurotrophin receptor, which are involved in many different signaling events. In addition to promoting cell differentiation survival, NGF can paradoxically be an inducer of cell death. Several receptor mediated mechanisms are proposed to explain how NGF might act as a trophic factor and as a cell killer. The survival and cell death properties of the receptors are dependent upon the relative ratio of receptors and the persistent nature of the signaling events.

A novel basal promoter element is required for expression of the rat tyrosine hydroxylase gene.

Transcription of the rat tyrosine hydroxylase (TH) gene is controlled by enhancer sequences in its 5' flanking region; these enhancers include the AP1, dyad, and cAMP response element (CRE) motifs. We show that a novel basal promoter element (-17 GCCTGCCTGGCGA -5) positioned between the TATA box and +1 works in conjunction with the upstream AP1-dyad and CRE enhancers but cannot support transcription by itself. A mutation of this element, termed partial dyad, reduces basal expression of a reporter gene in TH-positive cell lines and TH-negative lines but has no effect on cAMP- or KCl-induced expression. A double mutant at positions -17 and -11 of the partial dyad reduces transcriptional activation by 80%. Conversely, insertion of this element into a heterologous promoter restores basal expression to levels mediated by the native TH promoter. The partial dyad is a novel activational element that is required for full expression of the TH gene and may assist in the function of the AP1, dyad, and CRE motifs and also other enhancers further upstream. Hence, the rat TH gene is unusual in that its enhancers will not function with a heterologous promoter but require a specific TH promoter sequence for full activation.