Hypoalbuminemia, Low Base Excess Values, and Tachypnea Predict 28-Day Mortality in Severe Sepsis and Septic Shock Patients in the Emergency Department

PURPOSE: The objective of this study was to develop a new nomogram that can predict 28-day mortality in severe sepsis and/or septic shock patients using a combination of several biomarkers that are inexpensive and readily available in most emergency departments, with and without scoring systems. MATERIALS AND METHODS: We enrolled 561 patients who were admitted to an emergency department (ED) and received early goal-directed therapy for severe sepsis or septic shock. We collected demographic data, initial vital signs, and laboratory data sampled at the time of ED admission. Patients were randomly assigned to a training set or validation set. For the training set, we generated models using independent variables associated with 28-day mortality by multivariate analysis, and developed a new nomogram for the prediction of 28-day mortality. Thereafter, the diagnostic accuracy of the nomogram was tested using the validation set. RESULTS: The prediction model that included albumin, base excess, and respiratory rate demonstrated the largest area under the receiver operating characteristic curve (AUC) value of 0.8173 [95% confidence interval (CI), 0.7605–0.8741]. The logistic analysis revealed that a conventional scoring system was not associated with 28-day mortality. In the validation set, the discrimination of a newly developed nomogram was also good, with an AUC value of 0.7537 (95% CI, 0.6563–0.8512). CONCLUSION: Our new nomogram is valuable in predicting the 28-day mortality of patients with severe sepsis and/or septic shock in the emergency department. Moreover, our readily available nomogram is superior to conventional scoring systems in predicting mortality.

Changes in Dermatomal Somatosensory Evoked Potentials according to Stimulation Intensity and Severity of Carpal Tunnel Syndrome

OBJECTIVE: To investigate the change of latency of cervical dermatomal somatosensory evoked potential (DSEP) according to stimulation intensity (SI) and severity of carpal tunnel syndrome (CTS). METHODS: Stimulation sites were the C6, C7, and C8 dermatomal areas. Two stimulation intensities 1.5xsensory threshold (ST) and 2.5xST were used on both normal and CTS patients. RESULTS: In moderate CTS, the latencies of C6 and C7 DSEP during 1.5xST SI and those of C7 DSEP during 2.5xST SI were significantly delayed compared with the values of normal subjects. Significant correlation between the latency of C7 DSEP of 2.5xST stimulation and the median sensory nerve conduction velocity was observed. CONCLUSION: We suggest that these data can aid in the diagnosis of cervical sensory radiculopathy using low stimulation intensity and of those who have cervical sensory radiculopathy combined with CTS patients.

Assessment on the Potential Role of Applying Cryoprobe for Tissue Ablation

BACKGROUND/AIMS: Cryotherapy is the therapeutic application for tissue ablation. Clinical applications of cryotherpy such as in pulmonology have increased. Until now, its development in gastroenterology has been insignificant. But, as clinical application such as mucosal ablation on Barrett's esophagus became possible, various applications have been developed. Therefore, it is important to make standards of tissue injury's extent in cryotherapy prior to clinical trial. We evaluated the tissue injury according to the application of cryoprobe with a pig model. METHODS: Cryoprobe was applied to several different segments of the esophagus and stomach for various lengths of time using various number of probe's contact in a pig model. After 48 hours, esophagus and stomach were harvested and histological tissue injury was assessed. The extent of tissue injury was decided by the injury of the deepest layer. RESULTS: Endoscopic application of cryoprobe on esophagus and stomach resulted in a dose-dependent injury: esophageal necrosis was limited to the submucosa after 10 seconds of cryotherapy, and extended to involve the transmural necrosis after over 15 seconds. Necrosis on stomach was extended to involve the transmural necrosis after over 20 seconds. CONCLUSIONS: Positive relationship was seen between the duration and frequency of cryoprobe application and the extent of tissue injury.

Spinal cord injury after conducting transcatheter arterial chemoembolization for costal metastasis of hepatocellular carcinoma

Transcatheter arterial chemoembolization (TACE) has been used widely to treat patients with unresectable hepatocellular carcinoma. However, this method can induce various adverse events caused by necrosis of the tumor itself or damage to nontumor tissues. In particular, neurologic side effects such as cerebral infarction and paraplegia, although rare, may cause severe sequelae and permanent disability. Detailed information regarding the treatment process and prognosis associated with this procedure is not yet available. We experienced a case of paraplegia that occurred after conducting TACE through the intercostal artery to treat hepatocellular carcinoma that had metastasized to the rib. In this case, TACE was attempted to relieve severe bone pain, which had persisted even after palliative radiotherapy. A sudden impairment of sensory and motor functions after TACE developed in the trunk below the level of the sternum and in both lower extremities. The patient subsequently received steroid pulse therapy along with supportive care and continuous rehabilitation. At the time of discharge the patient had recovered sufficiently to enable him to walk by himself, although some paresthesia and spasticity remained.

Optimal time for repeating the IgM anti-hepatitis A virus antibody test in acute hepatitis A patients with a negative initial test / 대한간학회지

BACKGROUND/AIMS: The nonspecific clinical presentation of acute hepatitis A (AHA) mandates the detection of anti-hepatitis A virus IgM antibodies (IgM anti-HAV) in the serum for obtaining a definitive diagnosis. However, IgM anti-HAV might not be present during the early phase of the disease. The aim of this study was to determine the optimal time for repeating the IgM anti-HAV test (HAV test) in AHA patients with a negative initial test. METHODS: In total, 261 patients hospitalized with AHA were enrolled for this retrospective study. AHA was diagnosed when the test for IgM anti-HAV was positive and the serum alanine aminotransferase (ALT) level was > or =400 IU/L. Repeat HAV test was conducted after 1-2 weeks if the initial HAV test was negative but AHA was still clinically suspected. RESULTS: The results of the initial HAV test were negative in 28 (10.7%) patients. The intervals from symptom onset to the initial-HAV-test day and from the peak-ALT day to the initial-HAV-test day were significantly shorter in the negative-initial-HAV-test group, but on multivariate analysis only the latter was significantly associated with negative results for the initial HAV test (beta=-0.978; odds ratio [95% confidence interval]=0.376 [0.189-0.747]; P=0.005). The HAV test was positive in all patients when it was performed at least 2 days after the peak-ALT day. CONCLUSIONS: The results of HAV tests were significantly associated with the interval from the peak-ALT day to the HAV-test day. The optimal time for repeating the HAV test in clinically suspicious AHA patients with a negative initial HAV test appears to be at least 2 days after the peak-ALT day.

Comparison on the Efficacy of Disinfectants Used in Automated Endoscope Reprocessors: PHMB-DBAC versus Orthophthalaldehyde

BACKGROUND/AIMS: Since endoscopes are reusable apparatus classified as semicritical item, thorough reprocessing to achieve high-level disinfection is of utmost importance to prevent spread of infection. To improve disinfection efficacy and safety, disinfectants and endoscope reprocessors are continuously evolving. This study aimed to compare the efficacy of the combination of polyhexamethylenebiguanide hydrochloride-alkyldimethylbenzylammonium chloride (PHMB-DBAC) and orthophthalaldehyde (OPA) used respectively in ultrasonographic cleaning incorporated automated endoscope reprocessors: COOLENDO (APEX Korea) or OER-A (Olympus Optical). METHODS: A total of 86 flexible upper endoscopes were randomly reprocessed with either COOLENDO/PHMB-DBAC or OER-A/OPA. Culture samplings were done at two sites (endoscope tip and working channel) which were later incubated on blood agar plate. Bacterial colonies were counted and identified. RESULTS: The culture-positive rate at the endoscope tip and working channel was 0% and 2.33% for COOLENDO/PHMB-DBAC and 4.65% and 0% for OER-A/OPA. Staphylococcus hominis was cultured from one endoscope reprocessed with COOLENDO/PHMB-DBAC and Pseudomonas putida was isolated from two endoscopes reprocessed with OER-A/OPA. CONCLUSIONS: The reprocessing efficacy of COOLENDO/PHMB-DBAC was non-inferior to that of OER-A/OPA (p=0.032; confidence interval, -0.042 to 0.042). During the study period, significant side effect of PHMB-DBAC was not observed.

A Case of Pyoderma Gangrenosum of the Face Associated with Ulcerative Colitis

Ulcerative colitis is associated with various extra-intestinal manifestations, including rheumatic, dermatologic, ophthalmologic, biliary, and hematologic manifestations. Cutaneous findings are common extra-intestinal manifestations of ulcerative colitis, occurring in 10-20% of patients. Cutaneous manifestations include erythema nodosum, pyoderma gangrenosum, aphthous stomatitis, and acute febrile neutrophilic dermatosis. Treatments for these cutaneous manifestations include corticosteroids, cyclosporine, tacrolimus, mycophenolate mofetil, azathioprine, and infliximab. A 48-year-old male presented with an acute exacerbation of ulcerative colitis associated with multiple skin lesions on his face, thumbs, thighs, and feet. The final impression was neutrophilic folliculitis, which is an early form of pyoderma gangrenosum. The patient's skin lesions and colitis both improved with corticosteroids. There are rare published case reports of ulcerative colitis exacerbations associated with pyoderma gangrenosum that initiated as neutrophilic folliculitis of the face. This case report includes a review of the literature.

Motor Evoked Potentials of Trunk Muscles in Traumatic Brain Injury Patients

OBJECTIVE: To evaluate the motor innervation of trunk muscles in traumatic brain injury patients. METHOD: Twenty patients (12 men and 8 women) with traumatic brain injury were enrolled in this study. Their mean age was 41 years. Motor evoked potentials (MEPs) were performed on the motor cortex. Electromyographic activities were recorded from the bilateral rectus abdominis muscles, the external oblique abdominal muscles, and the 4th and 9th thoracic erector spinae muscles. The onset latency and amplitude of contralateral and ipsilateral MEPs were measured. All patients were assessed by the Korean version of the Berg Balance Scale (K-BBS) to investigate the relationship between the frequency of MEPs in trunk muscles and gait ability. RESULTS: The mean frequency of ipsilateral MEPs was 23.8% with more damaged hemisphere stimulation, while the contralateral MEPs showed a mean frequency of 47.5% with more damaged hemisphere stimulation in traumatic brain injury patients. The latencies and amplitudes of MEPs obtained from the more damaged hemisphere were not significantly different from those of the less damaged hemisphere. There was no correlation between the manifestation of MEPs in trunk muscles and gait ability. CONCLUSION: The ipsilateral and contralateral corticospinal pathways to trunk muscles are less likely to be activated in traumatic brain injury patients because of direct injury of the descending corticospinal motor tract or decreased excitability of the corticospinal tract from prefrontal contusion.

Reference Data of Cervical Dermatomal Somatosensory Evoked Potentials Using Low Intensity Stimulation and Report of 2 Cases

OBJECTIVE: To establish reference data for dermatomal somatosensory evoked potentials (DSEP) using a stimulation intensity lower than what is conventionally utilized. METHOD: Fifty subjects (25 older adults>48 years old; 25 younger adults<32 years old) without history of neck pain or cervical spine surgery were enrolled. The DSEP study was performed with stimulation intensities of 1.0, 1.5, and 2.5 times sensory threshold (ST) on right arms for C5, C6, C7, and C8 dermatomes. RESULTS: The mean latencies of DSEP stimulating C5, C6, C7, and C8 dermatomes with 1.5 times ST intensity were 17.6+/-1.7 ms, 22.2+/-2.1 ms, 22.8+/-1.4 ms, and 22.6+/-1.8 ms, respectively. The mean amplitude (N1P1) of DSEP stimulating C5, C6, C7, and C8 dermatomes with 1.5 times ST intensity were 0.9+/-0.4 microV, 0.9+/-0.5 microV, 1.0+/-0.6 microV, and 1.1+/-0.8 microV, respectively. The C5, C6, C7, and C8 DSEP were evoked in 84%, 98%, 100%, and 96% of cases with 2.5 times ST compared to 64%, 56%, 60%, and 62% with 1.5 times ST, respectively. When one DSEP was not evoked, the DSEP of the opposite side was evoked only in 2 subjects. CONCLUSION: This study provides the reference data of DSEP with lower stimulation intensities than are conventionally utilized. Additionally, two cases of clinical significance were reported.

Improvement of the Working Memory by Transcranial Direct Current Stimulation in Healthy Older Adults

OBJECTIVE: To investigate the short term effects of prefrontal transcranial direct current stimulation (tDCS) in healthy older adults aged more than 65 years by means of verbal and visuospatial working memory tasks. METHOD: Twenty four healthy older adults (14 males and 10 females, age range: 65-78 years old) were enrolled in this study. A double-blind study was conducted. The subjects underwent sham or anodal tDCS over the left prefrontal cortex (F3 in the international 10-20 EEG system). DC was delivered for 30 minutes at 2 mA with 25 cm2 saline-soaked sponge electrodes. A cathode electrode was applied to the left arm. Before and after tDCS, the subjects performed 2-back verbal working memory and visuospatial memory tasks. The rates of improvement of the accuracy and the reaction time were analyzed. RESULTS: On the 2-back verbal working memory tasks, the verbal working memory accuracy was improved in the real group compared with that of the sham group. On visuospatial working memory task, the working memory accuracy and reaction time were not improved in either the real group or the sham group. CONCLUSION: The results showed beneficial effects of noninvasive anodal tDCS on the cognitive function in healthy older adults. We suggest that tDCS induces functional changes on the left prefrontal cortex, and it improves the age-related cognitive impairment in the healthy elderly population.

A Case of Unilateral Submandibular Glandular Aplasia / 대한이비인후과학회지

The congenital absence of the major salivary glands is an uncommon disorder, although it is not always symptomatic. Their etiopathogenesis is poorly understood. Aplasia of the salivary glands may occur either in isolation or in association with other developmental abnormalities. Some authors have reported familial salivary gland aplasia. Aplasia may be partial or total. Severely affected patients suffer from dry mouth and an increased rate of dental decay. Following clinical exclusion of the cause of these symptoms, the diagnosis of submandibular gland aplasia can be confirmed by computed tomography and a Tc-99m pertechnate scintiscan. The authors experienced a case of incidentally detected, unilateral submandibular glandular aplasia in a 38-year old female. So we present this case with review of literatures.

Malignant Myoepithelioma of the Parotid Gland: A Case Report and Review of the Literature / 대한이비인후과학회지

Myoepitheliomas of salivary gland occur infrequently and are generally benign. Malignant myoepitheliomas of salivary gland are extremely rare tumor, and increasing number of case reports have shown that malignant myoepitheliomas may either arise de novo or develop in a pre-existing pleomorphic adenoma. In our case, myoepitheliomas was located in the parotid gland, and tumor cells displayed morphological features of spindle & epithelioid cells. Their clinical behavior by literature seems variable. This case dealt with malignant myoepithelioma of the parotid gland in a 65-year-old man with a relatively favourable course, and was followed up for 2 years and 5 months. In addition, this case illustrates some of the characteristic clinical and pathological features of this rare tumor.

A Case of Isolated Frontal Fungal Sinusitis with Orbital Complication / 대한이비인후과학회지

The most commonly involved sinus of fungal infections is maxillary sinus, followed by sphenoid sinus and ethmoid sinus. On the other hand, the frontal sinus is only occasionally affected. Common pathogenic organisms related to fungal sinusitis are species of Aspergillus, dematiaceous fungi or zygomycetes; however, species of candida are rarely reported. In the invasive fungal sinusitis, orbital invasion, invasion and destruction of the skull base with a fungal meningitis, and fungal osteomyelitis with complete destruction of the maxilla have all been reported. Although these occurrences can not be explained, orbital complications have been reported in the noninvasive paranasal sinus mycosis. The treatment of paranasal fungus ball is primarily by surgical removal. In the past, fungus ball of frontal sinus was approached externally; however, this has been largely replaced with the endonasal endoscopic technique. We experienced a case of frontal fungal sinusitis with orbital complication, which was successfully treated by endonasal endoscopic frontal sinusotomy. In this paper, we report this case with a review of literature.

Induction of Humoral Immue Response in Mice by Wild and Mutant Type HBV Core DNA Vaccination / 대한면역학회지

No abstract available.

Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR)

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.