Analysis of clinical phenotype and genetic variants in a Chinese pedigree affected with Angelman syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic etiology for a Chinese pedigree affected with Angelman syndrome (AS).@*METHODS@#The proband with phenotypes suggestive of AS was subjected to copy number variation sequencing (CNV-seq), methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) and high-throughput next generation sequencing (NGS). Variant of the UBE3A gene was verified among family members by Sanger sequencing and bioinformatic analysis.@*RESULTS@#NGS revealed that the proband has carried a heterozygous variant of the UBE3A gene, namely c.1517G>A (p.R506H). The variant has co-segregated with the disease in the pedigree. Multiple amino acid sequence alignment showed that the site of mutant residue is conserved among nine homologous species. The variant was predicted to be deleterious by bioinformatic analysis.@*CONCLUSION@#A novel variant of the UBE3A gene has been identified in a Chinese pedigree affected with AS. Above finding has further expanded the spectrum of UBE3A gene variants and phenotypes of AS, which also facilitated molecular diagnosis and genetic counseling for the family.

Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Analysis of NF1 gene mutations among eleven sporadic patients with neurofibromatosis type 1 / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To explore the genetic etiology for 11 sporadic patients with neurofibromatosis type 1.</p><p><b>METHODS</b>Chip targeting capture and high-throughput sequencing were employed to detect potential mutations of NF1 and NF2 genes among the 11 patients. The data was filtered through multiple mutational databases and in-house whole exome sequence database. Sanger sequencing was used for analysis of family members of the patients.</p><p><b>RESULTS</b>Eleven pathogenic variants were found among the 11 patients, which included two splicing mutations, one missense mutation, two nonsense mutations, and six frame-shifting mutations. None of the mutations was recorded by the public database or the in-house database generated from 1775 samples through whole exome sequencing. None of the unaffected parents carried the same mutation. Seven mutations were associated with neurofibromatosis type 1 previously, while the remaining four were discovered for the first time. Prenatal diagnosis of two high-risk pregnancies suggested that neither fetus has inherited the NF1 mutation from their affected parents.</p><p><b>CONCLUSION</b>Identification of causative mutations in patients with sporadic-type neurofibromatosis type 1 has provided a basis for genetic counseling. The four novel mutations have enriched the spectrum of NF1 gene mutations.</p>

Etiology analysis of 86 children with end-stage renal disease in a single-center / 中华实用儿科临床杂志

Objective To investigate the etiology composition of end-stage renal disease (ESRD) in children,in order to provide reference for the prevention and treatment.Methods The children with ESRD who were diagnosed in Peking University First Hospital from January 2005 to October 2013 were selected,and the etiology composition and incidence of the children with ESRD were retrospectively analyzed.Diagnostic criteria for children with ESRD refer to the clinical practice guidelines for chronic renal disease (NKF/KDOQI),developed by the American kidney foundation in 2002.Results Eighty-six children with ERSD were enrolled including 53 cases of males,33 cases of females,with the male to female ratio of 1.61 ∶ 1.00 and the mean onset age was (7.08 ± 4.23) years old,and their average diagnosis age was(9.25 ±4.17) years old.The median duration of ERSD before diagnosis was 0.84(0.01-13.67)years.The main cause of ESRD was acquired renal disease,accounting for 43.02％ (37/86 cases),mainly the chronic glomerulonephritis (18/86 cases,20.93％) and nephrotic syndrome (16/86 cases,18.60％);followed by urinary congenital abnormity,accounting for 40.70％ (35/86 cases),in which the most common were renal dysplasia (18/86 cases,20.93％) and cystic renal disease (11/86 cases,12.79％).Children under 3 years old mainly showed congenital urinary tract abnormalities(6/10 cases,60.00％).But children over 3 years old mainly showed acquired renal diseases (37/76 cases,48.7％),and pathologic classification of glomerular disease were proliferative mesangial glomerulonephritis (6/23 cases,26.09％),focal segmental glomerulosclerosis (5/23 cases,21.74％) and interstitial nephritis(3/23 cases,13.04％).Conclusions The main etiology of ESRD is glomerular disease and congenital abnormal development of urinary system,therefore,more attention should be paid on the ultrasound screening of the urinary tract in the perinatal period and urine screening in children.There are great significances in reducing the incidence of ESRD and intervening actively the progression to chronic kidney disease.

Etiology analysis of 86 children with end-stage renal disease in a single-center / 中华实用儿科临床杂志

Objective To investigate the etiology composition of end-stage renal disease (ESRD) in children,in order to provide reference for the prevention and treatment.Methods The children with ESRD who were diagnosed in Peking University First Hospital from January 2005 to October 2013 were selected,and the etiology composition and incidence of the children with ESRD were retrospectively analyzed.Diagnostic criteria for children with ESRD refer to the clinical practice guidelines for chronic renal disease (NKF/KDOQI),developed by the American kidney foundation in 2002.Results Eighty-six children with ERSD were enrolled including 53 cases of males,33 cases of females,with the male to female ratio of 1.61 ∶ 1.00 and the mean onset age was (7.08 ± 4.23) years old,and their average diagnosis age was(9.25 ±4.17) years old.The median duration of ERSD before diagnosis was 0.84(0.01-13.67)years.The main cause of ESRD was acquired renal disease,accounting for 43.02％ (37/86 cases),mainly the chronic glomerulonephritis (18/86 cases,20.93％) and nephrotic syndrome (16/86 cases,18.60％);followed by urinary congenital abnormity,accounting for 40.70％ (35/86 cases),in which the most common were renal dysplasia (18/86 cases,20.93％) and cystic renal disease (11/86 cases,12.79％).Children under 3 years old mainly showed congenital urinary tract abnormalities(6/10 cases,60.00％).But children over 3 years old mainly showed acquired renal diseases (37/76 cases,48.7％),and pathologic classification of glomerular disease were proliferative mesangial glomerulonephritis (6/23 cases,26.09％),focal segmental glomerulosclerosis (5/23 cases,21.74％) and interstitial nephritis(3/23 cases,13.04％).Conclusions The main etiology of ESRD is glomerular disease and congenital abnormal development of urinary system,therefore,more attention should be paid on the ultrasound screening of the urinary tract in the perinatal period and urine screening in children.There are great significances in reducing the incidence of ESRD and intervening actively the progression to chronic kidney disease.

Clinical and genetic features of X-linked Alport syndrome in men positive for the collagen Ⅳ α5 chain in epidermal basement membrane / 中华儿科杂志

<p><b>OBJECTIVE</b>To analyze the clinical and genetic features of X-linked Alport syndrome (XLAS) in men positive for the collagen α5(Ⅳ) chain in epidermal basement membrane.</p><p><b>METHOD</b>This was a retrospective study. Totally 725 families were diagnosed as Alport syndrome in Department of Pediatrics of Peking University First Hospital during January 1998 to December 2014, among them 450 patients were males with XLAS. Patients who met both of the following two criteria were included in this study. (1)Patients underwent α5(Ⅳ) chain staining in the epidermal basement membrane. (2)Mutations in COL4A5 gene were detected.Mann-Whitney test and χ(2) test were used.</p><p><b>RESULT</b>Totally 140 males with XLAS were included in this study, 18 cases were α5 (Ⅳ)-positive and 122 cases were α5 (Ⅳ)-negative. The two groups of patients were compared, the median age at analysis was 11.0 vs. 7.2 years (Z = -1.839, P = 0.066), the 24-hour urine protein was 1.50 vs. 0.57 g/d (Z = -1.212, P = 0.226), the rate of hearing loss was 28% vs. 53% (χ(2) = 3.619, P = 0.067), the number of patients progressed to end stage renal disease (ESRD) was 4 vs. 12 (χ(2) =2.377, P = 0.128), the median age of ESRD was 31.0 vs. 16.6 years (Z = -2.554, P = 0.011), the rate of missense mutations in COL4A5 gene was 67% vs. 52% (χ(2) = 1.424, P = 0.313).</p><p><b>CONCLUSION</b>Compared the two groups of patients with positive and negative staining for the collagen Ⅳ α5 chain in epidermal basement membrane, there was no significant difference in the proteinuria level, the rate of hearing loss and genotype of COL4A5 gene. But the patients with positive staining progressed to ESRD significantly later than the patients with negative staining.</p>

Treatment of idiopathic membranous nephropathy in 35 children / 中华实用儿科临床杂志

Objective To investigate the prognosis and efficiency of glucocorticoid and immunosuppressor in the treatment of idiopathic membranous nephropathy(IMN)in children. Methods A retrospective analysis of 35 cases of biopsy - proven membranous nephropathy without secondary factors was performed,who were found present with ne-phrotic proteinuria and admitted to hospital from March 2004 to July 2013,to explore the efficiency of treatment with glucocorticoid and immunosuppressor and its prognosis. Results The 35 IMN cases included 18 boys and 17 girls,and the ratio was 1. 1∶ 1. 0. The mean age at onset was(11. 3 ± 0. 5)years with a range of 3. 0 - 17. 1 years. Five cases with gross hematuria,24 cases present with microscopic hematuria,8 cases with hypertension,1 case with chronic renal insufficiency,and 2 cases were complicated with thrombosis. According to membranous nephropathy staging criteria,9 cases(25. 7% )were in stage Ⅰ,16 cases(45. 7% )in stage Ⅱ,10 cases(28. 6% )in stage Ⅲ;about 94. 3%(33 / 35 cases)had mesangial cells and mesangial matrix with mild to moderate hyperplasia. They were all treated with glucocor-ticoid initially and one of them showed sensitive to flucocorticoid but developed flucocorticoid resistance after relapse, while all the others were flucocorticoid - resistant. Cyclophosphamide A(CsA)was introduced to 17 cases and at least lasted for 3 months,in which 13 cases(76. 5% )reached complete remission and 3 cases reached partial remission, while 1 case didn't achieve remission,and the mean time for proteinuria to disappear was(4. 9 ± 3. 7)months;5 cases were treated with Mycophenolate mefetil( MMF),among which 4 cases reached complete remission in 2 months,4 months,5 months,and 9 months separately,while 1 case reached partial remission. Cyclophosphamide(CTX)was intro-duced to 6 cases,in which the mean cumulative dosage was(91. 2 ± 46. 5)mg/ kg,among them 1 case(87 mg/ kg) reached complete remission,1 case(160 mg/ kg)partial remission,but 4 cases didn't achieve remission. One case reached remission after Rituximab(RTX)was introduced. One case got partial remission after Leflunomide(LEF)was introduced,and the complete remission rate was higher in those treated with combined therapy of glucocorticoid and CsA than those treated with glucocorticoid only(76. 5% vs 12. 5% ,P = 0. 004),but the total efficacy showed no difference (94. 2% vs 62. 5% ,P = 0. 081). The complete remission rate(76. 5% vs 38. 5% ,P = 0. 042)and total efficacy (94. 1% vs 61. 5% ,P = 0. 040)were higher in those with combined therapy of steroid and CsA than those treated with steroid and other immunosuppressor. The complete remission rate(76. 5% vs 16. 7% ,P = 0. 018)and total efficacy (94. 1% vs 33. 3% ,P = 0. 008)were also higher than those treated with steroid and CTX,but the complete remission rate(76. 5% vs 80. 0% ,P = 0. 687)and total efficacy(94. 1% vs 100. 0% ,P = 0. 773)showed no difference com-pared with those treated with steroid and MMF. Conclusions IMN shows glucocorticoid resistance mostly,while CsA had definite efficiency and may be better than CTX. And the efficiency of MMF should be noted.

Analysis and carrier screening for copy numbers of SMN and NAIP genes in children with spinal muscular atrophy / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To assess the association of copy number variations of SMN1, SMN2, NAIP, GTF2H2 and H4F5 genes with clinical classification of spinal muscular atrophy in children, and determine the copy number of the SMN gene among pregnant women. A carrier screening was also performed in Sichuan province.</p><p><b>METHODS</b>The copy number variations of the above genes among 53 confirmed SMA patients were determined with MLPA technique. The copy number variations were analyzed by the Fisher's exact test. Deletion of exon 7 in the SMN1 gene was screened with denaturing high performance liquid chromatography (DHPLC) for 427 pregnant women.</p><p><b>RESULTS</b>Among the 53 cases of type I, II, and III SMA patients, the rate of homozygous deletion of both exons 7 and 8 of the SMN1 gene were 100%, 94.44% and 87.50%, respectively, whereas those of homozygous deletion of exon 7 of SMN1 gene were 0, 5.56%, and 12.50%, respectively. The patients with 1, 2, 3, and 4 copies of exon 7 of the SMN2 gene were 11.32%, 67.92%, 13.21% and 7.55%, respectively. The patients with 0, 1, and 2 copies of exon 5 of NAIP gene were 11.32%, 62.26%, and 26.42%, respectively. No deletion was detected in GTF2H2 or H4F5 genes. The heterozygous loss rate of exon 7 in SMN gene in the pregnant women population of Sichuan region was approximately 2.11%.</p><p><b>CONCLUSION</b>Copy number variations of SMN2 and NAIP genes in patients are related to SMA clinical types (P < 0.05). In contrast, there was no relationship between SMA clinical types and deletion of exons 7 and 8 in the SMN1 gene (P > 0.05). Analysis of copy number change in SMN1 gene can assist SMA carrier screening. However, when the general population without SMA family history is screened for disease-causing genes, it should be noted that the type "2+0" carriers may affect the screening result, and the result should be interpreted with caution.</p>

Clinical characteristies of atypical hemolytie uremic syndrome associated with H factor antibody in children / 中华儿科杂志

<p><b>OBJECTIVE</b>To investigate the clinical characteristics, renal pathology, treatment and prognosis of children with atypical hemolytic uremic syndrome associated with H factor antibody.</p><p><b>METHOD</b>Four children less than 18 yr of age admitted from Nov. 2010 to May 2011 in Peking University First Hospital were included. They all met the criteria for atypical hemolytic uremic syndrome and with positive serum anti factor H antibody. They aged from 5 to 11 yr. Data on clinical manifestations, renal pathology, treatment and prognosis were analyzed.</p><p><b>RESULT</b>All of the 4 cases had gastrointestinal symptoms such as vomiting, abdominal pain, or abdominal distension. None of them had diarrhea. Two children had hypertension. One child had episodes of convulsion. One child had history of atypical hemolytic uremic syndrome. All of them had low serum complement C3. Three of them had low serum factor H (38.0, 88.4, 209.4 mg/L). All of them had serum antibody to factor H (1: 7 068, 1: 1 110, 1: 174, and 1: 869). Three of them received renal biopsy, all of them showed thrombotic microangiopathy. All of them were treated with steroid combined with mycophenolate mofetil. Two children received plasma exchange. They were followed up for 8 to 29 months. The renal function became normal and proteinuria relieved in all of them. The serum factor H concentration increased to 405.8, 155.8 and 438.4 mg/L, respectively. The titer of anti factor H antibody decreased to 1: 119, 1: 170, 1: 123, and 1: 674, respectively.</p><p><b>CONCLUSION</b>Gastrointestinal symptom is common in children with atypical hemolytic uremic syndrome associated with H factor antibody. Hypocomplementemia was observed in all of them. Steroid combined with mycophenolate mofetil seemed to be effective for them. The monitoring of serum factor H and antibody to factor H may help diagnosis and treatment.</p>

Effect of fibrocystin on the proliferation of kidney cyst epithelial cells in autosomal recessive polycystic kidney disease / 中华肾脏病杂志

Objective To explore whether the inhibited expression of fibrocystin by RNA interference can increase epidermal growth factor (EGF)-induced cell proliferation and its possible mechanism . Methods A stable PKHD1-silenced HEK 293 cell line was established . Cell proliferation rate, intracellular Ca2+ concentration and extracellular signal-reguhted kinase 1/2(ERK1/2) activity were assessed after treatment with EGF, verapamil and Bay K8644 . Results The proliferation rate of PKHD1-silenced HEK-293 cells was found to be significantly higher after EGF stimulation compared to the control HEK 293 cell (231 .5% vs 152 .8%, P＜0 .01) . PKHD1-silencing lowered the intracellular Ca2+ concentration and caused EGF-induced ERK1/2 overactivation in the cells(P＜0 .01 ) . When cells were treated with verapamil for 4 hours to lower the intracellular Ca2+ concentration, the cell proliferation rate was significantly increased after 20 ng EGF for 24 hours . The verapamil treatment increased the level of activated ERK1/2 in EGF-treated cells . An increase of intracellular Ca2 + in PKHD1-silenced ceils repressed the EGF-dependent ERK1/2 activation and the hyperproliferative response to EGF stimulation . Conclusions Inhibition of fibrocystin can cause EGF-induced excessive proliferation through decreasing intracellular Ca2+ resulting in EGF-induced ERK1/2 activation . The loss of fibrocystin may lead to abnormal proliferation in kidney epithelial cells and cyst formation in ARPKD through modulation of intracellular Ca2+ concentration .

Relationship between podocyte molecule’s distribution and expression,foot process morphology and proteinuria / 北京大学学报(医学版)

Objective: To investigate the association between nephrin, podocin and ? actinin of the glomerular podocyte molecules, the morphometric change of podocyte foot process and the development of proteinuria. Methods: Puromycin aminonucleoside (PAN) nephrosis was established. Immunofluorescence staining, image analysis and real time quantitative PCR were employed to study the distribution and quantitation of glomerular expression of nephrin, podocin and ? actinin. Morphometric methods were applied to evaluate the morphology change of podocyte foot processes under electron microscopy. Results: (1) Before the onset of proteinuria, 2 days after PAN injection, the podocyte foot process became swollen;nephrin and podocin staining were changed into discontinuous pattern accompanied by the decrease of podocin staining intensity. The foot process became more swollen on day 5,and podocin intensity continued to decrease. Meanwhile, nephrin decreased significantly both in protein intensity and at mRNA level. (2) When heavy proteinuria [(130.8?30.7) mg/d, P =0.02]occurred, complete effacement of podocyte foot processes was revealed; both podocin and nephrin staining intensity decreased dramatically( P

Analysis of glucocorticoid receptor gene polymorphisms by denaturing high-performance liquid chromatography / 北京大学学报(医学版)

G) was relatively rare. Conclusion: DHPLC is a rapid and reliable method for polymorphism screening. Eight polymorphisms in the NR3C1 gene are detected in Chinese population with the technique of DHPLC , of which two haplotypes have been identified for the first time.

Effects of lipopolysaccharide and interleukin 1 receptor antagonist on proliferation and nitric oxide synthesis of mesangial cells / 中国病理生理杂志

AIM: To investigate the effects of Lipopolysaccharide(LPS) and interleukin 1 receptor antagonist(IL-1ra) on mesangial cells proliferation and nitric oxide synthesis. METHODS: Glomerular mesangial cells from SD rats were cultured. The first and second passages of cultured cells were used for the experiment. LPS and LPS plus IL-1ra were added in cell cultures, respectively. By using chemical method the nitrite in supernatants was measured,3H-TdR incorporation was determined to evaluate the GMC proliferation. Northern and slot hybridizations were performed to detect the expression of iNOS mRNA. RESULTS: There were expression of iNOS mRNA, more production of nitrite(0.64?0.25 vs 0.12?0.06 nmol/104 cell) in supernatants and GMC proliferation(3735?1177.9 vs 1785?280.6) in LPS group compared to the control. While compared with LPS group, in LPS+IL-1ra GMC group, expression of iNOS mRNA decreased by 40%, nitrite increased(3.28?0.33 nmol/104 cell), proliferation of GMC decreased (818?77.27). CONCLUSION: LPS could activate the GMC to express iNOS mRNA and produce more nitrite. IL-1ra could partially inhibit the effects of LPS on the expression of iNOS mRNA in GMC, but not nitrite. There is no synchronous correlation between NO production and GMC proliferation.

Effects of lipopolysaccharide and interleukin 1 receptor antagonist on proliferation and nitric oxide synthesis of mesangial cells / 中国病理生理杂志

AIM: To investigate the effects of Lipopolysaccharide(LPS) and interieukin 1 receptor antagonist (IL- 1ra) on mesangial cells proliferation and nitric oxide synthesis. METHODS: Glomerular mesangial cells from SD rats were cultured. The first and second passages of cultured cells were used for the experiment. LPS and LPS plus IL- 1ra were added in cell cultures, respectively. By using chemical method the nitrite in supernatants was measured ,3H- TaR incorporation was determined to evaluate the GMC proliferation. Northern and slot hybridizations were performed to detect the expression of iNOS mRNA. RESULTS: There were expression of iNOS mRNA, more production of nitrite(0.64 + 0.25 vs 0. 12 + 0.06 nmol/104 cell) in supernatants and GMC proliferation(3735 + 1177.9 vs 1785 + 280.6) in LPS group compared to the control. While compared with LPS group, in LPS + IL- 1ra GMC group, expression of iNOS mRNA decreased by 40%, nitrite increased(3.28 + 0.33 nmol/104 cell), proliferation of GMC decreased (818 + 77.27). CONCLUSION: LPS could activate the GMC to express iNOS mRNA and produce more nitrite. IL - 1ra could partially inhibit the effects of LPS on the expression of iNOS mRNA in GMC, but not nitrite. There is no synchronous correlation between NO production and GMC proliferation.

Relationship between genotype and phenotype in Alport syndrome: analysis at ?5 (Ⅳ) chain mRNA level / 中华肾脏病杂志

Objective To analyze type IV collagen a5 chain mRNA and to study the relationship between genotype and phenotype in X-linked Alport syndrome. Methods Total RNA was isolated from the cultured skin fibroblasts of 21 unrelated Chinese X-linked Alport syndrome patients (17 males and 4 females),then ?5 chain (Ⅳ) mRNA was analyzed by using reverse-transcription-polymerase reaction (RT-PCR) and direct sequencing. Meanwhile,by using PCR and direct sequencing,detection of COL4A5 gene mutations at genomic DNA level was carried out. Results Abnormal ?5 chain IV cDNA was detected in 21 X-linked Alport syndrome patients,and seventeen mutations detected in this study were novel mutations. In 15/21 of patients,identical COL4A5 mutations were detected both at mRNA level and genomic DNA level,and in 6/21 of patients with splicing-site mutations,changes in transcript structure differed from changes in genomic DNA level. 16/21 of patients belonged to X-linked juvenile kindreds,and 2/21 of patients to adult kindreds. Conclusion Different type of mutations in COL4A5 can lead to the severe form of X-linked Alport syndrome,and mRNA-based procedures can both directly detect mutations in the coding sequences,as well as changes in transcript level or structure,and can identify some abnormalities that would otherwise have been missed by DNA-based procedures.

Relationship between expression of nephrin, podocin and ? actinin with proteinuria in puromycin aminonucleoside nephrosis rats / 中华肾脏病杂志

Objective To study the expression of nephrin, podocin and ? actinin in glomeruli in puromycin aminonucleoside (PAN) nephrosis rat,and to disclose the possible association of these molecules with the development of proteinuria and the relation among these molecules′changes. Methods PAN nephrosis rat models were established by a single intraperitoneal injection of PAN. Indirect immunofluorescence (IF) staining and real time quantitative reverse PCR were used to study the expression of nephrin, podocin and ? actinin in glomeruli of model rats at 12 hours, 1 day, 36 hours,2 days, 5 days, 10 days, 15 days and 20 days after PAN injection. Results (1)In PAN rats, the urinary protein reached the peak level (P=0 02) at the 10th day and decreased back to control level at the 20th day. (2)The IF intensity of podocin decreased significantly at the 36th hr (P=0 04), the 2nd day(P=0 03), the 5th day(P=0 04) and the 10th day(P=0 006),while at the 15th day,the intensity began to recover (P=0 007)and reached to the control level at the 20th day. The distribution of podocin showed a linear pattern along the glomerular capillary wall (GCW) in control rats and discontinuous in PAN rats. (3)The intensity of nephrin staining decreased significantly at the 5th day (P=0 002), 10th day (P=0 007) and began to recover at the 15th day (P=0 04), while still abnormal at the 20th day(P=0 02). The distribution of nephrin in control rats showed a linear pattern along the GCW whereas a discontinuous pattern in PAN rats from the first day throughout the course. (4)The intensity of ? actinin in PAN rats increased significantly at the 20th day(P=0 009) accompanied by the increase of area ratio (P=0 007). (5)The mRNA of nephrin decreased(P =0 02)at the 5th day and recover at the 10th day. Conclusions Nephrin and podocin change prior to the presence of heavy proteinuria, which suggests their causative effects to proteinuria in PAN nephrosis. The distribution changes of nephrin and podocin occurre before the decrease of their expression level and seem to be an initial trigger factor of proteinuria. The significant decrease and recovery of podocin presents earlier than those of nephrin.The proteinuria level is correlated with the expression of podocin and nephrin.

Renal Impairment in One Child with Long - Standing Cyanotic Congenital Heart Disease and Literature Review / 实用儿科临床杂志

Objective To improve the recognition of renal impairment with long- standing cyanotic congenital heart disease, to avoid occurrence of renal impairment before and after cardiac surgery. Methods The clinical, laboratory data and treatment course of renal impairment in one child with long - standing cyanotic congenital heart disease were investigated in this study, and the related literature were reviewed Results After 10 years of cyanotic congenital heart disease course, this child presented with nephritic syndrome, renal dysfunction, hyperuricaemia, secondary polycythaemia. After loosen the limitation on fluid intake,decrease the blood viscosity and urine protein,the child was transferred to other hospital for cardiac surgery. Conclusions Children with long- standing cyanotic congenital heart disease can lead to renal impairment, we must pay attention to renal impairment to decrease incidence of acute renal failure after cardiac surgery.