First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Nuclear Localizing Peptide-Conjugated, Redox-Sensitive Polymersomes for Delivering Curcumin and Doxorubicin to Pancreatic Cancer Microtumors.

Improving the therapeutic index of anticancer agents is an enormous challenge. Targeting decreases the side effects of the therapeutic agents by delivering the drugs to the intended destination. Nanocarriers containing the nuclear localizing peptide sequences (NLS) translocate to the cell nuclei. However, the nuclear localization peptides are nonselective and cannot distinguish the malignant cells from the healthy counterparts. In this study, we designed a "masked" NLS peptide which is activated only in the presence of overexpressed matrix metalloproteinase-7 (MMP-7) enzyme in the pancreatic cancer microenvironment. This peptide is conjugated to the surface of redox responsive polymersomes to deliver doxorubicin and curcumin to the pancreatic cancer cell nucleus. We have tested the formulation in both two- and three-dimensional cultures of pancreatic cancer and normal cells. Our studies revealed that the drug-encapsulated polymeric vesicles are significantly more toxic toward the cancer cells (shrinking the spheroids up to 49%) compared to the normal cells (shrinking the spheroids up to 24%). This study can lead to the development of other organelle targeted drug delivery systems for various human malignancies.

Insulin Resistance in Young Obese Subjects and Its Relation to Smoking (A Pilot Study).

Insulin resistance is a condition in which cells fail to respond to the normal actions of insulin. Dietary fat, obesity and smoking have been attributed to increase insulin resistance. However, the prevalence of insulin resistance in young obese subjects and its relation to smoking is not well established. This study comprising seventy-five healthy young adults was undertaken to find insulin resistance in obese smokers and non smokers both. Present study showed an overall prevalence of raised homeostatic model assessment of insulin resistance in 14.7 % otherwise healthy young subjects (20-30 years age group). Non-smokers did not show any significant correlation between insulin resistance and body mass index at either stage (normal, pre-obese as well as obese). Smokers also did not show any significant difference of insulin resistance in normal and pre-obese stages. However, marked increase in homeostatic model assessment of insulin resistance was observed in obese smokers. Homeostatic model assessment of insulin resistance showed a linear trend in relation to body mass index and its values were found to be higher in smokers. Obesity combined with smoking demonstrated statistically significant increase in homeostatic model assessment of insulin resistance.

Mechanism of N-Acylthiourea-mediated activation of human histone deacetylase 8 (HDAC8) at molecular and cellular levels.

We reported previously that an N-acylthiourea derivative (TM-2-51) serves as a potent and isozyme-selective activator for human histone deacetylase 8 (HDAC8). To probe the molecular mechanism of the enzyme activation, we performed a detailed account of the steady-state kinetics, thermodynamics, molecular modeling, and cell biology studies. The steady-state kinetic data revealed that TM-2-51 binds to HDAC8 at two sites in a positive cooperative manner. Isothermal titration calorimetric and molecular modeling data conformed to the two-site binding model of the enzyme-activator complex. We evaluated the efficacy of TM-2-51 on SH-SY5Y and BE(2)-C neuroblastoma cells, wherein the HDAC8 expression has been correlated with cellular malignancy. Whereas TM-2-51 selectively induced cell growth inhibition and apoptosis in SH-SY5Y cells, it showed no such effects in BE(2)-C cells, and this discriminatory feature appears to be encoded in the p53 genotype of the above cells. Our mechanistic and cellular studies on HDAC8 activation have the potential to provide insight into the development of novel anticancer drugs.

Bridging of a substrate between cyclodextrin and an enzyme's active site pocket triggers a unique mode of inhibition.

BACKGROUND: Methionyl-7-amino-4-methylcoumarin (MetAMC) serves as a substrate for the Escherichia coli methionine aminopeptidase (MetAP) catalyzed reaction, and is routinely used for screening compounds to identify potential antibiotic agents. In pursuit of screening the enzyme's inhibitors, we observed that 2-hydroxypropyl-ß-cyclodextrin (HP-ß-CD), utilized to solubilize hydrophobic inhibitors, inhibited the catalytic activity of the enzyme, and such inhibition was not solely due to sequestration of the substrate by HP-ß-CD. METHODS: The mechanistic path for the HP-ß-CD mediated inhibition of MetAP was probed by performing a detailed account of steady-state kinetics, ligand binding, X-ray crystallographic, and molecular modeling studies. RESULTS: X-ray crystallographic data of the ß-cyclodextrin-substrate (ß-CD-MetAMC) complex reveal that while the AMC moiety of the substrate is confined within the CD cavity, the methionine moiety protrudes outward. The steady-state kinetic data for inhibition of MetAP by HP-ß-CD-MetAMC conform to a model mechanism in which the substrate is "bridged" between HP-ß-CD and the enzyme's active-site pocket, forming HP-ß-CD-MetAMC-MetAP as the catalytically inactive ternary complex. Molecular modeling shows that the scissile bond of HP-ß-CD-bound MetAMC substrate does not reach within the proximity of the enzyme's catalytic metal center, and thus the substrate fails to undergo cleavage. CONCLUSIONS: The data presented herein suggests that the bridging of the substrate between the enzyme and HP-ß-CD cavities is facilitated by interaction of their surfaces, and the resulting complex inhibits the enzyme activity. GENERAL SIGNIFICANCE: Due to its potential interaction with physiological proteins via sequestered substrates, caution must be exercised in HP-ß-CD mediated delivery of drugs under pathophysiological conditions.

High frequency organogenesis in hypocotyl, cotyledon, leaf and petiole explants of broccoli (Brassica oleracea L. var. italica), an important vegetable crop.

Broccoli (Brassica oleracea L. var. italica) is an important, nutritionally rich vegetable crop, but severely affected by environmental stresses, pests and diseases which cause massive yield and quality losses. Genetic manipulation is becoming an important method for broccoli improvement. In the present study, a reproducible and highly efficient protocol for obtaining organogenesis from hypocotyl, cotyledon, leaf and petiole explants of broccoli (Brassica oleracea L. var. italica cv. Solan green head) has been developed. Hypocotyl and cotyledon explants were used from 10 to 12 days old aseptically grown seedlings whereas leaf and petiole explants were excised from 18 to 20 days old green house grown seedlings and surface sterilized. These explants were cultured on shoot induction medium containing different concentration and combination of BAP and NAA. High efficiency shoot regeneration has been achieved in hypocotyl (83.33 %), cotyledon (90.11 %), leaf (62.96 %) and petiole (91.10 %) explants on MS medium supplemented with 3.5 mg/l BAP + 0.019 mg/l NAA 2.5 mg/l BAP + 0.5 mg/l NAA, 4.0 mg/l BAP + 0.5 mg/l NAA and 4.5 mg/l BAP + 0.019 mg/l NAA respectively. Petiole explants showed maximum shoot regeneration response as compared to other explants. MS medium supplemented with 0.10 mg/l NAA was found best for root regeneration (100 %) from in vitro developed shoots. The regenerated complete plantlets were transferred to the pots containing cocopeat and successfully acclimatized. This optimized regeneration protocol can be efficiently used for genetic transformation in broccoli. This is the first comparative report on multiple shoot induction using four different types of explants viz. hypocotyl, cotyledon, leaf and petiole.

Thermodynamics of binding of structurally similar ligands to histone deacetylase 8 sheds light on challenges in the rational design of potent and isozyme-selective inhibitors of the enzyme.

Among the different histone deacetylase (HDAC) isozymes, HDAC8 is the most highly malleable enzyme, and it exhibits the potential to accommodate structurally diverse ligands (albeit with moderate binding affinities) in its active site pocket. To probe the molecular basis of this feature, we performed detailed thermodynamic studies of the binding of structurally similar ligands, which differed with respect to the "cap", "linker", and "metal-binding" regions of the suberoylanilide hydroxamic acid (SAHA) pharmacophore, to HDAC8. The experimental data revealed that although the enthalpic (ΔH°) and entropic (ΔS°) changes for the binding of individual SAHA analogues to HDAC8 were substantially different, their binding free energies (ΔG°) were markedly similar, conforming to a strong enthalpy-entropy compensation effect. This effect was further observed in the temperature-dependent thermodynamics of binding of all SAHA analogues to the enzyme. Notably, in contrast to other metalloenzymes, our isothermal titration calorimetry experiments (performed in different buffers of varying ionization enthalpies) suggest that depending on the ligand, its zinc-binding group may or may not be deprotonated upon the binding to HDAC8. Furthermore, the heat capacity changes (ΔCp°) associated with the ligand binding to HDAC8 markedly differed from one SAHA analogue to the other, and such features could primarily be rationalized in light of the dynamic flexibility in the enzyme structure in conjunction with the reorganization of the active site resident water molecules. Arguments are presented that although the binding thermodynamic features described above would facilitate identification of weak to moderately tight-binding HDAC8 inhibitors (by a high-throughput and/or virtual screening of libraries of small molecules), they would pose major challenges for the structure-based rational design of highly potent and isozyme-selective inhibitors of human HDAC8.

A disintegrin and metalloproteinase-12 (ADAM12): function, roles in disease progression, and clinical implications.

BACKGROUND: A disintegrin and metalloproteinase-12 (ADAM12) is a member of the greater ADAM family of enzymes: these are multifunctional, generally membrane-bound, zinc proteases for which there are forty genes known (21 of these appearing in humans). ADAM12 has been implicated in the pathogenesis of various cancers, liver fibrogenesis, hypertension, and asthma, and its elevation or decrease in human serum has been linked to these and other physiological/pathological conditions. SCOPE: In this review, we begin with a brief overview of the ADAM family of enzymes and protein structure. We then discuss the role of ADAM12 in the progression and/or diagnosis of various disease conditions, and we will conclude with an exploration of currently known natural and synthetic inhibitors. MAJOR CONCLUSION: ADAM12 has potential to emerge as a successful drug target, although targeting the metalloproteinase domain with any specificity will be difficult to achieve due to structural similarity between the members of the ADAM and MMP family of enzymes. Overall, more research is required to establish ADAM12 being as a highly desirable biomarker and drug target of different diseases, and their selective inhibitors as potential therapeutic agents. GENERAL SIGNIFICANCE: Given the appearance of elevated levels of ADAM12 in various diseases, particularly breast cancer, our understanding of this enzyme both as a biomarker and a potential drug target could help make significant inroads into both early diagnosis and treatment of disease.

pH-triggered echogenicity and contents release from liposomes.

Liposomes are representative lipid nanoparticles widely used for delivering anticancer drugs, DNA fragments, or siRNA to cancer cells. Upon targeting, various internal and external triggers have been used to increase the rate for contents release from the liposomes. Among the internal triggers, decreased pH within the cellular lysosomes has been successfully used to enhance the rate for releasing contents. However, imparting pH sensitivity to liposomes requires the synthesis of specialized lipids with structures that are substantially modified at a reduced pH. Herein, we report an alternative strategy to render liposomes pH sensitive by encapsulating a precursor which generates gas bubbles in situ in response to acidic pH. The disturbance created by the escaping gas bubbles leads to the rapid release of the encapsulated contents from the liposomes. Atomic force microscopic studies indicate that the liposomal structure is destroyed at a reduced pH. The gas bubbles also render the liposomes echogenic, allowing ultrasound imaging. To demonstrate the applicability of this strategy, we have successfully targeted doxorubicin-encapsulated liposomes to the pancreatic ductal carcinoma cells that overexpress the folate receptor on the surface. In response to the decreased pH in the lysosomes, the encapsulated anticancer drug is efficiently released. Contents released from these liposomes are further enhanced by the application of continuous wave ultrasound (1 MHz), resulting in substantially reduced viability for the pancreatic cancer cells (14%).

Bone mineral density among long-term survivors of childhood acute lymphoblastic leukemia: results from the St. Jude Lifetime Cohort Study.

BACKGROUND: The prevalence of low bone mineral density (BMD) in adult survivors of childhood acute lymphoblastic leukemia (ALL), and the degree of recovery or decline, are not well elucidated. PROCEDURE: Study subjects (age ≥ 18 years and ≥10 years post-diagnosis) participated in an institutional follow-up protocol and risk-based clinical evaluation based on Children's Oncology Group guidelines. Trabecular volumetric BMD was ascertained using quantitative computed tomography, reported as age- and sex-specific Z-scores. RESULTS: At median age 31 years, 5.7% of 845 subjects had a BMD Z-score of ≤-2 and 23.8% had a Z-score of -1 to -2. Cranial radiation dose of ≥24 Gy, but not cumulative methotrexate or prednisone equivalence doses, was associated with a twofold elevated risk of a BMD Z-score of ≤-1. The cranial radiation effect was stronger in females than in males. In a subset of 400 subjects, 67% of those who previously had a BMD Z-score of ≤-2 improved by one or more categories a median of 8.5 years later. CONCLUSIONS: Very low BMD was relatively uncommon in this sample of adult survivors of childhood ALL, and BMD Z-scores tended to improve from adolescence to young adulthood. High-dose cranial or craniospinal radiation exposure was the primary predictor of suboptimal BMD in our study. Given that cranial radiation treatment for childhood ALL is used far more sparingly now than in earlier treatment eras, concerns about persistently low BMD among most current childhood ALL patients may be unwarranted.

Early infections after autologous hematopoietic stem cell transplantation in children and adolescents: the St. Jude experience.

INTRODUCTION: Advances in autologous hematopoietic stem cell transplantation (HSCT) over the past 20 years may have had an impact on the morbidity and mortality associated with infections post transplant. PATIENTS AND METHODS: We sought to retrospectively analyze the epidemiology of the first episode of bacterial, fungal, viral, or parasitic infections 0-30 days post transplant in a cohort of 320 children and adolescents who underwent autologous HSCT in a single institution, between 1990 and 2009 for solid tumors or lymphoma, and in 65 children transplanted for acute leukemia during the same period. RESULTS: Infections occurred in 66 (21%) patients with solid tumors or lymphoma. Bacterial infections occurred in 33 (10%) including bacteremia in 23 (7%), and viral infections in 34 (11%) patients. Gram-positive bacterial infections were more prevalent than gram-negative bacterial infections (P = 0.03). Infections caused by fungal or parasitic pathogens were uncommon. The decade when transplant was performed (1990-1999 vs. 2000-2009) had no impact on the incidence of bacterial (P = 0.41) or viral (P = 0.47) infection. Between 1990 and 1999, a total of 60 (92%) children were transplanted for leukemia, and 5 (8%) in the 2000-2009 period (P < 0.0001). Infections occurred in 32 (49%) patients. Bacterial (P = 0.004), candidal (P = 0.003), and herpes simplex viral (P = 0.03) infections were more common in patients transplanted for leukemia. In patients transplanted for leukemia, 3 deaths occurred attributed to infection, all before 2000. CONCLUSION: Changes in epidemiology of infection are likely a result of decline in autologous transplantation for childhood leukemia in the recent era. Autologous transplantation for solid tumors or lymphoma was not associated with mortality from early infections at our institution.

Kinetic and thermodynamic rationale for suberoylanilide hydroxamic acid being a preferential human histone deacetylase 8 inhibitor as compared to the structurally similar ligand, trichostatin a.

Of the different hydroxamate-based histone deacetylase (HDAC) inhibitors, suberoylanilide hydroxamic acid (SAHA) has been approved by the Food and Drug Administration for the treatment of T-cell lymphoma. Interestingly, a structurally similar inhibitor, trichostatin A (TSA), which has a higher in vitro inhibitory potency against HDAC8, reportedly shows poor efficacy in clinical settings. To gain molecular insight into this discriminatory feature, we performed transient kinetic and isothermal titration calorimetric studies for the interaction of SAHA and TSA with the recombinant form of human HDAC8. The transient kinetic data revealed that the binding of both inhibitors to the enzyme showed biphasic profiles, which represented an initial encounter of the enzyme with the inhibitor followed by the isomerization of the transient enzyme-inhibitor complexes. The temperature-dependent transient kinetic studies with these inhibitors revealed that the bimolecular process is primarily dominated by favorable enthalpic changes, as opposed to the isomerization step, which is solely contributed by entropic changes. The standard binding enthalpy (ΔH°) of SAHA, deduced from the transient kinetic as well as the isothermal titration calorimetric experiments, was 2-3 kcal/mol higher than that of TSA. The experimental data presented herein suggest that SAHA serves as a preferential (target-specific and -selective) HDAC8 inhibitor as compared to TSA. Arguments that the detailed kinetic and thermodynamic studies may guide the rational design of HDAC inhibitors as therapeutic agents are presented.

Longitudinal patterns of psychological distress in adult survivors of childhood cancer.

BACKGROUND: This study investigated longitudinal patterns of psychological distress in adult survivors of childhood cancer. METHODS: Participants included 4569 adult survivors in the Childhood Cancer Survivor Study Cohort (CCSS) who completed the Brief Symptom Inventory-18 on three occasions between 1994 and 2010. Longitudinal latent class analysis was used to identify discrete classes of psychological distress. Predictors of class membership were examined through logistic regression modelling with odds ratios (ORs) and 95% confidence intervals (CIs) reported. RESULTS: Survivors were a median of 39 years of age and 30 years from diagnosis at the most recent follow-up. Most survivors reported few or no symptoms of distress over time, although subsets of survivors reported persistently elevated (depression: 8.9%; anxiety: 4.8%; somatisation: 7.2%) or significant increases in distress symptoms over the follow-up period (depression: 10.2%; anxiety: 11.8%; somatisation: 13.0%). Increasing distress symptoms were predicted by survivor perception of worsening physical health over time (depression: OR=3.3; 95% CI=2.4-4.5; anxiety: OR=3.0; 95% CI=2.2-4.0; somatisation: OR=5.3; 95% CI=3.9-7.4). Persistent distress symptoms were also predicted by survivor perception of worsening physical health over time, as well as by worsening pain and ending analgesic use. CONCLUSION: Subgroups of adult survivors are at-risk for chronic distress or significant increases in distress decades following their original cancer diagnosis. Routine screening of psychological distress in adult survivors of childhood cancer is warranted, especially for survivors who experience physical health morbidities.

Polymer-coated echogenic lipid nanoparticles with dual release triggers.

Although lipid nanoparticles are promising drug delivery vehicles, passive release of encapsulated contents at the target site is often slow. Herein, we report contents release from targeted, polymer-coated, echogenic lipid nanoparticles in the cell cytoplasm by redox trigger and simultaneously enhanced by diagnostic frequency ultrasound. The lipid nanoparticles were polymerized on the external leaflet using a disulfide cross-linker. In the presence of cytosolic concentrations of glutathione, the lipid nanoparticles released 76% of encapsulated contents. Plasma concentrations of glutathione failed to release the encapsulated contents. Application of 3 MHz ultrasound for 2 min simultaneously with the reducing agent enhanced the release to 96%. Folic acid conjugated, doxorubicin-loaded nanoparticles showed enhanced uptake and higher cytotoxicity in cancer cells overexpressing the folate receptor (compared to the control). With further developments, these lipid nanoparticles have the potential to be used as multimodal nanocarriers for simultaneous targeted drug delivery and ultrasound imaging.

Melanoma as a subsequent neoplasm in adult survivors of childhood cancer: a report from the childhood cancer survivor study.

BACKGROUND: Childhood cancer survivors have a sixfold increased risk of developing subsequent neoplasms when compared to the general population. We sought to describe the occurrence of melanoma as a subsequent neoplasm among adult survivors of childhood cancer. PATIENTS AND METHODS: Among 14,358 5-year survivors of childhood cancer diagnosed between 1970 and 1986, we calculated the cumulative incidence, standardized incidence ratio (SIR), and absolute excess risk (AER) of subsequent melanoma. Potential risk factors were assessed using a cause-specific hazards model. RESULTS: Fifty-seven melanomas (46 invasive, 2 ocular, and 9 in situ) occurred in 51 survivors. The median time to the development of melanoma was 21.0 years (range: 5.6-35.4 years) and the median age at melanoma was 32.3 years (range: 10.9-49.0 years). Initial cancer diagnoses included soft tissue and bone sarcoma (n = 15), leukemia (13), lymphoma (14), central nervous system malignancy (5), Wilms tumor (3), and neuroblastoma (1). The cumulative incidence of first subsequent melanoma at 35 years from initial cancer diagnosis was 0.55% [95% confidence interval (CI): 0.37-0.73]. The SIR of subsequent invasive malignant melanoma of the skin was 2.42 (95% CI: 1.77-3.23), and the AER was 0.10 (95% CI: 0.05-0.15) per 1,000 person-years. No statistically significant associations were found between melanoma risk and family history of cancer, demographic, or treatment-related factors. CONCLUSION: Survivors of childhood cancer have an approximate 2.5-fold increased risk of melanoma. Early screening and prevention strategies are warranted.

Validation of satisfaction questionnaire for services provided in the labour rooms of government health facilities.

INTRODUCTION AND OBJECTIVES: Using the assessment of satisfaction of patients of labour room services, the caregiver or policymakers can identify the gaps in the implemented programmes and health policies. This study was aimed to design a valid and reliable satisfaction questionnaire that will help in identifying the aspects of gaps that need improvement. METHODS: A facility and community-based observational cross-sectional study was conducted in the district of western Uttar Pradesh (India) between January 2019 and August 2020. Validation of the structured questionnaire with 34 dichotomous questions categorized under five subscales was performed by evaluating its validity and reliability. A total of 380 beneficiaries were selected from 48 government health facilities. RESULTS: The calculated Content validity index was calculated to be 9.5 which was adequate as per the guidelines. The reliability analysis of the questionnaire showed that the internal consistency was high with an overall Cronbach's alpha of 0.710. The variation in Cronbach's alpha on the elimination of any question from the questionnaire ranged from 0.676 to 0.767. The mean patient satisfaction score in the total surveyed population was 24.39±4.684 (total score=34) and there was a greater variation in the satisfaction score of infrastructure when compared with other subscales. CONCLUSION: The findings from this study support the reliability and validity of the patient satisfaction questionnaire as it is capable of evaluating the satisfaction in terms of delivery services provided in labour rooms as a whole.

Ultrasound enhanced matrix metalloproteinase-9 triggered release of contents from echogenic liposomes.

The extracellular enzyme matrix metalloproteinase-9 (MMP-9) is overexpressed in atherosclerotic plaques and in metastatic cancers. The enzyme is responsible for rupture of the plaques and for the invasion and metastasis of a large number of cancers. The ability of ultrasonic excitation to induce thermal and mechanical effects has been used to release drugs from different carriers. However, the majority of these studies were performed with low frequency ultrasound (LFUS) at kilohertz frequencies. Clinical usage of LFUS excitations will be limited due to harmful biological effects. Herein, we report our results on the release of encapsulated contents from substrate lipopeptide incorporated echogenic liposomes triggered by recombinant human MMP-9. The contents release was further enhanced by the application of diagnostic frequency (3 MHz) ultrasound. The echogenic liposomes were successfully imaged employing a medical ultrasound transducer (4-15 MHz). The conditioned cell culture media from cancer cells (secreting MMP-9) released the encapsulated dye from the liposomes (30-50%), and this release is also increased (50-80%) by applying diagnostic frequency ultrasound (3 MHz) for 3 min. With further developments, these liposomes have the potential to serve as multimodal carriers for triggered release and simultaneous ultrasound imaging.

Glycosaminoglycan-mediated selective changes in the aggregation states, zeta potentials, and intrinsic stability of liposomes.

Though the aggregation of glycosaminoglycans (GAGs) in the presence of liposomes and divalent cations has been previously reported, the effects of different GAG species and minor changes in GAG composition on the aggregates that are formed are yet unknown. If minor changes in GAG composition produce observable changes in the liposome aggregate diameter or zeta potential, such a phenomenon may be used to detect potentially dangerous oversulfated contaminants in heparin. We studied the mechanism of the interactions between heparin and its oversulfated glycosaminoglycan contaminants with liposomes. Herein, we demonstrate that Mg(2+) acts to shield the incoming glycosaminoglycans from the negatively charged phosphate groups of the phospholipids and that changes in the aggregate diameter and zeta potential are a function of the glycosaminoglycan species and concentration as well as the liposome bilayer composition. These observations are supported by TEM studies. We have shown that the organizational states of the liposome bilayers are influenced by the presence of GAG and excess Mg(2+), resulting in a stabilizing effect that increases the T(m) value of DSPC liposomes; the magnitude of this effect is also dependent on the GAG species and concentration present. There is an inverse relationship between the percent change in aggregate diameter and the percent change in aggregate zeta potential as a function of GAG concentration in solution. Finally, we demonstrate that the diameter and zeta potential changes in POPC liposome aggregates in the presence of different oversulfated heparin contaminants at low concentrations allow for an accurate detection of oversulfated chondroitin sulfate at concentrations of as low as 1 mol %.

Health-related quality of life of multidrug-resistant tuberculosis patients: A study of eastern Uttar Pradesh, India.

INTRODUCTION: Much attention has been given to the microbiological aspect, drug treatment, and clinical indicators of MDR-TB, but patients' QOL has remained a neglected area. In this study, we aimed to find the quality of MDRTB on various quality of life domains during the initiation of the MDR Treatment regimen. MATERIALS & METHODS: A cross-sectional study was conducted over a period of 6 months at the Drug-Resistance Tuberculosis Management Centre (DR-TB Centre), of a tertiary care centre in the eastern Uttar pradesh, India. Patients with age >18 years diagnosed with MDR-TB (Multidrug resistance TB) were included in the study. The WHO QOL-BREF scale was used to assess the health-related quality of life of patients. Data were analyzed using SPSS version 21. The institutional ethical review committee approved the study, and consent was taken before the participation of patients. RESULTS: A total of 157 patients were included in the study & 45.85% were dissatisfied with their condition. Social domain of WHO QOL-BREF is having the lowest mean score (28.51 ± 15.4) while psychological has high mean values (39.92 ± 6.91). There was a significant difference in the physical health domain with respect to age (p-value 0.001). Similar differences have been seen in the psychological domain regarding patient sex (p-value 0.001), smoking and alcohol within the social domain, and loss of income in the environmental domain. CONCLUSION: The mean value of different domains of WHO QOL-BREF is low in MDR-TB patients, with social relation domain being the most affected.

Stabilization of anionic and neutral forms of a fluorophoric ligand at the active site of human carbonic anhydrase I.

We synthesized a fluorogenic dansylamide derivative (JB2-48), which fills the entire (15 A deep) active site pocket of human carbonic anhydrase I, and investigated the contributions of sulfonamide and hydrophobic regions of the ligand structure on the spectral, kinetic, and thermodynamic properties of the enzyme-ligand complex. The steady-state and fluorescence lifetime data revealed that the deprotonation of the sulfonamide moiety of the enzyme bound ligand increases the fluorescence emission intensity as well as the lifetime of the fluorophores. This is manifested via the electrostatic interaction between the active site resident Zn²+ cofactor and the negatively charged sulfonamide group of the ligand, and such interaction contributes to about 2.2 kcal/mol (ΔΔG°) and 0.89 kcal/mol (ΔΔG(#)) energy in stabilizing the ground and the putative transition states, respectively. We provide evidence that the anionic and neutral forms of JB2-48 are stabilized by the complementary microscopic/conformational states of the enzyme. The implication of the mechanistic studies presented herein in rationale design of carbonic anhydrase inhibitors is discussed.