Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 597
Filter
1.
Chinese Journal of Oncology ; (12): 464-470, 2023.
Article in Chinese | WPRIM | ID: wpr-984745

ABSTRACT

Conventional tumor culture models include two-dimensional tumor cell cultures and xenograft models. The former has disadvantages including lack of tumor heterogeneity and poor clinical relevance, while the latter are limited by the slow growth, low engraftment successful rate, and high cost. In recent years, in vitro three-dimensional (3D) tumor models have emerged as the tool to better recapitulate the spatial structure and the in vivo environment of tumors. In addition, they preserve the pathological and genetic features of tumor cells and reflect the complex intracellular and extracellular interactions of tumors, which have become a powerful tool for investigating the tumor mechanism, drug screening, and personalized cancer treatment. 3D tumor model technologies such as spheroids, organoids, and microfluidic devices are maturing. Application of new technologies such as co-culture, 3D bioprinting, and air-liquid interface has further improved the clinical relevance of the models. Some models recapitulate the tumor microenvironment, and some can even reconstitute endogenous immune components and microvasculature. In recent years, some scholars have combined xenograft models with organoid technology to develop matched in vivo/in vitro model biobanks, giving full play to the advantages of the two technologies, and providing an ideal research platform for individualized precision therapy for specific molecular targets in certain subtypes of tumors. So far, the above technologies have been widely applied in the field of colorectal cancer research. Our research team is currently studying upon the application of patient-derived tumor cell-like clusters, a self-assembly 3D tumor model, in guiding the selection of postoperative chemotherapy regimens for colorectal cancer. A high modeling success rate and satisfactory results in the drug screening experiments have been achieved. There is no doubt that with the advancement of related technologies, 3D tumor models will play an increasingly important role in the research and clinical practice of colorectal cancer.


Subject(s)
Humans , Organoids/pathology , Cell Culture Techniques , Colorectal Neoplasms/pathology , Tumor Microenvironment
2.
Chinese Journal of Oncology ; (12): 340-347, 2023.
Article in Chinese | WPRIM | ID: wpr-984728

ABSTRACT

Objective: To investigate the clinicopathological features and prognostic factors of lung metastasis in patients with cervical cancer after treatment. Methods: The clinicopathological data of 191 patients with lung metastasis of stage Ⅰa-Ⅲb cervical cancer (FIGO 2009 stage) treated in Sichuan Cancer Hospital from January 2007 to December 2020 were analyzed retrospectively. Kaplan Meier method and Log rank test were used for survival analysis, and Cox regression model was used for prognostic factors analysis. Results: Among 191 patients with lung metastasis of cervical cancer, pulmonary metastasis was found in 134 patients (70.2%) during follow-up examination, and 57 patients (29.8%) had clinical symptoms (cough, chest pain, shortness of breath, hemoptysis, and fever). The time from the initial treatment of cervical cancer to the discovery of lung metastasis was 1-144 months in the whole group, with a median time of 19 months. Univariate analysis of the prognosis of lung metastasis after treatment of cervical cancer showed that the diameter of cervical tumor, lymph node metastasis, positive surgical margin, disease-free interval after treatment of cervical cancer, whether it is accompanied by other metastasis, the number, location and maximum diameter of lung metastasis, and the treatment method after lung metastasis are related to the prognosis of patients with lung metastasis of cervical cancer. Multivariate analysis showed that the number of lung metastases and other site metastases in addition to lung metastases were independent factors affecting the prognosis of patients with lung metastases of cervical cancer (P<0.05). Conclusions: For patients with cervical cancer, attention should be paid to chest CT examination during follow-up to guard against the possibility of lung metastasis after treatment. Besides lung metastasis, other site metastasis and the number of lung metastasis are independent factors affecting the prognosis of patients with lung metastasis of cervical cancer. For patients with lung metastasis after treatment of cervical cancer, surgical treatment is an effective treatment. It is necessary to strictly grasp the surgical indications, and some patients can achieve long-term survival. For patients with lung metastasis of cervical cancer who are not suitable for resection of lung metastasis, the remedial treatment of chemotherapy with or without radiotherapy is still a recommended choice.


Subject(s)
Female , Humans , Prognosis , Uterine Cervical Neoplasms/pathology , Neoplasm Staging , Retrospective Studies , Lung Neoplasms/pathology , Survival Rate
3.
Journal of Modern Urology ; (12): 153-156, 2023.
Article in Chinese | WPRIM | ID: wpr-1006105

ABSTRACT

【Objective】 To investigate the current status of incision sites to obtain intact specimens in laparoscopic nephrectomy by urologists in China, so as to provide reference for the standardized procedure. 【Methods】 During Jun.20, 2021 and Jul.4, 2021, more than 20 000 urologists in a WeChat group were surveyed with a questionnaire. The general data, incision sites and related complications were statistically analyzed. 【Results】 A total of 601 valid questionnaires were collected, covering urologists from 31 provinces, autonomous regions and municipalities. Surgical approaches: 68 urologists chose trans-abdominal approach, 432 chose posterior abdominal space approach, 101 chose both surgical approaches. Incision sites: 97 urologists chose lumbar transverse incision, 202 chose dorsal oblique incision of the waist, 119 chose ventral oblique incision, 93 chose the paramedian incision, 112 chose the lower abdominal oblique incision (Gibson), 11 chose the transverse lower abdominal incision (Pfannenstiel), 7 chose the median incision of the lower abdomen, 2 chose the median incision in the upper abdomen, 15 chose axillary midline direct incision; 399 chose to cut off the muscles, and 202 chose not to. Complications: 232 urologists reported pain after 2 weeks, 369 reported no pain; 325 reported numbness after 2 weeks, 276 reported no numbness; 66 reported incisional hernia, 535 reported no hernia. 【Conclusions】 Chinese urologists tend to choose retroperitoneoscopic nephrectomy and waist incision to obtain intact specimens. Transperitoneal laparoscopic nephrectomy has a variety of incisions for intact specimens. There is no standardized incision sites to obtain intact specimens.

4.
International Eye Science ; (12): 2087-2091, 2023.
Article in Chinese | WPRIM | ID: wpr-998495

ABSTRACT

AIM: To compare the clinical efficacy of the Balanced energy system versus the conventional torsional ultrasound system in phacoemulsification surgeries for cataracts with varying nuclear hardness.METHODS: In this study, 120 patients(122 eyes)with age-related cataracts scheduled for surgery between November 2021 and November 2022 at our hospital were randomly divided into two groups: 58 patients(59 eyes)in the experimental group underwent surgery using the Balanced energy system, while 62 patients(63 eyes)in the control group were treated with the conventional torsional ultrasound system. Intraoperative cumulative dissipated energy(CDE), case time(CT), aspiration time(AST), and estimated fluid used(EFU)were recorded. Patients were followed-up for 3mo to examine and record the best-corrected visual acuity(BCVA)and corneal endothelial cell density(ECD), and to calculate the rate of endothelial cell loss.RESULTS: Comparing the intraoperative parameters between the two groups, there was no significant difference in CT(P&#x003E;0.05), but the CDE, AST and EFU of the patients in the experimental group were lower than those of the control group(P&#x003C;0.05), and the CDE of patients with grade III nuclear hardness in the experimental group was lower than the control group(P&#x003C;0.05), CDE, AST and EFU in patients with grade IV nuclear hardness were lower than those in the control group(P&#x003C;0.05). After 3mo of follow-up, BCVA in both groups improved significantly, and the experimental group recovered faster than the control group. At 3mo after surgery, the ECD of the two groups of patients was reduced compared with that before surgery(P&#x003C;0.01), but there were no significant differences in ECD and endothelial cell loss rates between the experimental and control groups before and at 3mo after surgery(P&#x003E;0.05). In grade IV nuclear hardness cataracts, the rate of endothelial cell loss in the experimental group was significantly lower than that in the control group(4.63%±4.10% vs. 6.63%±4.49%, P&#x003C;0.01).CONCLUSION: The Balanced energy system and the conventional torsional ultrasound system both show high safety and efficiency in phacoemulsification of cataracts with different nuclear hardness. However, the former demonstrates substantial advantages in cases with dense nuclei, offering lower ultrasound energy, shorter aspiration and infusion times, and reduced volume of infusion fluid.

5.
Chinese Journal of Rehabilitation Theory and Practice ; (12): 833-838, 2023.
Article in Chinese | WPRIM | ID: wpr-998250

ABSTRACT

ObjectiveTo observe the clinical effect of hand controlled rhythm music therapy on unilateral spatial neglect for stroke patients. MethodsFrom September, 2020 to September, 2022, 52 patients with unilateral spatial neglect after stroke in Wuxi Central Rehabilitation Hospital were randomly divided into control group (n = 26) and observation group (n = 26). Both groups accepted routine rehabilitation, and the observation group accepted hand controlled rhythm music therapy in addition, for eight weeks. Before and after treatment, the patients were assessed with Chinese Behavioral Inattention Test-Hong Kong version (CBIT-HK) routine tests (line crossing, letter cancellation, star cancellation, line bisection, figure and shape copying, and representational drawing) and modified Barthel Index (MBI). ResultsAfter treatment, six scores of CBIT-HK routine tests and the scores of MBI increased in both groups (|t| > 3.077, P < 0.05), and they were higher in the observation group than in the control group (|t| > 2.639, P < 0.05). ConclusionHand controlled rhythm music therapy could effectively alleviate the symptoms of unilateral spatial neglect after stroke, and improve the activities of daily living.

6.
Chinese Journal of Neurology ; (12): 646-653, 2023.
Article in Chinese | WPRIM | ID: wpr-994876

ABSTRACT

Objective:To compare the gait characteristics of cognitive and motor dual task walking (DTW) in patients with cerebral small vessel disease (CSVD), and determine the best gait parameters to diagnose CSVD and judge the severity of the disease.Methods:A total of 106 patients with CSVD and 21 healthy individuals were included from September 1, 2020 to July 1, 2021 in the Seventh Medical Center of Chinese People′s Liberation Army General Hospital. According to the Fazekas scores, the subjects were divided into mild ( n=34, 1 point), moderate ( n=34, 2 points), severe ( n=38,3 points) groups and control group ( n=21). Participants were recorded parameters under single task walking (STW) and DTW conditions, and calculated dual task effect (DTC) through the difference between single task and dual task. The differences in gait variances and their DTC were shown by generalized estimation equations when performed in STW and DTW and 4 groups of the severity of disease. Post-hoc comparisons were corrected using Bonferroni′s method. Spearman analyses were applied to explore the correlations between gait parameters and their DTC during STW or DTW and severity of disease. Based on the Logistic model, combining predictors or probabilities were gained and applied to establish receiver operating characteristic curve in order to calculate sensitivity, specificity, and the area under the curve. Results:In the control group, there was no statistically significant difference in gait parameters between STW and DTW. In the CSVD group, the gait parameters of STW were significantly better than cognitive or motor DTW (all P<0.05). In the control group, there was no statistically significant difference in basic gait parameters under different tasks (all P>0.05). In cognitive DTW, temporal gait parameters (stride frequency and stride time) deteriorated significantly only in moderate and severe groups [stride frequency:moderate group 100.220±1.795/min,severe group 94.525±2.139/min;stride time:moderate group (1.227±0.024) s, severe group (1.299±0.031) s], but spatial parameters [stride length: control group (1.050±0.021) m, mild group (0.974±0.022) m, moderate group (0.903±0.025) m, severe group (0.793±0.026) m; stride speed: control group (0.944±0.028) m/s, mild group (0.866±0.030) m/s, moderate group (0.751±0.027) m/s, severe group (0.606±0.022) m/s] were significantly different among all groups (except the control group and mild group;all P<0.05). The DTC of all gait parameters during cognitive DTW was higher than that during motor DTW (all P<0.05) for CSVD patients. While no any difference was found between cognitive DTW and motor DTW in the control group (all P>0.05). Similarly, the temporal parameters′ DTC of cognitive DTW was abnormal only in the late stage of disease, while the spatial parameters′ DTC showed statistically significant difference among all the groups (including the control group and the mild group;all P<0.05). Correlation coefficients of the spatial parameters and their DTC in condition of cognitive DTW were significantly higher than temporal parameters and their DTC (0.50< r<0.64 vs 0.15< r<0.39). The area under curve of the combined predictor was significantly higher than that of any single index. Conclusions:Cognitive DTW can better reflect the abnormal gait of CSVD patients. The spatial parameters and DTC of cognitive DTW could effectively diagnose CSVD and distinguish the disease of severity. And DTC might be better indicators. For diagnosis of CSVD, there was no significant discrepancy between the spatial parameters and DTC, but the combined predictor could significantly improve the sensitivity and reduce the false negative rate.

7.
Chinese Journal of Internal Medicine ; (12): 232-236, 2023.
Article in Chinese | WPRIM | ID: wpr-994401

ABSTRACT

A male child, aged 5 years and 3 months, was admitted to the Oncology Department with a history of pain in both hip joints, headache, and diplopia lasting for 40 days. Physical examination did not reveal definitive signs or obvious abnormalities in the nervous system. Imaging studies showed only abnormalities in the craniocerebrum and spinal cord. Routine cerebrospinal fluid (CSF) analysis revealed elevation in the total number of white blood cells, mainly mononuclear cells. Biochemical analysis of CSF showed normal glucose and chloride levels, and increased protein concentrations. The possibility of central nervous system (CNS) infection was initially considered. Subsequently, antibacterial and antiviral therapy was administered; however, this treatment was ineffective. Further examination of CSF through immunophenotyping revealed mature B-cell lymphoma with CNS involvement; there were no neoplastic lesions detected elsewhere in the body. Thus, the patient was diagnosed with primary central nervous system lymphoma (PCNSL). Complete remission was achieved after chemotherapy with the CNCL-2017-mature B-cell lymphoma regimen. Thus far, all chemotherapy cycles have been completed, the patient remains in complete remission, and the follow-up is ongoing. Clinicians should pay close attention to PCNSL in children.

8.
Journal of Peking University(Health Sciences) ; (6): 149-155, 2023.
Article in Chinese | WPRIM | ID: wpr-971288

ABSTRACT

OBJECTIVE@#To evaluate the implications of the prognostic nutrition index (PNI) in non-metastatic renal cell carcinoma (RCC) patients treated with surgery and to compare it with other hematological biomarkers, including neutrophil to lymphocyte ratio (NLR), platelet to lymphocyte ratio (PLR), and systemic immune inflammation index (SII).@*METHODS@#A cohort of 328 non-metastatic RCC patients who received surgical treatment between 2010 and 2012 at Peking University First Hospital was analyzed retrospectively. Receiver operating characteristic (ROC) curve analysis was used to determine the optimal cutoff values of the hematological biomarkers. The Youden index was maximum for PNI was value of 47.3. So we divided the patients into two groups (PNI≤ 47. 3 and >47. 3) for further analysis. Categorical variables [age, gender, body mass index (BMI), surgery type, histological subtype, necrosis, pathological T stage and tumor grade] were compared using the Chi-square test and Student' s t test. The association of the biomarkers with overall survival (OS) and disease-free survival (DFS) was analyzed using Kaplan-Meier methods with log-rank test, followed by multivariate Cox proportional hazards model.@*RESULTS@#According to the maximum Youden index of ROC curve, the best cut-off value of PNI is 47. 3. Low level of PNI was significantly associated with older age, lower BMI and higher tumor pathological T stage (P < 0.05). Kaplan-Meier univariate analysis showed that lower PNI was significantly correlated with poor OS and DFS (P < 0.05). In addition, older age, lower BMI, tumor necrosis, higher tumor pathological T stage and Fuhrman grade were significantly correlated with poor OS (P < 0.05). Cox multivariate analysis showed that among the four hematological indexes, only PNI was an independent factor significantly associated with OS, whether as a continuous variable (HR=0.9, 95%CI=0.828-0.978, P=0.013) or a classified variable (HR=2.397, 95%CI=1.061-5.418, P=0.036).@*CONCLUSION@#Low PNI was a significant predictor for advanced pathological T stage, decreased OS, or DFS in non-metastatic RCC patients treated with surgery. In addition, PNI was superior to the other hematological biomar-kers as a useful tool for predicting prognosis of RCC in our study. It should be externally validated in future research before the PNI can be used widely as a predictor of RCC patients undergoing nephrectomy.


Subject(s)
Humans , Prognosis , Nutrition Assessment , Carcinoma, Renal Cell/surgery , Retrospective Studies , Biomarkers , Kidney Neoplasms/pathology
9.
Chinese Acupuncture & Moxibustion ; (12): 762-765, 2023.
Article in Chinese | WPRIM | ID: wpr-980792

ABSTRACT

OBJECTIVE@#To observe the clinical efficacy of moxibustion combined with coptis chinensis ointment sealing on plaque psoriasis complicated with obesity.@*METHODS@#A total of 52 patients of plaque psoriasis complicated with obesity were randomized into an observation group (26 cases) and a control group (26 cases, 2 cases dropped off). Coptis chinensis ointment sealing was adopted in the control group. On the basis of the treatment in the control group, moxibustion was applied at ashi point (area of local target lesions), Zhongwan (CV 12) and bilateral Zusanli (ST 36), Fenglong (ST 40), Quchi (LI 11), Tianshu (ST 25), Shangjuxu (ST 37) in the observation group. The treatment was given 30 min each time, once a day for 4 weeks in both groups. The psoriasis area and severity index (PASI) score, obesity related indexes (body mass, waist circumference, body mass index [BMI]), triglyceride, cholesterol, uric acid and plasma glucose were compared before and after treatment, and the clinical efficacy was evaluated in the two groups.@*RESULTS@#After treatment, the PASI scores were decreased compared with those before treatment in the two groups (P<0.01), and the PASI score in the observation group was lower than that in the control group (P<0.05); the body mass, waist circumference, BMI, triglyceride, cholesterol, uric acid and plasma glucose were decreased compared with those before treatment in the observation group (P<0.01, P<0.05), the triglyceride and cholesterol in the observation group were lower than those in the control group (P<0.05). The total effective rate was 53.8% (14/26) in the observation group, which was superior to 20.8% (5/24) in the control group (P<0.05).@*CONCLUSION@#Moxibustion combined with coptis chinensis ointment sealing can effectively improve the clinical symptoms in patients of plaque psoriasis complicated with obesity.


Subject(s)
Humans , Moxibustion , Blood Glucose , Ointments , Uric Acid , Psoriasis/therapy , Triglycerides , Obesity/therapy
10.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 274-282, 2023.
Article in Chinese | WPRIM | ID: wpr-979474

ABSTRACT

Sepsis is a systemic inflammatory syndrome induced by infection and other factors, with the number of patients worldwide exceeding 10 million each year. The pathophysiological mechanism is of this disease complex. Sepsis is often accompanied by endotoxin translocation, gastrointestinal dysfunction, inflammatory cytokine activation, immune dysregulation, coagulation disorder, multiple organ function impairment and many other body imbalances, as well as systemic inflammation, apoptosis, oxidative stress injury and other cell damage mechanisms. This disease causes a heavy medical burden due to the difficult diagnosis and treatment and the poor prognosis. Great progress has been achieved in the diagnosis and treatment of sepsis with traditional Chinese medicine (TCM) and western medicine. The value of western medicine in the diagnosis and treatment of sepsis is limited due to antibiotic resistance, hormone abuse, and high medical costs. Sepsis is classified as a warm disease or typhoid fever in TCM. Da Chengqitang is a classical formula in the Treatise on Typhoid Fever to deal with the excess syndrome of Yang brightness Fu-organ. Modern medicine has proved that Da Chengqitang has the effect of inhibiting oxidative stress, reducing inflammation, and delaying apoptosis by improving gastrointestinal dynamics and regulating intestinal microecology. On the basis of the previous theoretical basis and the rich experience in the medication, medical practitioners have proposed a new therapeutic concept of using Da Chengqitang in combination with western drugs from a holistic view involving both bacteria and toxicity for treating both the symptoms and the root cause, which has a wide range of application. The article reviews the classical research and latest findings of Da Chengqitang in the treatment of sepsis, with a view to clarifying the mechanism and advantages of this formula in the adjuvant treatment of sepsis, exploring its potential efficacy, and providing timely, adequate, and scientific theoretical support for the promotion of this formula in the clinical practice.

11.
Journal of Environmental and Occupational Medicine ; (12): 788-795, 2023.
Article in Chinese | WPRIM | ID: wpr-979194

ABSTRACT

Background The prevalence of osteoporosis and osteopenia is higher among underground coal miners than surface workers. The special underground work environment and unhealthy habits such as smoking, drinking, and a high-salt diet may lead to changes in bone metabolism, increasing the risk of fragility fractures and placing a heavy economic burden on individuals and society. Objective To identify potential factors influencing fragility fractures among coal miners in different working environments and to provide a basis for targeted preventive measures to reduce the occurrence of fragility fractures. Methods Male participants who attended at least one of the physical examinations in Kailuan Group between June 2006 and December 2020 were included in the study. The participants were divided into two groups based on their working environment: surface or underground. A case-control study was conducted, where patients with new fragility fractures served as the case group and participants without fragility fractures served as the control group. The two groups were matched with a case:control ratio of 1:4 by age (±1 year) and the same year of physical examination. The matching process was repeated twice, once for the surface working population and once for the underground working population. The analysis of risk factors was conducted using conditional logistic regression models. Results Among a total of 113138 employees in Kailuan Group, 82631 surface workers and 30507 underground workers were included, respectively. The number of individuals who suffered fragility fractures was 1375, accounting for 1.22% of the total population. The incidence of fragility fractures in underground workers was significantly higher than that in surface workers (1.63%>1.07%, P<0.001). The results of conditional logistic regression model showed that current smoking (OR=1.26, 95%CI: 1.05, 1.51), manual labor (OR=1.37, 95%CI: 1.06, 1.78), diabetes (OR=1.26, 95%CI: 1.04, 1.54), sinus tachycardia (OR=1.81, 95%CI: 1.23, 2.66), history of stroke (OR=1.51, 95%CI: 1.09, 2.09), education at college and above (OR=0.65, 95%CI: 0.45, 0.95), high income level (OR=0.69, 95%CI: 0.54, 0.90), elevated hemoglobin (OR=0.91, 95%CI: 0.85, 0.98), and elevated total cholesterol (OR=0.90, 95%CI: 0.82, 0.99) were associated with fragility fractures in the surface working population of coal mines; current smoking (OR=1.48, 95%CI: 1.17, 1.87), current drinking (OR=1.26, 95%CI: 1.01, 1.56), manual labor (OR=2.64, 95%CI: 1.41, 4.94), history of dust exposure (OR=1.28, 95%CI: 1.03, 1.58), and obesity (OR=0.72, 95%CI: 0.52, 0.96) were associated with fragility fractures in the underground working population of coal mines. Conclusion In preventing fragility fractures, special attention should be paid to the bone health of underground workers engaged in manual labor or having a history of dust exposure. It is important to correct their unhealthy behaviors in a timely manner, such as smoking and drinking, and to appropriately increase body weight to prevent fragility fractures. For surface workers, particular attention should be given to the high-risk group for fragility fractures, such as low family income per capita, manual labor, and having a history of stroke or diabetes; in addition, close monitoring of their resting heart rate, hemoglobin levels, and total cholesterol levels may help prevent fragility fractures.

12.
Acta Pharmaceutica Sinica ; (12): 1441-1451, 2023.
Article in Chinese | WPRIM | ID: wpr-978735

ABSTRACT

We used network pharmacology to predict the mechanism in the treatment of rheumatoid arthritis (RA) via modified Gan Cao Fu Zi Decoction (GCFZ), and validated the results of the analysis and explored the pharmacodynamic effects of GCFZ through animal experiments. Firstly, TCMID, SymMap, HERB, STITCH and GEO databases were utilized to obtain the target genes of GCFZ for the treatment of RA, which yielded a total of 1 250 differentially expressed genes for RA, 534 genes for GCFZ targets and 83 intersecting genes. Then functional enrichment analysis of the intersecting genes was performed through GO and KEGG databases, and the results revealed that GCFZ and its active ingredients mainly functioned through cytokine pathways, where chemokine signaling pathway and tumor necrosis factor (TNF) signaling pathway were enriched with a high number of genes. Cytoscape 3.8.0 software was used to construct the drug-target-disease network and screen key proteins, which included TNF, C-X-C chemokine ligand 8 (CXCL8), C-X-C chemokine ligand 10 (CXCL10), C-C chemokine ligand 5 (CCL5), C-X-C chemokine ligand 2 (CXCL2) and C-X-C chemokine receptor type 4 (CXCR4). The molecular docking technology was used to confirm the binding ability of the main active ingredients of GCFZ to the core proteins. Additionally, the therapeutic effects of GCFZ in low (4 g·kg-1), medium (8 g·kg-1) and high (16 g·kg-1) dose groups were investigated by constructing the collagen-induced arthritis (CIA) rat model. X-ray imaging approach, HE staining and Safranin O-Fast Green staining showed that GCFZ treatment significantly improved bone destruction, synovial hyperplasia and cartilage damage in CIA rats, while immunofluorescence results showed that GCFZ treatment could regulate the expression of TNF, CXCL8 and CCL5. In summary, our results indicate that GCFZ contains a variety of small molecule pharmacodynamic substances, which can exert therapeutic effects via multiple targets and pathways, and obviously reduce the symptoms of arthritis in CIA rats. This animal experiment of our research was approved by the Experimental Animal Management and Ethics Committee of Bengbu Medical College.

13.
Journal of Integrative Medicine ; (12): 205-214, 2023.
Article in English | WPRIM | ID: wpr-971654

ABSTRACT

OBJECTIVE@#Anxiety is one of the most common symptoms associated with autistic spectrum disorder. The essential oil of Cananga odorata (Lam.) Hook. f. & Thomson, usually known as ylang-ylang oil (YYO), is often used in aromatherapy as a mood-regulating agent, sedative, or hypotensive agent. In the present study, the effects and mechanisms of YYO in alleviating anxiety, social and cognitive behaviors in autism-like rats were investigated.@*METHODS@#The prenatal valproic acid (VPA) model was used to induce autism-like behaviors in offspring rats. The effectiveness of prenatal sodium valproate treatment (600 mg/kg) on offspring was shown by postnatal growth observation, and negative geotaxis, olfactory discrimination and Morris water maze (MWM) tests. Then three treatment groups were formed with varying exposure to atomized YYO to explore the effects of YYO on the anxiety, social and cognitive behaviors of the autistic-like offspring through the elevated plus-maze test, three-chamber social test, and MWM test. Finally, the monoamine neurotransmitters, including serotonin, dopamine and their metabolites, in the hippocampus and prefrontal cortex (PFC) of the rats were measured using a high-performance liquid chromatography.@*RESULTS@#Offspring of VPA exposure rats showed autism-like behaviors. In the VPA offspring, medium-dose YYO exposure significantly elevated the time and entries into the open arms in the elevated plus-maze test, while low-dose YYO exposure significantly enhanced the social interaction time with the stranger rat in session 1 of the three-chamber social test. VPA offspring treated with YYO exposure used less time to reach the platform in the navigation test of the MWM test. YYO exposure significantly elevated the metabolism of serotonin and dopamine in the PFC of VPA offspring.@*CONCLUSION@#YYO exposure showed the effects in alleviating anxiety and improving cognitive and social abilities in the offspring of VPA exposure rats. The role of YYO was related to the regulation of the metabolism of serotonin and dopamine. Please cite this article as: Zhang N, Wang ST, Yao L. Inhalation of Cananga odorata essential oil relieves anxiety behaviors in autism-like rats via regulation of serotonin and dopamine metabolism. J Integr Med. 2023; 21(2): 205-214.


Subject(s)
Pregnancy , Female , Rats , Animals , Autistic Disorder/drug therapy , Oils, Volatile/therapeutic use , Serotonin/metabolism , Cananga/metabolism , Dopamine , Anxiety/drug therapy , Valproic Acid/pharmacology , Plant Oils , Disease Models, Animal
14.
Chinese Journal of Applied Clinical Pediatrics ; (24): 457-460, 2023.
Article in Chinese | WPRIM | ID: wpr-990060

ABSTRACT

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

15.
Journal of International Oncology ; (12): 362-367, 2023.
Article in Chinese | WPRIM | ID: wpr-989572

ABSTRACT

Compared with single therapy, radiotherapy combined with chemotherapy, endocrine therapy, molecular targeted therapy and immunological therapy can not only shorten the treatment cycle, but also improve the local control rate and prolong the survival of patients. However, the safety of combined therapy still needs to be further clarified to comprehensively evaluate the feasibility. Therefore, exploring the efficacy and safety of radiotherapy combined with systematic therapy will provide evidence for clinical benefits.

16.
Journal of Leukemia & Lymphoma ; (12): 109-113, 2023.
Article in Chinese | WPRIM | ID: wpr-988962

ABSTRACT

Objective:To explore the clinical features of childhood lymphoma complicated with Pneumocystis jirovecii pneumonia (PJP).Methods:The clinical data, diagnosis and treatment of 5 children with lymphoma complicated with PJP admitted to Beijing Children's Hospital from January 2013 to April 2022 were retrospectively analyzed.Results:Among 5 patients, there were 3 males and 2 females, the median onset age was 7 years old; 4 cases were non-Hodgkin lymphoma and 1 case was Hodgkin lymphoma. Fever and cough occurred 5-18 months after chemotherapy; typical mosaic sign could be seen in 2 cases without pneumothorax and pleural effusion as well as other pathogenic infection; all 5 cases had hypoxemia; 4 cases were diagnosed by next-generation sequencing (NGS). The CD4/CD8 ratio decreased in all cases, and the median CD4 positive T-cell was 200/μl. Trimethoprim-sulfamethoxazole (TMP-SMZ) was irregularly used in 3 cases. During the treatment, all cases received mechanical ventilation, TMP-SMZ intravenously dripping combined with caspofungin, glucocorticoid and gamma globulin. All 5 cases of PJP were cured and there was no recurrent infection.Conclusions:Lymphoma children are susceptible to PJP due to immunocompromise caused by chemotherapy, and their condition progresses rapidly. When encountering fever, shortness of breath, severe lung symptoms and mild signs of children, it is necessary to improve the vigilance of PJP. NGS can help diagnosis, and TMP-SMZ should be actively treated and prevented. Early diagnosis and active treatment can achieve a good prognosis.

17.
Chinese Journal of Obstetrics and Gynecology ; (12): 368-377, 2023.
Article in Chinese | WPRIM | ID: wpr-985660

ABSTRACT

Objective: To investigate the mechanism of signal transducer and activator of transcription 3 (STAT3) and cancer associated fibroblasts (CAF) jointly generate chemo-resistance in epithelial-ovarian cancer and their effect on prognosis. Methods: A total of 119 patients with high-grade ovarian serous cancer who received surgery in Cancer Hospital of Chinese Academy of Medical Sciences from September 2009 to October 2017 were collected. The clinico-pathological data and follow-up data were complete. Multivariate Cox regression model was used to analyze the prognostic factors. Ovarian cancer tissue chips of patients in our hospital were prepared. EnVision two-step method immunohistochemistry was used to detect the protein expression levels of STAT3, the specific markers of CAF activation, fibroblast activating protein (FAP), and type Ⅰ collagen (COL1A1) secreted by CAF. The relationship between the expression of STAT3, FAP, COL1A1 protein and drug resistance and prognosis of ovarian cancer patients was analyzed, and the correlation between the expression of three proteins was analyzed. These results were verified through the gene expression and prognostic information of human ovarian cancer tissues collected in the GSE26712 dataset of gene expression omnibus (GEO) database. Results: (1) Multivariate Cox regression model analysis showed that chemotherapy resistance was an independent risk factor for overall survival (OS) of ovarian cancer (P<0.001). (2) The expression levels of STAT3, FAP, and COL1A1 proteins in chemotherapy resistant patients were significantly higher than those in chemotherapy sensitive patients (all P<0.05). Patients with high expression of STAT3, FAP, and COL1A1 had significantly shorter OS than those with low expression (all P<0.05). According to the human ovarian cancer GSE26712 dataset of GEO database, patients with high expression of STAT3, FAP, and COL1A1 also showed shorter OS than patients with low expression (all P<0.05), the verification results were consistent with the detection results of ovarian cancer patients in our hospital. (3) Correlation analysis showed that the protein level of STAT3 was positively correlated with FAP and COL1A1 in our hospital's ovarian cancer tissue chips (r=0.47, P<0.001; r=0.30, P=0.006), the analysis of GEO database GSE26712 dataset showed that the expression of STAT3 gene and FAP, COL1A1 gene were also significantly positively correlated (r=0.31, P<0.001; r=0.52, P<0.001). Conclusion: STAT3 and CAF could promote chemotherapy resistance of ovarian cancer and lead to poor prognosis.


Subject(s)
Female , Humans , Cancer-Associated Fibroblasts/pathology , Carcinoma, Ovarian Epithelial , Ovarian Neoplasms/pathology , Prognosis , STAT3 Transcription Factor/metabolism , Drug Resistance, Neoplasm
18.
Chinese Journal of Stomatology ; (12): 57-63, 2023.
Article in Chinese | WPRIM | ID: wpr-970755

ABSTRACT

Objective: To preliminarily explore the mechanism of tensile stress regulating endochondral osteogenesis of condyle by analyzing the expression profiles of significantly different microRNAs (miRNAs) in exosomes of rat mandibular condylar chondrocytes (MCC) under quiescent and cyclic tensile strain (CTS) conditions. Methods: Rat condylar chondrocytes were cultured under static and CTS conditions respectively (10 SD rats, male, 2 weeks old), and exosomes were extracted. The two groups of exosomes were named as control group and CTS group respectively. The differential expression miRNAs were screened by high-throughput sequencing. Bioinformatics analysis and prediction of target genes related to osteogenesis were performed by TargetScan and miRanda website. Results: The exosomes of rat condylar chondrocytes cultured under tensile stress showed a "double concave disc" monolayer membrane structure, the expression of CD9 and CD81 were positive, and the particle size distribution accorded with the characteristics of exosomes, which was consistent with that of static cultured rat condylar chondrocytes. A total of 85 miRNAs with significantly different expression were detected by high-throughput sequencing (P<0.05). The main biological processes and molecular functions of differential miRNAs were biological processes and protein binding, respectively. Kyoto Encyclopedia of Genes and Genomes (KEGG) database pathway enrichment analysis showed that there was significant enrichment in mammalian target of rapamycin (mTOR) signal pathway. The candidate target genes of miR-199a-5p include bone morphogenetic protein 3 (BMP3), endothelin converting enzyme 1, and miR-186-5p may target Smad8 and BMP3 to exert osteogenesis-related functions. Conclusions: Compared with static state, tensile stress stimulation can change the expression of miRNAs such as miR-199a-5p, miR-186-5p in the exocrine body of rat condylar chondrocytes, which can be considered as a mean to regulate the application potential of the exosomes.


Subject(s)
Animals , Male , Rats , Bone Morphogenetic Protein 3 , Chondrocytes/metabolism , Mandibular Condyle , MicroRNAs/metabolism , Rats, Sprague-Dawley , Signal Transduction , Stress, Mechanical
19.
China Journal of Chinese Materia Medica ; (24): 22-29, 2023.
Article in Chinese | WPRIM | ID: wpr-970497

ABSTRACT

Owing to the advancement in pharmaceutical technology, traditional Chinese medicine industry has seen rapid development. Preferring conventional manufacturing mode, pharmaceutical enterprises of traditional Chinese medicine have no effective process detection tools and process control methods. As a result, the quality of the final products mainly depends on testing and the quality is inconsistent in the same batch. Process analytical technology(PAT) for traditional Chinese medicine manufacturing, as one of the key advanced manufacturing techniques, can break through the bottleneck in quality control of medicine manufacturing, thus improving the production efficiency and product quality and reducing the material and energy consumption. It is applicable to the process control and real-time release of advanced manufacturing modes such as intelligent manufacturing and continuous manufacturing. This paper summarized the general idea of PAT for traditional Chinese medicine manufacturing. Through the analysis of the characteristics and status quo of the technology, we summed up the methodology for the continuous application and improvement of PAT during the whole life-cycle of traditional Chinese medicine. The five key procedures(process understanding, process detection, process modeling, process control, and continuous improvement) were summarized, and the application was reviewed. Finally, we proposed suggestions for the technical and regulatory challenges in implementing PAT in traditional Chinese medicine industry. This paper aims to provide a reference for development and application of PAT in advanced manufacturing, intelligent manufacturing, and continuous manufacturing of traditional Chinese medicine industry.


Subject(s)
Medicine, Chinese Traditional , Drugs, Chinese Herbal , Technology, Pharmaceutical , Drug Industry , Quality Control
20.
Biomedical and Environmental Sciences ; (12): 160-173, 2023.
Article in English | WPRIM | ID: wpr-970303

ABSTRACT

OBJECTIVE@#To provide useful information for selecting the most appropriate peripheral nerve injury model for different research purposes in nerve injury and repair studies, and to compare nerve regeneration capacity and characteristics between them.@*METHODS@#Sixty adult SD rats were randomly divided into two groups and underwent crush injury alone (group A, n = 30) or transection injury followed by surgical repair (group B, n = 30) of the right hind paw. Each group was subjected to the CatWalk test, gastrocnemius muscle evaluation, pain threshold measurement, electrophysiological examination, retrograde neuronal labeling, and quantification of nerve regeneration before and 7, 14, 21, and 28 days after injury.@*RESULTS@#Gait analysis showed that the recovery speed in group A was significantly faster than that in group B at 14 days. At 21 days, the compound muscle action potential of the gastrocnemius muscle in group A was significantly higher than that in group B, and the number of labeled motor neurons in group B was lower than that in group A. The number of new myelin sheaths and the g-ratio were higher in group A than in group B. There was a 7-day time difference in the regeneration rate between the two injury groups.@*CONCLUSION@#The regeneration of nerve fibers was rapid after crush nerve injury, whereas the transection injury was relatively slow, which provides some ideas for the selection of clinical research models.


Subject(s)
Animals , Rats , Nerve Fibers , Nerve Regeneration , Rats, Sprague-Dawley , Sciatic Nerve/injuries
SELECTION OF CITATIONS
SEARCH DETAIL