ABSTRACT
Objective:To record stereoelectroencephalography (SEEG) data and to induce cortical electrical stimulation in children with tuberous sclerosis complex (TSC), thus exploring the epileptogenicity of different types of cortical tubers.Methods:The SEEG recording and cortical electrical stimulation data of 50 children with TSC who underwent preoperative evaluation for drug-resistant epilepsy at Epilepsy Center, Tsinghua University Yuquan Hospital from November 2016 to September 2022 were retrospectively analyzed, involving 27 boys and 23 girls with the age of (5.5±3.4) years.According to the results of 3.0T magnetic resonance imaging (3T-MRI) and computed tomography(CT), cortical tubers were classified.The incidences of electroclinical seizures, electrical seizures and seizures induced by cortical electrical stimulation in different types of tubers recorded by SEEG were analyzed, and the differences in the proportion of the above seizures among different types of tubers were compared using the Fisher′ s exact test. Results:A total of 303 cortical tubers were explored using SEEG in 50 patients.The tubers were divided into 6 types, including Type A, B, C, D and E, and focal cortical dysplasia like (FCD-like) type, among which Type E was for the first time proposed in the world.Among these explored tubers, 7 tubers had electrical seizures, and 57 tubers had electroclinical seizures.A total of 64 tubers (21.1%) were epileptogenic.The incidence of epileptogenic tubers in Type A-E and FCD-like type were 3.6%, 1.4%, 19.0%, 77.8%, 77.5%, and 90.0%, respectively. Fisher′ s exact test and Bonferroni correction were performed for pairwise comparisons( P<0.003). There was no significant difference in the incidence of epileptogenic tubes among Type A, B and C. There was significant difference in the incidence of epileptogenic tubes between Type A-C with Type D, Type E and FCD-like type, respectively.There was no significant difference in the incidence of epileptogenic tubes between Type D, Type E and FCD-like like.Electrical stimulation-induced seizures occurred in 36 cortical tubers (11.9%). The positive rate of electrical stimulation seizures in Type A-E and FCD-like type were 0.7%, 1.4%, 4.8%, 44.4%, 45.0%, and 70.0%, respectively.There was significant difference in the positive rate of electrical stimulation seizures between Type A-B and Type D, Type E and FCD-like type, respectively, so as that between Type C versus Type E and FCD-like type.No significant difference in the positive rate of electrical stimulation seizures was found between other pairwise comparisons. Conclusions:This study proposed a new classification of cortical tubers in TSC patients, and Type E is proposed for the first time in the world.SEEG records confirmed great differences in epileptogenicity indifferent types of cortical tubers.Type D, Type E and FCD-like type have higher epileptogenicity, which is of great value for the preoperative evaluation of TSC epilepsy surgery and the placement strategy of SEEG electrodes.
ABSTRACT
Objective:To analyze the characteristics of stereoelectroencephalography (SEEG) in children with drug-resistant epileptic spasms (ES), and to explore the surgical strategy of children with spastic seizure under the guidance of SEEG.Methods:The clinical data of 156 children with ES who were preoperatively evaluated in the Department of Neurosurgery Ward 3, Tsinghua University Yuquan Hospital from January 2014 to December 2021 were retrospectively reviewed.All children were evaluated in the second stage of stereotactic electrode placement after a non-invasive preoperative evaluation.The characteristics of intracranial EEG, surgical strategy and prognosis were analyzed.Results:A total of 19 eligible children were included, involving 13 boys and 6 girls.The age of first onset and surgical age of them ranged 1 month to 4 years, and 2 years to 13 years, respectively.The SEEG was divided into 3 types in children with ES at the onset.Five children were SEEG type A, presenting with the focal seizure discharges at the beginning and a gradual propagation to widespread fast-wave bursts.Ten children were SEEG type B, presenting a focal leading spike followed by diffused fast-wave bursts.Four children were SEEG type C, presenting a diffuse fast wave rhythm onset.Although some electrode discharges appeared slightly " leading", they covered more than one brain region.After focal resection or thermocoagulation, 13/19 patients did not have the onset of seizures, and 5/19 and 8/19 were graded as SEEG type A, and B, respectively.During the intermittent period of SEEG attacks in children with SEEG type A and B, a significant phenomenon of focal epileptic discharge consistent with the onset of the attack was observed, and surgical removal of these areas effectively controlled spastic seizures.Conclusions:Epileptic spasms may be triggered by a focal neocortical discharge.Intracranial EEG showed that the focal seizure onset evolves into spasm or a focal " leading spike" is a good indicator of surgical prognosis.
ABSTRACT
Objective To study the diversities of imaging, symptoms, electrophysiology and clinical value of the stereoelectroencephalography(SEEG) in patients with mesial temporal lobe epilepsy.Methods Eight patients with intractable epilepsy in Epilepsy Center of Yuquan Hospital of Tsinghua University who underwent mesial temporal lobectomy were recruited in this study, and their epileptic foci could not be accurately positioned.Therefore stereotactic brain electrodes were implanted, and their usual attack originated from mesial temporal lobe structure were confirmed.There was no seizure in the one year follow-up.Results Symptoms of the eight patients behaved differently, and the onset of the seizures in scalp electroencephalograph or SEEG showed diversities.Epileptic discharges were found originated from the mesial temporal lobe after implanting electrodes: in the early stage of discharges, four cases had the conduction to insular lobe structure;two cases had the conduction to contralateral mesial temporal lobe;one case had the conduction to retrosplenial cortex;one case had the conduction to parietal lobe;one case had the conduction to frontal lobe and rapid generalization (one case had the conduction to insular lobe and contralateral mesial temporal lobe meanwhile).Conclusions There is difference in clinic, imaging and electrophysiology of the patients with mesial temporal lobe epilepsy The non-specificity can be explained by the evolution of the intracranial electroencephalography, which can help us know its network conduction pattern Insular lobe is the most common conduction approach of mesial temporal lobe epilepsy in early stage SEEG can be used as a microinvasive, accurate preoperative localization method, which can help us to locate accurately and understand the discharges and conduction mode.
ABSTRACT
Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .
ABSTRACT
Objective To propose a novel stereo-electroencephalography(SEEG) quantitative measure analyzing ictal high frequency (60-90 Hz) and calculating high frequency epileptogenicity index (HFEI) to localize epileptogenic zone and evaluate epileptogenic network. Methods The clinical presurgical evaluation and SEEG data of 15 patients who were performed SEEG electrodes implantation from April 2015 to March 2016 were analyzed retrospectively. Post-implantation head CT images and 3D MRI data were fused for accurately identifying and locating each electrode contact. Ictal SEEG quantitative measure HFEI was calculated and threshold was set. The epileptogenic network was divided into focal, regional, multiple regional and bilateral ones and the results were compared with the pathological results.Results The epileptogenic network was focal for four patients, regional for four patients, multiple regional for six patients and bilateral for one patient (7/15). In terms of the pathology,two cases with hippocampal sclerosis both showed regional network. In four cases with cerebral malacia, two cases showed multiple regional network and the other two cases showed focal network. In six cases with cortical malformation, three cases showed multiple regional network, the other three cases showed focal, regional and bilateral networks respectively. Conclusions We explored a novel SEEG quantitative measure based on the high frequency power analysis,which is objective and could localize epileptogenic zone and evaluate the epileptic network.
ABSTRACT
Cerebral palsy, a non-progressive central dyskinesis caused by a variety of reasons. is one of the major diseases resulting in serious paralysis of children nervous system. At present there is no special treatment. and most are supporting and symptomatic treatments. In recent years, with development of recombinant DNA technology and cell biology. transgenic cell lines and cell line transplantation have become new focus of study in brain transplant. Currently the experimental studies on cell transplantation, especially stem cells. in the treatment of children cerebral palsy mainly refer to newborn animals with hypoxic-ischemic brain injury at acute phase. and have made some progresses. Studies have demonstrated that stem cells can survive longest for eight months after transplanted into the brain. and can migrate to the damage a/ca and differentiate into different phenotypes of nerve cells to improve partly neuroethology disorder. However. that transplanted stem cells differentiate into minimal target neurons may be ode of main reasons that cannot achieve ideal effects.
ABSTRACT
AIM:To observe the dynamic changes of synapsin I expression and its phosphorylation in hippocampus in vascular dementia(VD)rats.METHODS:Eighty SD rats were randomly divided into sham-operated group(n=40)and VD model group(n=40),and the latter were established by repeatedly clipping the common carotid arteries with an intraperitoneal injection of sodium nitroprusside solution in anesthetized condition.The synaptic ultrastructural changes in hippocampal CA1 region and the expression levels of synapsinⅠ and phosphorylated synapsinⅠin hippocampus were observed by TEM and immunohistochemical staining method respectively in both sham-operated group and VD model group at 15 d,1 month,2 months and 4 months time points.RESULTS:No obviously pathological changes to CA1 area synapse were found in SO group.In model group rats,synaptic circa membrane ambiguity and fusion,synaptic circa membrane structure decreased the postsynaptic density,reduced synaptic vesicles and vesicle cluster.Above pathological changes became gradually severe along with the time prolongation after model-making operation.Compared with sham-operated group,the expression of synapsin I significantly reduced in CA1 region(P0.05)in model group was observed.The number of p-synapsin I positive neurons in DG and hippocampal CA1 region was less in model group than that in sham-operated group(P0.05).CONCLUSION:The damaged synaptic structure and depressed expression of synapsin I and its phosphorylation in presynaptic parts of hippocampus induced by repeatedly cerebral ischemia/reperfusion may contribute to the synaptic transmission disorders,especially the presynaptic disorder which may be one of the important pathogenesis of the initiation and development in vascular dementia rats.