Transcriptional regulation of NDUFA4L2 by NFIB induces sorafenib resistance by decreasing reactive oxygen species in hepatocellular carcinoma.

Sorafenib is one a first-line therapeutic drugs for advanced hepatocellular carcinoma (HCC). However, only 30% of patients benefit from sorafenib due to drug resistance. We and other groups have revealed that nuclear factor I B (NFIB) regulates liver regeneration and carcinogenesis, but its role in drug resistance is poorly known. We found that NFIB was more upregulated in sorafenib-resistant SMMC-7721 cells compared to parental cells. NFIB knockdown not only sensitized drug-resistant cells to sorafenib but also inhibited the proliferation and invasion of these cells. Meanwhile, NFIB promoted the proliferation and invasion of HCC cells in vitro and facilitated tumor growth and metastasis in vivo. Knocking down NFIB synergetically inhibited tumor growth with sorafenib. Mechanically, gene expression profiling and subsequent verification experiments proved that NFIB could bind with the promoter region of a complex I inhibitor NDUFA4L2 and promote its transcription. Transcriptional upregulation of NDUFA4L2 by NFIB could thus inhibit the sorafenib-induced reactive oxygen species accumulation. Finally, we found that NFIB was highly expressed in HCC tissues, and high NFIB expression level was associated with macrovascular invasion, advanced tumor stage, and poor prognosis of HCC patients (n = 156). In summary, we demonstrated that NFIB could transcriptionally upregulate NDUFA4L2 to enhance both intrinsic and acquired sorafenib resistance of HCC cells by reducing reactive oxygen species induction.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Response of occurrence in microplastics and its adsorped cadmium capacity to simulated agricultural environmental scenarios in sludge-amended soil.

Large amounts of microplastics (MPs) enter the soil along with the amendment of sludge to soil. However, it is still unclear about the response of MPs occurrence and the adsorption behaviors of cadmium (Cd)on MPs to typical agricultural environmental scenarios. In present work, three kinds of MPs (polyethylene, polypropylene, and polystyrene) were chosen to investigate that response in three agricultural environmental scenarios with sludge-amended soil, including dry-wet alteration (7 d, five cycles), microbial addition (Bacillus subtilis, 0.05 g/g soil), and Ultraviolet (UV) irradiation (340 nm, 4 × 15 W, 4 d). The results showed that there was the highest adsorption capacity of Cd on MPs (36.21, 45.15, 12.43 µg/g for PE, PP, PS, respectively) after UV irradiation exceeding those from MPs triggered by other two scenarios). UV irradiation caused an increase in the abundance of Streptomyces, an expansion in specific surface area, a significant change in surface morphologies, an improvement in crystallinity or the formation of new crystals, and an enhancement in C-O and CO content, and then resulted in the incremental adsorption capacity of Cd on MPs. The findings are important of significance for controlling the environmental risks from sludge MPs via carrying heavy metals in the soil-plant systems.

The prevalence of chronic medication therapy problems and pharmacists' interventions among hospitalized perioperative patients: a retrospective observational study.

BACKGROUND: Inadequate preoperative management of chronic medications can place perioperative patients at risk and cause unnecessary delays in surgical procedures. This study aims to investigate the prevalence of chronic medication therapy problems (CMTPs) in hospitalized perioperative patients and assess the relevance of pharmacists' interventions. METHODS: We conducted a retrospective study of pharmacist-led preoperative management of chronic medications in hospitalized adult patients from November 2018 to April 2019. The recorded drug-related problems (DRPs) were retrospectively reviewed and categorized according to the Pharmaceutical Care Network Europe classification V9.1 and were analyzed with a multinomial regression model to identify risk factors. RESULTS: A total of 254 DRPs were recorded, with an average of 0.52 DRPs per patient. Treatment safety (66.9%) was the most common DRP. The most frequent causes of perioperative DRPs and nonperioperative DRPs were drug selection (72.9%) and patient related (50.8%), respectively. Of the 292 documented interventions, 71.6% were fully accepted by the clinicians and patients. The majority (68.9%) of the recorded problems were completely resolved. The number of comorbidities (OR = 3.815) and the number of chronic medications taken (OR = 1.539) were risk factors for the occurrence of DRPs. CONCLUSION: The findings of this study suggest that pharmacist-led chronic medication therapy management in surgical wards may be an effective method to help reduce medication-related surgical risks and optimize the medication therapies used for the long-term treatment of chronic diseases.

Simulation, prediction and optimization of typical heavy metals immobilization in swine manure composting by using machine learning models and genetic algorithm.

Machine learning (ML) is a novel method of data analysis with potential to overcome limitations of traditional composting experiments. In this study, four ML models (multi-layer perceptron regression, support vector regression, decision tree regression, and gradient boosting regression) were integrated with genetic algorithm to predict and optimize heavy metal immobilization during composting. Gradient boosting regression performed best among the four models for predicting both heavy metal bioavailability variations and immobilization. Gradient boosting regression-based feature importance analysis revealed that the heavy metal initial bioavailability factor, total phosphorus, and composting duration were the determinant factors for heavy metal bioavailability variations (together contributing >75%). After genetic algorithm optimization, the maximum immobilization rates of Cu, Zn, Cd, As, and Cr were 79.53, 31.30, 14.91, 46.25, and 66.27%, respectively, superior to over 90% of the measured data. These findings demonstrate the potential application of ML to risk-control for heavy metals in livestock manure composting.

Influence of sludge treatment methods on behaviors of microplastics adsorbed cadmium and its driving factors.

The complicated contamination of microplastics (MPs) and heavy metals in sludge has garnered substantial attention in recent years; however, research on the behavior of MPs loading of heavy metals in sludge after sludge treatment methods is limited. Four representative sludge treatment methods were selected herein: anaerobic digestion, thermal drying, thermal hydrolysis (TH), and aerobic composting. Before and after sludge treatment, the chemical bonding of MPs, cadmium (Cd) adsorption properties, and metabolic changes in the microbial community succession was analyzed, and the factors influencing differences in Cd sorption by sludge MPs were explored. The results revealed that Cd adsorption by MPs occurs as multilayer physical adsorption that can be well fitted by Freundlich isotherms. Compared with the other three treatments, TH led to the most significant effect on the chemical bonding properties of the MPs, with a more than two-fold increase in C-O single bonds and CO double bonds, as well as adsorption of the highest amount of Cd at 767 µg/g. In addition, sludge conductivity and water content also affected Cd sorption capacity, with correlation coefficients of 0.405 and -0.384. Pedobacter, Flavobacterium, Lysobacter, and Sphingobacterium in the sludge presented a high degree of coupling with adsorption capacity, it was inferred that the above dominant species of bacteria may affect the adsorption of Cd by microplastics through the production of extracellular enzyme forms.

Probing changes in humus chemical characteristics in response to biochar addition and varying bulking agents during composting: A holistic multi-evidence-based approach.

Despite the various benefits of humus, the changes in its chemical characteristics during composting in response to biochar addition and varying bulking agents remain to be further explored. In this study, three treatments were conducted, in which swine manure, bulking agent, and biochar were mixed at ratios of 4:1:0, 8:1:0, and 8:1:1. Fourier transform infrared spectroscopy (FTIR), carbon nuclear magnetic resonance spectroscopy (13C-NMR), three-dimensional excitation-emission matrix fluorescence spectroscopy (3D-EEM), and near-edge X-ray absorption fine structure (NEXAFS) were employed to characterize the chemical and structural properties of humus from multiple perspectives. The 3D-EEM spectra in this study showed a larger increase in humic acids (HAs) content (56%) and HAs to fulvic acids ratio (128%) during composting, indicating stronger humification in biochar-amended treatment. FTIR, 13C-NMR, and NEXAFS all confirmed the essential properties of HA as the core agronomic functional substance with rich aromatic and carboxyl groups, and that its aromaticity increased gradually during composting. In addition, 13C-NMR demonstrated that biochar addition and a relatively higher bulking agent ratio aided an increase in the carboxyl C proportion in HA after composting. In particular, NEXAFS revealed that biochar addition promoted the diversification of C, N, and O species in HA, with the emergence of quinone C and O-alkyl C as the main representatives. This work suggests that biochar addition and a relatively high bulking agent ratio could enhance humification and improve the agronomic function of humus.

Exercise Preconditioning Increases Beclin1 and Induces Autophagy to Promote Early Myocardial Protection via Intermittent Myocardial Ischemia-Hypoxia.

Exercise preconditioning (EP) provides protective effects for acute cardiovascular stress; however, its mechanisms need to be further investigated. Autophagy is a degradation pathway essential for myocardium health. Therefore, we investigated whether intermittent myocardial ischemia-hypoxia affected Beclin1 and whether the changes in autophagy levels contribute to EP-induced early myocardial protective effects. Rats were trained on a treadmill using an EP model (four cycles of 10 minutes of running/10 minutes of rest). Exhaustive exercise (EE) was performed to induce myocardial injury. Cardiac troponin I (cTnI) and ischemia-hypoxia staining were used to evaluate myocardial injury and protection. Double-labeled immunofluorescence staining and western blot analysis were employed to examine related markers. EP attenuated the myocardial ischemic-hypoxic injury induced by EE. Compared with the control (C) group, the dissociations of Beclin1/Bcl-2 ratio and Beclin1 expression were both higher in all other groups. Compared with the C group, PI3KC3 and the LC3-II/LC3-I ratio were higher in all other groups, whereas LC3-II was higher in the EE and EEP + EE groups. p62 was higher in the EE group than in the C group but lower in the EEP + EE group than in the EE group. We concluded that EP increases Beclin1 via intermittent myocardial ischemia-hypoxia and induces autophagy, which exerts early myocardial protective effects and reduces the myocardial ischemic-hypoxic injury induced by exhaustive exercise.

High-Resolution Photoelectron Imaging and Photodetachment Spectroscopy of Cryogenically Cooled IO.

We report a high-resolution photoelectron imaging and photodetachment spectroscopy study of cryogenically cooled IO-. The high-resolution photoelectron spectra yield a more accurate electron affinity (EA) of 2.3805(5) eV for IO as well as a more accurate spin-orbit splitting energy between the 2Π3/2 and 2Π1/2 states of IO as 2093(5) cm-1. Photodetachment spectroscopy confirmed several excited states for the IO- anion predicted by theoretical calculations, including two valence-type excited states, the repulsive 3Π state, and a shallow bound 1Π state. More interestingly, we have observed two vibrational resonances which are proposed to be due to a dipole-induced resonant state, about 230 cm-1 above the detachment threshold of IO-.

The synergistic anti-tumor effect of schisandrin B and apatinib.

The synergistic anti-tumor effect of schisandrin B (Sch.B) and apatinib was investigated in vitro. The CCK-8 assay revealed that Sch.B enhanced the inhibition of apatinib on cell proliferation by arresting cell cycle in G0/G1 phase. Sch.B also potentiated the suppression of apatinib on cell migration and invasion, by means of wound-healing and transwell invasion assay. Flow cytometry results showed that Sch.B enhanced apoptosis induced by apatinib. The results were confirmed by western blot analysis of the proteins MMP-9, and Bax caspase-9, and -12. These results suggest that combining apatinib and Sch.B is an effective therapeutic strategy for preventing GC progression. [Formula: see text].

A novel ASBT inhibitor, IMB17-15, repressed nonalcoholic fatty liver disease development in high-fat diet-fed Syrian golden hamsters.

The manipulation of bile acid (BA) homeostasis by blocking the ileal apical Na+-dependent bile salt transporter (ASBT/SLC10A2) may have therapeutic effects in nonalcoholic fatty liver disease. We developed a novel ASBT inhibitor, an N-(3,4-o-dichlorophenyl)-2-(3-trifluoromethoxy) benzamide derivative referred to as IMB17-15, and investigated its therapeutic effects and the molecular mechanisms underlying the effects. Syrian golden hamsters were challenged with high-fat diet (HFD) to induce NAFLD and were subsequently administered 400 mg/kg IMB17-15 by gavage daily for 21 days. Serum, liver, and fecal samples were collected for further analysis. Plasma concentration-time profiles of IMB17-15 were also constructed. The human hepatocyte cell line HL-7702 was treated with Oleic acid (OA) with or without IMB17-15. Western blotting and real-time PCR were used to study the molecular mechanisms of IMB17-15. We found that IMB17-15 inhibited ASBT and subsequently suppressed ileal farnesoid X receptor (FXR) and FXR-activated fibroblast growth factor15/19 (FGF15/19) expression, which reduced the hepatic phosphorylated extracellular regulated protein kinase (ERK) and c-Jun N-terminal kinase (JNK) levels and upregulated the cholesterol 7α-hydroxylase (CYP7A1) activity. Additionally, IMB17-15 stimulated adenosine monophosphate (AMP)-activated protein kinase (AMPKα) phosphorylation and enhanced peroxisome proliferator activated receptor α (PPARα) expression and thus promoted triglyceride (TG) oxidation and high-density lipoprotein cholesterol (HDL-c) metabolism through an ASBT-independent mechanism. In conclusion, a novel ASBT inhibitor known as IMB17-15 protected hamsters against HFD-induced NFALD by manipulating BA and lipid homeostasis. IMB17-15 also reduced lipid deposition in human hepatic cell lines, indicating that it may be useful as a therapy for NAFLD patients.

[Expressions of Sry-related High Mobility Group Box 9 and Gastrokine-1 in Gastric Cancer and Their Relationships with Prognosis].

Objective To explore the expressions of Sry-related high mobility group box 9(SOX9)and gastrokine-1(GKN1) in gastric cancer tissues and their relationships with clinicopathologic features and prognosis of patients.Methods Immunohistochemistry was used to detect the expressions of SOX9 and GKN1 in 70 cases of gastric cancer tissues and corresponding paracancerous tissues including 27 cases of intestinal metaplasia and 43 cases of normal gastric mucosa. The relationships of SOX9 and GKN1 expressions with clinicopathological features and prognosis were analyzed in gastric cancer tissues.Results The high expression rates of SOX9 in gastric cancer tissues,intestinal metaplasia,and normal gastric mucosa were 92.9%(65/70),77.8%(21/27),and 55.8%(24/43),respectively(χ 2=21.722,P<0.001). Positive nuclear and cytoplasmic staining was observed. The high nuclear expression rate of SOX9 in gastric cancer tissues was 67.1%,which was significantly higher than those of intestinal metaplasia(37.0%,P=0.007)and normal gastric mucosa(23.3%,P<0.001). The high cytoplasmic expression rate of GKN1 in normal gastric mucosa was 76.7%,which was significantly higher than those of intestinal metaplasia(44.4%,P=0.006)and gastric cancer tissues(37.1%,P<0.001). Univariate analysis demonstrated that the nuclear expression of SOX9 in gastric cancer was associated with the degree of tissue differentiation(P=0.007),while the cytoplasmic expression of GKN1 was associated with both the degree of tissue differentiation(P=0.002)and whether the pathological type was a signet-ring cell carcinoma(P=0.009). Furthermore,the nuclear expression of SOX9 was negatively correlated with the expression of GKN1 in gastric cancer(χ 2=15.424,P<0.001). The 5-year survival rates of patients with high or low nuclear expression of SOX9 were 33.8% and 67.5%,respectively(P=0.016).The 5-year survival rates of patients with high or low expression of GKN1 were 60.0% and 35.6%,respectively(P=0.044). Further research indicated that 5-year survival rate of patients with high nuclear expression of SOX9 and low expression of GKN1 was 28.8%. Cox multivariate regression analysis showed that TNM stage(stage Ⅱ:HR=7.435,95%CI:1.313-42.096,P=0.023;stage Ⅲ:HR=12.214,95%CI:2.677-55.721,P=0.001)and nuclear expression level of SOX9(HR=3.297,95%CI:1.199-9.065,P=0.021)were independent risk factors for the prognosis of gastric cancer patients.Conclusions Changes in the expressions of SOX9 and GKN1 may be associated with the malignant biological behavior of gastric cancer. SOX9 may be a potential prognostic factor. The combined detection of SOX9 and GKN1 expression and the further study of their molecular mechanism may provide new clues for early diagnosis,targeted therapy,and prognostic prediction of gastric cancer.

[Molecular Mechanism of Ventilator-associated Lung Injury Based on Keap1/Nfr2/ARE Signaling Pathway].

OBJECTIVE: To explore the molecular mechanism of ventilation induced lung injury (VILI) formation based on Keap1/Nfr2/ARE signaling pathway. METHODS: The VILI model was established by excessive mechanical ventilation in SD rats. HE staining was used to detect the pathological changes of lung tissue in the control group, normal tidal volume (VT) group and large VT group (VT 40 mL/kg). The wet weight of lung tissue was detected in each group. Dry weight (W/D) ratio change; BCA method was used to detect the changes of total protein in bronchoalveolar lavage fluid (BALF) of each group; ELISA was used to detect interleukin-1ß (IL-1ß) and leukocyte in BALF and serum of each group. The content of 8-OHdG in the lung tissue was detected by IL-8 and the content of malondialdehyde (MDA) in the lung tissue was detected by TBA method. The NLRP3, ASC and caspase-1 proteins in macrophages were detected by Western blot. The changes of Keap1 and Nrf2 proteins in lung tissues were detected by RT-PCR. The expressions of SOD mRNA and HO-1 mRNA in lung tissues of each group were detected by RT-PCR. RESULTS: Excessive mechanical ventilation could damage lung tissue, leading to alveolar rupture, inflammatory cell infiltration and erythrocytosis. Compared with the control group and normal VT group, the W/D value, 8-OHdG and MDA content in the large VT group, and total BALF, the contents of IL-1ß and IL-18 in protein, IL-1ß, IL-18 in serum increased significantly ( P<0.05). Compared with the control group and normal VT group, NLRP3, ASC, in macrophage of large VT group, the content of Keap1 protein in caspase-1 protein and lung tissue increased significantly ( P<0.05). The expression of Nrf2 protein, SOD mRNA and HO-1 mRNA in lung tissue decreased significantly. CONCLUSIONS: Large VT ventilation can cause acute inflammatory injury in lung tissue and lead to the occurrence of VILI. Inflammatory bodies of NLRP3 in alveolar macrophages are involved in this process, and the mechanism of NLRP3 inflammatory bodies is caused by hyperventilation in addition to mechanical injury. Decreased Keap1/Nrf2-ARE pathway inhibition and ROS clearance may also cause macrophage production of NLRP3 inflammatory bodies.

Arabidopsis casein kinase1 proteins CK1.3 and CK1.4 phosphorylate cryptochrome2 to regulate blue light signaling.

Casein kinase1 (CK1) plays crucial roles in regulating growth and development via phosphorylating various substrates throughout the eukaryote kingdom. Blue light is crucial for normal growth of both plants and animals, and blue light receptor cryptochrome2 (CRY2) undergoes blue light-dependent phosphorylation and degradation in planta. To study the function of plant CK1s, systematic genetic analysis showed that deficiency of two paralogous Arabidopsis thaliana CK1s, CK1.3 and CK1.4, caused shortened hypocotyls, especially under blue light, while overexpression of either CK1.3 or CK1.4 resulted in the insensitive response to blue light and delayed flowering under long-day conditions. CK1.3 or CK1.4 act dependently on CRY2, and overexpression of CK1.3 or CK1.4 significantly suppresses the hypersensitive response to blue light by CRY2 overexpression. Biochemical studies showed that CK1.3 and CK1.4 directly phosphorylate CRY2 at Ser-587 and Thr-603 in vitro and negatively regulate CRY2 stability in planta, which are stimulated by blue light, further confirming the crucial roles of CK1.3 and CK1.4 in blue light responses through phosphorylating CRY2. Interestingly, expression of CK1.3 and CK1.4 is stimulated by blue light and feedback regulated by CRY2-mediated signaling. These results provide direct evidence for CRY2 phosphorylation and informative clues on the mechanisms of CRY2-mediated light responses.

Reduced intensity haplo plus single cord transplant compared to double cord transplant: improved engraftment and graft-versus-host disease-free, relapse-free survival.

Umbilical cord blood stem cell transplants are commonly used in adults lacking HLA-identical donors. Delays in hematopoietic recovery contribute to mortality and morbidity. To hasten recovery, we used co-infusion of progenitor cells from a partially matched related donor and from an umbilical cord blood graft (haplo-cord transplant). Here we compared the outcomes of haplo-cord and double-cord transplants. A total of 97 adults underwent reduced intensity conditioning followed by haplo-cord transplant and 193 patients received reduced intensity conditioning followed by double umbilical cord blood transplantation. Patients in the haplo-cord group were more often from minority groups and had more advanced malignancy. Haplo-cord recipients received fludarabine-melphalan-anti-thymocyte globulin. Double umbilical cord blood recipients received fludarabine-cyclophosphamide and low-dose total body irradiation. In a multivariate analysis, haplo-cord had faster neutrophil (HR=1.42, P=0.007) and platelet (HR=2.54, P<0.0001) recovery, lower risk of grade II-IV acute graft-versus-host disease (HR=0.26, P<0.0001) and chronic graft-versus-host disease (HR=0.06, P<0.0001). Haplo-cord was associated with decreased risk of relapse (HR 0.48, P=0.001). Graft-versus-host disease-free, relapse-free survival was superior with haplo-cord (HR 0.63, P=0.002) but not overall survival (HR=0.97, P=0.85). Haplo-cord transplantation using fludarabine-melphalan-thymoglobulin conditioning hastens hematopoietic recovery with a lower risk of relapse relative to double umbilical cord blood transplantation using the commonly used fludarabine-cyclophosphamide-low-dose total body irradiation conditioning. Graft-versus-host disease-free and relapse-free survival is significantly improved. Haplo-cord is a readily available graft source that improves outcomes and access to transplant for those lacking HLA-matched donors. Trials registered at clinicaltrials.gov identifiers 00943800 and 01810588.

Identification and expression analysis of a new invertebrate lysozyme in Kuruma shrimp (Marsupenaeus japonicus).

Lysozyme is an important component of the innate immunity system against invading pathogens. An invertebrate (i-type) lysozyme from the hepatopancreas of Kuruma shrimp Marsupenaeus japonicus (Mj-ilys) was identified. The full-length cDNA of Mj-ilys was 580bp with a 429 bp open reading frame encoding a 142 amino acid polypeptide. The encoded polypeptide was predicted to have a 17 amino acid signal peptide, and a 125 amino acid mature protein with a theoretical mass of 14.099 kDa and an isoelectric point (pI) of 4.18. A Destabilase conserved domain was predicted in Mj-ilys amino acid sequences which may be stable by 10 cysteine residues forming 5 disulfide bonds. Mj-ilys may loss the muramidase and isopeptidase activities due to the lack of the key catalytic residues. Mj-ilys had high homologous of 80-82% with i-type lysozymes of penaeid shrimps. It was first grouped with other i-type lysozyme of shrimps and crabs in a phylogenetic tree predicted by the Neighbor-Joining method. Mj-ilys mRNA was expressed mainly in hepatopancreas and almost undetectable in other tissues. The mRNA expression of Mj-ilys were all found from fertilized eggs to post-larvae of 17 days (PL17), and its expression exhibited significant differences among each developmental stage. After white spot syndrome virus (WSSV) challenge (3.6 × 10(8) virions/µl), the time-dependent expression pattern of Mj-ilys in hepatopancreas and gills showed significantly different. These results indicated that Mj-ilys is potentially involved in the ontogenesis and immune defense in Kuruma shrimp.

Research on Heat Transfer Characteristics in Oil Pool Fire Based on Spectral Analysis.

The inner part of the oil pool flame could be divided into different combustion areas, and there have been a limited number of researches on the heat transfer characteristics within oil pool fire. Due to the lack of adequate researches on the characteristics of heat transfer in oil pool flame, this paper carries out an analytical study to pool flame spectrums of 92# gasoline，95# gasoline and lube by establishing flame infrared testing system. Spectral information about different combustion regions of oil pool fire is collected. The results show that three kinds of oil pool fire have similar spectral characteristics, with several characteristics emission bands of such combustion products as CO2, H2O and carbon black particles and that 3.4 µm C­H stretching vibration peak is obvious; the main spectral characteristics of smoke zone is high temperature CO2 emission peak at the band range of 4～4.5µm, the heat exchange of flame and air is violent; the temperature changes unstably, and flame pulse frequency is high; spectral characteristics in the intermittent area is high temperature CO2 emission peak at 4～4.5 µm; and flame pulse frequency in intermittent zone is relatively lower compared with that in the smoke zone; compared with that in the flue gas zone and intermittent zone, the combustion in continuous zone is more stable, the spectral characteristics of the region is obvious, and carbon black particle emission intensity is high at 2.5～3 µm, and C­H stretching vibration emission peak shows itself at 3.4 µm, which showed that the characteristic peak oil pool flame spectrum at 3.4 µm is caused by high temperature oil vapor steam. Spectral characteristics analysis of the oil pool flame in different combustion areas shows that the heat transfer is absorbed by the fuel rich layer on the surface of the oil pool flame, which leads to the change in the energy level of the oil vapor near 3.4 µm. The calculation of the emission spectrum intensity of oil pool flame in different combustion areas shows that the intensity in flame continuous zone is the largest, followed by the intermittent zone, that the connection between the flame smoke zone and the air is strong, and that the emission spectrum intensity is the lowest. The results in this study provide a reference for the modification of flame oil heat transfer model.

Analytic Study on the Characteristics of Infrared Spectrum of Oil Pool Flame.

In virtue of the severity and scale of the pollution caused by oil pool flame, space remote sensing can provide us a new way of monitoring in real time the oil pool flame pollution. Space remote sensing monitoring is based on the analysis of target spectrum characteristics. Due to lack of adequate researches on the characteristics of infrared spectrum of oil pool flame, this paper carries out the analytical study on flame spectrums of several types of oil, mixed oil and other combustible objects in outdoor space by establishing all-flame infrared testing system with the spectrum range of 1～14 µm. The results show that the spectrum curves of oil pool flame of 92# gasoline, 95# gasoline, 0# diesel, aviation kerosene and lube have similar features, that there exist characteristics emission peaks at the area of certain wave lengths­H2O characteristics emission peak for 1.1, 2.4, 2.8 and 6.3 µm, CO2 characteristics emission peak for 4.2 and 4.5 µm, C­H stretching vibration emission peak for 3.4 µm, and no obvious characteristics peak for spectrum curves of 6.3 µm and above; that there is no obvious difference in the spectrum of oil pool flame among the mixtures of 92# gasoline and 0# diesel at different proportions, that the comparison of the flame spectrum of 92# gasoline with that of wood and paper shows that there appears a characteristics emission peak at 3.4 µm; that though the flame spectrum of alcohol has similar radiated emission near 3.4 µm, the proportion of its radiation intensity to that of CO2 at 4.5 µm is far less than that for the flame spectrum of 92# gasoline; that the flame spectrum of honeycomb briquette is similar to that of gray body radiation. The differences in flame spectrum among all kinds of combustible materials are closely linked to their chemical compositions and burning reaction mechanisms. Comparative analysis on the spectrum characteristics at continuous area, intermission area and flue gas area shows that C­H stretching vibration peak only exists in continuous area, which proves that the emission peak is caused by the combustible reaction of oil and gas. This result is in line with the mechanism of oil pool combustion reaction. The experimental conclusion is of great significance in the remote-sensing recognition of oil pool flame based on the analysis of spectrum characteristics.

Synthesis and biological evaluation of novel HIV-1 protease inhibitors using tertiary amine as P2-ligands.

A series of tertiary amine derivatives exhibiting potent HIV-1 protease inhibiting properties were identified. These novel inhibitors were designed based on the structure of Darunavir with modification on the P2 and P2' position. This effort led to discovery of 35e and 38e, which exhibited excellent HIV-1 protease inhibition with IC50 values of 15 nM and 64 nM, respectively.

Identification and expression analysis of a novel stylicin antimicrobial peptide from Kuruma shrimp (Marsupenaeus japonicus).

Antimicrobial peptides (AMPs) are important components of the innate immune system and function as the first line of defense against invading pathogens. In current study we identified, cloned and characterized a novel stylicin AMP from Kuruma shrimp Marsupenaeus japonicus (Mj-sty). The full-length cDNA of Mj-sty was 428 bp with an open reading frame of 315 bp that encoded 104 amino acids. The theoretical molecular mass of mature Mj-sty was 8.693 kDa with an isoelectric point (pI) of 4.79. A proline-rich N-terminal region and a C-terminal region contained 13 cysteine residues were identified. Genomic sequence analysis with respect to its cDNA showed that Mj-sty was organized into two exons interrupted by one intron. Tissue-specific expression revealed that Mj-sty was mainly transcribed in gills and hemocytes. Expression of Mj-sty in early developmental stages demonstrated that Mj-sty mRNA were present from fertilized eggs to post-larvae of 17 days (PL17), and the expression levels showed a significant variation in different developmental stages. After challenge of white spot syndrome virus (WSSV), the time-dependent expression pattern of Mj-sty in both gills and hepatopancrease showed down-regulation at the early hours of infection, subsequently up-regulation and down-regulation, and then up-regulation at the end hours to almost the half of the controls. The results indicate that Mj-sty is potentially involved in the ontogenesis and immune responses against WSSV.