Study of resting-state functional MRI on immediate effect regulated by acupuncture on acupoints in patients with migraine without aura / 实用放射学杂志

Objective To explore the mechanism of immediate effect regulated by acupuncture on acupoints in patients with migraine without aura(MwoA)during the interictal period.Methods A total of 28 MwoA patients were enrolled and resting-state functional magnetic resonance imaging(rs-fMRI)were performed at baseline and after acupuncture for 30 minutes.Paired t test was used to compare the differences of regional homogeneity(ReHo)and voxel-mirrored homotopic connectivity(VMHC)between two groups.Additionally,the correlation between the changes of rs-fMRI indexes and clinical scores was analyzed.Results In MwoA patients after acupuncture for 30 minutes,the mean regional homogeneity(mReHo)was decreased in the right lingual gyrus and right cere-bellum and was increased in the right middle frontal gyrus,while the z transformation voxel-mirrored homotopic connectivity(zVMHC)was significantly decreased in the bilateral cuneus compared with baseline.There was no significant correlation between imaging data and clinical scales.Conclusion Patients with MwoA after acupuncture for 30 minutes show abnormal ReHo and VMHC in multiple brain regions,which suggest that the mechanism of immediate effect may act through regulating pain-related brain regions.

Analysis of factors associated with spread through air spaces(STAS) of small adenocarcinomas(≤2 cm) in peripheral stage ⅠA lungs and modeling of nomograms / 中华胸心血管外科杂志

Objective:To investigate the relationship between spread through air spaces(STAS) of peripheral stage ⅠA small adenocarcinoma of the lung(≤2 cm) and related factors such as clinical and CT morphological features, and to construct a nomogram model.Methods:Relevant clinical, pathological and imaging data of patients who underwent lung surgery and were diagnosed as peripheral stage ⅠA small lung adenocarcinoma by postoperative pathology in the Affiliated Hospital of Nantong University from 2017 to 2022 were collected, of which cases that met the inclusion criteria from 2017 to 2021 served as the training group, and those that met the inclusion criteria in 2022 served as the validation group. The independent risk factors for the occurrence of STAS in peripheral stage ⅠA lung small adenocarcinoma were investigated by using univariate analysis and multifactorial logistic regression analysis, based on which a nomogram prediction model was constructed, and the subjects were analyzed by using the receiver operating characteristic curve( ROC), correction model, etc. were used to evaluate the model. Results:A total of 430 patients who met the criteria were included, including 351 patients in the training group(109 STAS-positive and 242 STAS-negative) and 79 patients in the validation group(23 STAS-positive and 56 STAS-negative). Univariate analysis showed that the patients in the two groups showed a significant difference in age(>58 years old), gender, smoking history, tumor location(subpleural, non-subpleural), pleural pull, nodule type, nodule maximal diameter, solid component maximal diameter, consolidation tumor ratio(CTR), lobulation sign, burr sign, bronchial truncation sign, vascular sign(includes thickening and distortion of blood vessels in/around the nodes), satellite lesions, and ground-glass band sign were statistically significant( P<0.05). The results of multifactorial logistic regression analysis showed that CTR( OR=4.98, P<0.001), lobulation sign( OR=4.07, P=0.013), burr sign( OR=3.66, P<0.001), and satellite lesions( OR=3.56, P=0.009) were the independent risk factors for the occurrence of STAS. Applying the above factors to construct the nomogram model and validate the model, the results showed that the ROC curve was plotted by the nomogram prediction model, and the area under the ROC curve( AUC) of the training set was 0.840(sensitivity 0.835, specificity 0.734), and the validation set had an AUC value of 0.852(sensitivity 0.786, specificity 0.783), and the training set and validation set calibration curves have good overlap with the ideal curve. Conclusion:CTR, lobular sign, burr sign, and satellite lesions are independent risk factors for STAS, and the nomogram model constructed in this study has good predictive value.

Antitumor effects of redox-responsive nanoparticles containing platinum（Ⅳ）in ovarian cancer / 中华肿瘤杂志

Objectives: To explore the antitumor effects of redox-responsive nanoparticles containing platinum(Ⅳ)-NP@Pt(Ⅳ) in ovarian cancer. Methods: Redox-responsive polymer carriers were synthesized. Polymer carriers and platinum(Ⅳ)-Pt(Ⅳ) can self-assemble into NP@Pt(Ⅳ). Inductively coupled plasma mass spectrometry was performed to detect the platinum release from NP@Pt(Ⅳ) in reducing environment and the platinum content in ovarian cancer cells ES2 treated with cisplatin, Pt(Ⅳ) and NP@Pt(Ⅳ). The proliferation ability of the ovarian cancer cells were detected by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cellular apoptosis was assessed by flow cytometry. Collection of primary ovarian cancer tissues from patients with primary high-grade serous ovarian cancer who were surgically treated at the Cancer Hospital of the Chinese Academy of Medical Sciences from October to December 2022. The high-grade serous ovarian cancer patient-derived xenograft (PDX) mice were intravenously injected with Cy7.5 labeled NP@Pt(Ⅳ) followed by in vivo imaging system. Mice were treated with PBS, cisplatin and NP@Pt(Ⅳ). Tumor volume and weight were measured in each group. Necrosis, apoptosis and cell proliferation of tumor tissues were detected by hematoxylin-eosin (HE) staining, TUNEL fluorescence staining and Ki-67 immunohistochemistry staining. Body weight and HE staining of heart, liver, spleen, lung and kidney of mice in each group were measured. Results: The platinum release of NP@Pt(Ⅳ) after 48 hours in reducing environment was 76.29%, which was significantly higher than that of 26.82% in non-reducing environment (P<0.001). The platinum content in ES2 cells after 4 hours and 7 hours of treatment with NP@Pt(Ⅳ) (308.59, 553.15 ng/million cells) were significantly higher than those of Pt(Ⅳ) (100.21, 180.31 ng/million cells) and cisplatin (43.36, 50.36 ng/million cells, P＜0.05). The half inhibitory concentrations of NP@Pt(Ⅳ) in ovarian cancer cells ES2, A2780, A2780DDP were 1.39, 1.42 and 4.62 μmol/L, respectively, which were lower than those of Pt(IV) (2.89, 7.27, and 16.74 μmol/L) and cisplatin (5.21, 11.85, and 71.98 μmol/L). The apoptosis rate of ES2 cells treated with NP@Pt(Ⅳ) was (33.91±3.80)%, which was significantly higher than that of Pt(Ⅳ) [(16.28±2.41)%] and cisplatin [(15.01±1.17)%, P＜0.05]. In high-grade serous ovarian cancer PDX model, targeted accumulation of Cy7.5 labeled NP@Pt(Ⅳ) at tumor tissue could be observed. After the treatment, the tumor volume of mice in NP@Pt(IV) group was (130±98) mm3, which was significantly lower than those in control group [(1 349±161) mm3, P<0.001] and cisplatin group [(715±293) mm3, P=0.026]. The tumor weight of mice in NP@Pt(IV) group was (0.17±0.09)g, which was significantly lower than those in control group [(1.55±0.11)g, P<0.001] and cisplatin group [(0.82±0.38)g, P=0.029]. The areas of tumor necrosis and apoptosis in mice treated with NP@Pt(Ⅳ) were higher than those in mice treated with cisplatin. Immunohistochemical staining revealed that there were low expressions of Ki-67 at tumor tissues of mice treated with NP@Pt(Ⅳ) compared with cisplatin. The change in body weight of mice in NP@Pt(Ⅳ) group was not significantly different from that of the control group [(18.56±2.04)g vs.(20.87±0.79)g, P=0.063]. Moreover, the major organs of the heart, liver, spleen, lung, and kidney were also normal by HE staining. Conclusion: Redox-responsive NP@Pt(Ⅳ), produced in this study can enhance the accumulation of cisplatin in ovarian cancer cells and improve the efficacy of ovarian cancer chemotherapy.

Antitumor effects of redox-responsive nanoparticles containing platinum（Ⅳ）in ovarian cancer / 中华肿瘤杂志

Objectives: To explore the antitumor effects of redox-responsive nanoparticles containing platinum(Ⅳ)-NP@Pt(Ⅳ) in ovarian cancer. Methods: Redox-responsive polymer carriers were synthesized. Polymer carriers and platinum(Ⅳ)-Pt(Ⅳ) can self-assemble into NP@Pt(Ⅳ). Inductively coupled plasma mass spectrometry was performed to detect the platinum release from NP@Pt(Ⅳ) in reducing environment and the platinum content in ovarian cancer cells ES2 treated with cisplatin, Pt(Ⅳ) and NP@Pt(Ⅳ). The proliferation ability of the ovarian cancer cells were detected by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cellular apoptosis was assessed by flow cytometry. Collection of primary ovarian cancer tissues from patients with primary high-grade serous ovarian cancer who were surgically treated at the Cancer Hospital of the Chinese Academy of Medical Sciences from October to December 2022. The high-grade serous ovarian cancer patient-derived xenograft (PDX) mice were intravenously injected with Cy7.5 labeled NP@Pt(Ⅳ) followed by in vivo imaging system. Mice were treated with PBS, cisplatin and NP@Pt(Ⅳ). Tumor volume and weight were measured in each group. Necrosis, apoptosis and cell proliferation of tumor tissues were detected by hematoxylin-eosin (HE) staining, TUNEL fluorescence staining and Ki-67 immunohistochemistry staining. Body weight and HE staining of heart, liver, spleen, lung and kidney of mice in each group were measured. Results: The platinum release of NP@Pt(Ⅳ) after 48 hours in reducing environment was 76.29%, which was significantly higher than that of 26.82% in non-reducing environment (P<0.001). The platinum content in ES2 cells after 4 hours and 7 hours of treatment with NP@Pt(Ⅳ) (308.59, 553.15 ng/million cells) were significantly higher than those of Pt(Ⅳ) (100.21, 180.31 ng/million cells) and cisplatin (43.36, 50.36 ng/million cells, P＜0.05). The half inhibitory concentrations of NP@Pt(Ⅳ) in ovarian cancer cells ES2, A2780, A2780DDP were 1.39, 1.42 and 4.62 μmol/L, respectively, which were lower than those of Pt(IV) (2.89, 7.27, and 16.74 μmol/L) and cisplatin (5.21, 11.85, and 71.98 μmol/L). The apoptosis rate of ES2 cells treated with NP@Pt(Ⅳ) was (33.91±3.80)%, which was significantly higher than that of Pt(Ⅳ) [(16.28±2.41)%] and cisplatin [(15.01±1.17)%, P＜0.05]. In high-grade serous ovarian cancer PDX model, targeted accumulation of Cy7.5 labeled NP@Pt(Ⅳ) at tumor tissue could be observed. After the treatment, the tumor volume of mice in NP@Pt(IV) group was (130±98) mm3, which was significantly lower than those in control group [(1 349±161) mm3, P<0.001] and cisplatin group [(715±293) mm3, P=0.026]. The tumor weight of mice in NP@Pt(IV) group was (0.17±0.09)g, which was significantly lower than those in control group [(1.55±0.11)g, P<0.001] and cisplatin group [(0.82±0.38)g, P=0.029]. The areas of tumor necrosis and apoptosis in mice treated with NP@Pt(Ⅳ) were higher than those in mice treated with cisplatin. Immunohistochemical staining revealed that there were low expressions of Ki-67 at tumor tissues of mice treated with NP@Pt(Ⅳ) compared with cisplatin. The change in body weight of mice in NP@Pt(Ⅳ) group was not significantly different from that of the control group [(18.56±2.04)g vs.(20.87±0.79)g, P=0.063]. Moreover, the major organs of the heart, liver, spleen, lung, and kidney were also normal by HE staining. Conclusion: Redox-responsive NP@Pt(Ⅳ), produced in this study can enhance the accumulation of cisplatin in ovarian cancer cells and improve the efficacy of ovarian cancer chemotherapy.

Signal transducer and activator of transcription 3 and cancer associated fibroblasts jointly generate chemo-resistance and affect prognosis in epithelial ovarian cancer / 中华妇产科杂志

Objective: To investigate the mechanism of signal transducer and activator of transcription 3 (STAT3) and cancer associated fibroblasts (CAF) jointly generate chemo-resistance in epithelial-ovarian cancer and their effect on prognosis. Methods: A total of 119 patients with high-grade ovarian serous cancer who received surgery in Cancer Hospital of Chinese Academy of Medical Sciences from September 2009 to October 2017 were collected. The clinico-pathological data and follow-up data were complete. Multivariate Cox regression model was used to analyze the prognostic factors. Ovarian cancer tissue chips of patients in our hospital were prepared. EnVision two-step method immunohistochemistry was used to detect the protein expression levels of STAT3, the specific markers of CAF activation, fibroblast activating protein (FAP), and type Ⅰ collagen (COL1A1) secreted by CAF. The relationship between the expression of STAT3, FAP, COL1A1 protein and drug resistance and prognosis of ovarian cancer patients was analyzed, and the correlation between the expression of three proteins was analyzed. These results were verified through the gene expression and prognostic information of human ovarian cancer tissues collected in the GSE26712 dataset of gene expression omnibus (GEO) database. Results: (1) Multivariate Cox regression model analysis showed that chemotherapy resistance was an independent risk factor for overall survival (OS) of ovarian cancer (P<0.001). (2) The expression levels of STAT3, FAP, and COL1A1 proteins in chemotherapy resistant patients were significantly higher than those in chemotherapy sensitive patients (all P<0.05). Patients with high expression of STAT3, FAP, and COL1A1 had significantly shorter OS than those with low expression (all P<0.05). According to the human ovarian cancer GSE26712 dataset of GEO database, patients with high expression of STAT3, FAP, and COL1A1 also showed shorter OS than patients with low expression (all P<0.05), the verification results were consistent with the detection results of ovarian cancer patients in our hospital. (3) Correlation analysis showed that the protein level of STAT3 was positively correlated with FAP and COL1A1 in our hospital's ovarian cancer tissue chips (r=0.47, P<0.001; r=0.30, P=0.006), the analysis of GEO database GSE26712 dataset showed that the expression of STAT3 gene and FAP, COL1A1 gene were also significantly positively correlated (r=0.31, P<0.001; r=0.52, P<0.001). Conclusion: STAT3 and CAF could promote chemotherapy resistance of ovarian cancer and lead to poor prognosis.

The expression and significance of protease activated receptor 2 in ovarian epithelial carcinoma / 中华肿瘤杂志

Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.

Implication of DTAS gene mutation on prognosis in newly diagnosed patients with acute myeloid leukemia / 中华检验医学杂志

Objective:To investigate the influence of DTAS gene mutations (DNMT3A, TET2, ASXL1, SRSF2) on survival of newly diagnosed acute myeloid leukemia (AML) patients.Methods:A retrospective analysis of 163 patients with next-generation sequencing(NGS)data in the hematology Department of Affiliated Hospital of Xuzhou Medical University from January 1, 2018 to October 31, 2021 was performed. Clinical data of patients were collected and analyzed including patient′s height, weight, gender, age, bone marrowblast ratio, induction chemotherapy regimen, transplantation or not, complete blood count, etc. There were 88 males and 75 females with a median age of 48 (4-81) years. According to the next-generation sequencing data, patients with any mutation of the above four genes were divided into the DTAS gene mutation group, and vice versa, they were divides into non-DTAS gene mutation group.The Kaplan-Meier method and Cox proportional risk model were used to analyze survival and prognosis.Results:Among 163 patients, DTAS gene mutation was detected in 50 patients (30.7%), and not in 113patients(69.3%). Among the 50 patients with DTAS genemutations, 8 cases(16%) had≥2 mutations and 42 cases(84%) had any gene mutation in DTAS. In the DTAS gene mutation group, the patients were older, the stratification of the European leukemia network(ELN) was poor, the duration of remission was shorter, the proportion of sever myelosuppression degree was higher (61.8% vs 34.8%) at day28 after induction chemotherapy, and the lymphocyte-monocyte ratio was lower than that of the healthy control group when CR was reached after treatment.The results of K-M survival analysis showed that the overall survival(OS)time ( P=0.003) and event-free survival(EFS) ( P=0.008) time of the DTAS gene mutant were significantly shorter than those of the non-DTAS gene mutated group.The medianOS timein theh DTAS gene mutations was significantly shorter than that in the non-DTAS gene mutated group ( P=0.003, HR=2.041) [21(95% CI 16.63-25.37) months vs 43 (95% CI 33.01-52.99) months].The results of multivariate COX analysis revealed that DTAS gene mutations was an independent risk facror forOS time(HR=2.041, 95% CI: 1.285-3.244, P=0.003) in AML patients. Conclusion:DTAS gene mutation does not affect the hematopoietic recovery time after induction chemotherapy, but the duration of remission is shorter in the DTAS gene mutations group. DTAS gene mutations indicate a poor prognosis, which is an independent risk factor for OS.

Aurora A Kinase Plays a Key Role in Mitosis Skip during Senescence Induced by Ionizing Radiation / 生物医学与环境科学（英文）

OBJECTIVE@#To investigate the fate and underlying mechanisms of G2 phase arrest in cancer cells elicited by ionizing radiation (IR).@*METHODS@#Human melanoma A375 and 92-1 cells were treated with X-rays radiation or Aurora A inhibitor MLN8237 (MLN) and/or p21 depletion by small interfering RNA (siRNA). Cell cycle distribution was determined using flow cytometry and a fluorescent ubiquitin-based cell cycle indicator (FUCCI) system combined with histone H3 phosphorylation at Ser10 (pS10 H3) detection. Senescence was assessed using senescence-associated-β-galactosidase (SA-β-Gal), Ki67, and γH2AX staining. Protein expression levels were determined using western blotting.@*RESULTS@#Tumor cells suffered severe DNA damage and underwent G2 arrest after IR treatment. The damaged cells did not successfully enter M phase nor were they stably blocked at G2 phase but underwent mitotic skipping and entered G1 phase as tetraploid cells, ultimately leading to senescence in G1. During this process, the p53/p21 pathway is hyperactivated. Accompanying p21 accumulation, Aurora A kinase levels declined sharply. MLN treatment confirmed that Aurora A kinase activity is essential for mitosis skipping and senescence induction.@*CONCLUSION@#Persistent p21 activation during IR-induced G2 phase blockade drives Aurora A kinase degradation, leading to senescence via mitotic skipping.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Danggui Buxuetang in Malignant Tumor： A Review / 中国实验方剂学杂志

The occurrence and development of malignant tumors seriously affect the survival time and quality of life of people all over the world， and finding proper treatment methods has been a focus for doctors. Especially in recent years， traditional Chinese medicine （TCM） has developed and attracted the attention of doctors and patients. From the perspective of TCM syndrome differentiation and treatment， deficiency and stasis are the most fundamental causes of malignant tumors， and supplementing deficiency and removing stasis can be regarded as the basic criteria of TCM treatment of malignant tumors. TCM prescriptions can treat diseases by means of multiple components and multiple targets， with the characteristics of slight side effect and high efficacy， safety and cost performance， as well as easiness to be accepted and taken. As a classic recipe for invigorating Qi and generating blood， Danggui Buxuetang consists of Astragali Radix -Angelicae Sinensis Radix 5∶1. It has excellent effects in anti-tumor， bone marrow suppression after chemotherapy， immune function decline， anemia， heart and cerebral vessels protection， blood deficiency-led fever， diabetes， anti-atherosclerosis， anti-fatigue， anti-radiation， myocardial ischemia alleviation， inhibition of platelet aggregation， liver damage， etc. In addition， with many active anti-tumor ingredients， Danggui Buxuetang can exert anti-tumor effects via acting on multiple targets in different binding sites. However， there has been a lack of reviews on the role of Danggui Buxuetang in malignant tumors so far. Therefore， in this paper， the functions of Danggui Buxuetang in malignant tumors were reviewed. Besides， molecular docking technology was used to analyze the main active anti-tumor ingredients and action targets of Danggui Buxuetang.

Antitumor Effect and Mechanism of Rutin： A Review / 中国实验方剂学杂志

The morbidity and mortality of cancer have been on the rise， making it atop the list of human health threats. It has been a conundrum of global magnitude. As the side effects of chemotherapeutics seriously affect the life quality of cancer patients， it is urgent to find effective anti-cancer drugs with small toxic and side effects. In recent years， the anti-cancer effects of traditional Chinese medicine have attracted the interest of scholars. Owing to the improvement of medical research， an increasing number of anti-cancer components with small toxic and side effects have been extracted from traditional Chinese medicine. Rutin， a unique flavonoid in Chinese medicinals and many plants， proves to inhibit the proliferation of breast cancer， colon cancer， lung cancer， and prostate cancer cells. In addition， rutin alone or in combination with other therapeutic drugs can regulate a variety of signaling pathways and signal mediators of inflammation， apoptosis， autophagy， and angiogenesis， thereby suppressing tumor progression. Moreover， it can also alleviate the drug resistance of tumors and the side effect of chemotherapeutics. Nevertheless， it is limited by the low bioavailability and low solubility， to which nano delivery system turns to be a solution. At the moment， the anti-cancer potential of rutin and the molecular targets of it against various cancers have not been summarized and comprehensively analyzed. Therefore， the authors retrieved articles on the anti-cancer effects of rutin in recent years， summed up the mechanisms and molecular targets， and discussed relevant drug delivery systems and the safety， aiming at laying a theoretical foundation for further development and application of the flavonoid.

MiR-663a Inhibits Radiation-Induced Epithelium-to-Mesenchymal Transition by Targeting TGF-β1 / 生物医学与环境科学（英文）

Objective@#miR-663a has been reported to be downregulated by X-ray irradiation and participates in radiation-induced bystander effect via TGF-β1. The goal of this study was to explore the role of miR-663a during radiation-induced Epithelium-to-mesenchymal transition (EMT).@*Methods@#TGF-β1 or IR was used to induce EMT. After miR-663a transfection, cell migration and cell morphological changes were detected and the expression levels of miR-663a, TGF-β1, and EMT-related factors were quantified.@*Results@#Enhancement of cell migration and promotion of mesenchymal changes induced by either TGF-β1 or radiation were suppressed by miR-663a. Furthermore, both X-ray and carbon ion irradiation resulted in the upregulation of TGF-β1 and downregulation of miR-663a, while the silencing of TGF-β1 by miR-663a reversed the EMT process after radiation.@*Conclusion@#Our findings demonstrate an EMT-suppressing effect by miR-663a via TGF-β1 in radiation-induced EMT.

Protective Mechanism of Electroacupuncture on Peripheral Neurotoxicity Induced by Oxaliplatin in Rats / 中国结合医学杂志

OBJECTIVE@#To study the effect of electroacupuncture (EA) on oxaliplatin-induced peripheral neuropathy (OIPN) in rats.@*METHODS@#Male Sprague-Dawley rats were equally divided into 3 groups using a random number table: the control group, the OIPN group, and the EA (OIPN + EA) group, with 10 rats in each. The time courses of mechanical, cold sensitivity, and microcirculation blood flow intensity were determined. The morphology of the dorsal root ganglion (DRG) was observed by electron microscopic examination. The protein levels of nuclear factor E2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and the transient receptor potential (TRP) protein family in DRGs were assayed by Western blot.@*RESULTS@#EA treatment significantly reduced mechanical allodynia and cold allodynia in OIPN rats (P<0.01). Notably, oxaliplatin treatment resulted in impaired microcirculatory blood flow and pathomorphological defects in DRGs (P<0.01). EA treatment increased the microcirculation blood flow and attenuated the pathological changes induced by oxaliplatin (P<0.01). In addition, the expression levels of Nrf2 and HO-1 were down-regulated, and the TRP protein family was over-expressed in the DRGs of OIPN rats (P<0.01). EA increased the expression levels of Nrf2 and HO-1 and decreased the level of TRP protein family in DRG (P<0.05 or P<0.01).@*CONCLUSION@#EA may be a potential alternative therapy for OIPN, and its mechanism may be mainly mediated by restoring the Nrf2/HO-1 signaling pathway.

Role of Foxo6 in insulin resistance of vascular endothelial cells induced by high glucose and high fat and its interaction with NF-κB pathway / 中国药理学通报

Aim To investigate the expression of Foxos in human umbilical vein endothelial cells(HUVECs)with insulin resistance(IR)induced by high glucose and high fat(HG/HF)stress and its significance.Methods First, the IR model of endothelial cells was established by HG /HF stress.The differential expression of Foxos gene in normal(Ctrl )group and HG /HF group was observed, and the subtypes with the most significant changes in Foxos were screened out, such as Foxo6.Next, Foxo6 was silenced to observe its role in endothelial cell with IR.Finally, whether the mechanism of Foxo6-mediated IR was related to the interaction of NF-κB signaling was investigated.Results The expression increase of Foxo6 was the most significant among Foxos under the IR condition induced by HG/HF.Using a small RNA interference and plasmid transfection technique, we found that the silence effect of the siRNA3 fragments targeting Foxo6 was the most significant among the siRNAs.Moreover, the further study showed that silencing the Foxo6 gene could significantly reverse the endothelial IR induced by HG/HF, and the mechanism of the reversal effect was related to the interaction between the Foxo6 and NF-κB signal.Conclusions Foxo6 mediates the endothelial cell IR induced by the HG /HF stress.The underlying mechanism is that Foxo6 can interact with NF-κBp65 and activate NF-κB signaling pathway.Silencing Foxo6 can improve the IR of vascular endothelial cells induced by HG /HF stress.

The Interaction Between CAL and mGluR1 Alleviates Cytotoxicity Induced by mGluR1 Overactivation / 中国生物化学与分子生物学报

Glutamate excitotoxicity mediated by metabotropic glutamate receptor 1 (mGluR1) overexpression or overactivation plays an important role in the development of Parkinson's disease (PD). Although clinical trials support the therapeutic potential of certain mGluR negative allosteric modulators (NAMs), there are still some limitations of precise modulation of mGluR using NAMs. Thus, the identification of small molecules or endogenous genes that facilitate mGluR1 modulation might be potentially beneficial for PD treatment. We determined the role of interacting partner cystic fibrosis transmembrane conductance regulator-associated ligand (CAL) in overactivated mGluR1-mediated cell apoptosis and signaling pathway in vitro and in vivo. HEK293 cells were used as an experimental tool to directly examine the interaction between CAL and mGluR1. We found that agonist of mGluR1 significantly enhanced the interaction between CAL and mGluR1 (P< 0. 05). Furthermore, CAL suppressed overactivated mGluR1-induced cell apoptosis and the activation of mGluR1 downstream signaling pathways. CAL overexpression relieved rotenone-induced neuron death (P< 0. 001) by inhibiting the activation of mGluR1-mediated signaling pathways in rotenone-induced rat model of PD. This study may reveal a new mechanism of mGluR1 activity regulation, and hopefully provide a novel molecular mechanism for the nervous system related diseases.

Correlation between serum 25-(OH)D 3, adiponectin, chemerin levels and insulin resistance in women with gestational diabetes / 国际生物医学工程杂志

Objective:To explore the correlation between the serum 25-(OH)D 3, adiponectin (APN), and chemerin levels of pregnant women with gestational diabetes mellitus (GDM) and insulin resistance. Methods:28 pregnant women with GDM were selected for the study group from May 2020 to December 2021, and 45 pregnant women with normal glucose tolerance were selected for the control group. 25-(OH)D 3, APN, chemerin, islet resistance index (HOMA-IR), fasting blood glucose, fasting insulin, and HbA1c were compared between the two groups. The correlation between 25-(OH)D 3, APN, chemerin, and GDM insulin resistance was analyzed. Results:Fasting blood glucose, fasting insulin, HOMA-IR, and chemerin in the GDM group were higher than those in the control group (all P<0.05), while 25-(OH)D 3 and APN were lower than those in the control group (all P<0.05). There was no statistical difference in HbA1c between the two groups. Logistic regression analysis showed that serum 25-(OH)D 3, APN, and chemerin were all related influencing factors of GDM (all P<0.05). Spearman's correlation analysis showed that serum 25-(OH)D 3 was negatively correlated with fasting blood glucose and HOMA-IR (all P<0.05), chemerin was positively correlated with fasting insulin and HOMA-IR (all P<0.05). ROC curve analysis showed that the AUC of 25-(OH)D 3 was 0.841 (95% CI: 0.746~0.967). AUC of APN was 0.678 (95% CI: 0.545~0.812). AUC of chemerin AUC was 0.360 (95% CI: 0.233~0.487). Conclusions:The levels of 25-(OH)D 3, APN, and chemerin have a certain correlation with the pathogenesis of GDM, which has a certain reference value for the prediction of GDM.

Anti-tumor Effect and Mechanisms of Calycosin： A Review / 中国实验方剂学杂志

Calycosin （CA）， a functional phytoestrogenic isoflavone extracted from Chinese herb Astragali Radix， is characterized by high efficiency， low toxicity， and multiple targets and has multiple pharmacological activities such as anti-oxidation， anti-radiation， anti-bacteria， cardio-cerebrovascular protection， and immunity enhancement. A number of studies have proved its significant anti-tumor effect， making it expected to become a potential component for the treatment of malignant tumors. Research shows that CA exerts the anti-tumor effect via multiple mechanisms like inducing tumor cell apoptosis and inhibiting tumor cell proliferation， migration， and invasion. It has been proved to be effective in suppressing breast cancer， colorectal cancer， lung cancer， cervical cancer， ovarian cancer， nasopharyngeal cancer， and other common malignant tumors. Its anti-tumor activity is mainly related to the regulation of B-cell lymphoma-2 （Bcl-2） family genes， microRNA （miRNA）， and estrogen receptor β （ERβ） to trigger tumor cell apoptosis. Its anti-proliferation activity is mainly reflected in the regulation of cyclin family， WD repeat-containing protein 7 （WDR7-7）， and Ewing sarcoma-associated transcript 1 （EWSAT1）. By blocking the epithelial mesenchymal transformation （EMT）， vascular endothelial growth factor （VEGF）， matrix metalloproteinases （MMPs）， CA inhibits tumor cell metastasis and invasion. In addition， it inhibits tumors by regulating autophagy marker Beclin-1 induced tumor cell autophagy and increases the sensitivity to chemotherapy drugs， thus improving the treatment effect. Although there are many reports about the wide range of applications and good effects of CA in anti-tumor， the systematic review of its anti-tumor mechanism is still lacking. Therefore， this study reviewed the anti-tumor effects and mechanisms of CA， aiming to provide reference for researchers and clinical workers.

Anti-tumor Effect and Mechanism of Betulinic Acid： A Review / 中国实验方剂学杂志

Betulinic acid （BA） is a lupane pentacyclic triterpene extracted from a variety of Chinese herbs such as Betulae Platyphyllae Cortex， Astragali Radix， Paeoniae Radix Alba， Jujubae Fructus， Sanguisorbae Radix， Eucommiae Cortex， Glycrrhizae Radix et Rhizoma， Aucklandiae Radix， and Ziziphi Spinosae Semen. It has attracted wide attention from doctors because of its low toxicity， high efficacy， and multiple functions. BA has been found to possess a significant anti-tumor biological activity， and it is expected to become a potential drug for the treatment of malignant tumors. So far， a number of studies have shown that BA is able to promote apoptosis， inhibit proliferation， metastasis and invasion， and induce cell cycle arrest via multiple mechanisms， thus resisting various malignant tumors such as ovarian cancer， breast cancer， gastric cancer， lung cancer， colorectal cancer， and prostate cancer. It exerts the anti-tomor effect by regulating the expression of cancer suppressor genes p53 and p21， triggering the generatoipn of reactive oxygen species （ROS）， down-regulating the expression of nuclear transcription factor-κB （NF-κB）， adjusting the B lymphocytoma-2 （Bcl-2） family to cause tumor cell apoptosis， and regulating transcription factor Sp1/3/4 to induce apoptosis. Its anti-proliferative activity is mainly achieved via the regulation of cyclin B， cyclin D and cyclin dependent kinases CDK and CDC. Its efficacy in inhibiting metastasis and invasion is mainly realized by regulating matrix metalloproteinase （MMP） and matrix metalloproteinase inhibitor （TIMP）， up-regulating E-cadherin， down-regulating N-cadherin and blocking the epithelial-mesenchymal transformation （EMT）. In addition， BA also induces cell cycle arrest， affects tumor metabolic reprogramming， and activates autophagy to inhibit tumor. Although there are a large number of studies on BA against tumors and its efficacy has been proved strong， the systematic review on its anti-tumor effect is still lacking. Therefore， this study reviewed the anti-tumor effect and mechanism of BA， in order to provide reference for its subsenquent research.

Analysis of Pulmonary Fibrosis Animal Models Based on Clinical Characteristics in Traditional Chinese Medicine and Western Medicine / 中国实验方剂学杂志

This paper collated the western medicine and traditional Chinese medicine （TCM） diagnostic criteria of pulmonary fibrosis （PF） based on its clinical characteristics and relevant literature reports and summarized the inductive agents， methods， objects， and mechanisms for replicating the PF animal models as well as their respective advantages and disadvantages. By analyzing the consistency of symptoms among successfully modeled animal models with the clinical characteristics in TCM and western medicine， we found that the intratracheal injection of bleomycin was the most frequently employed method for modeling， and the resulting outcomes were very similar to clinical characteristics in TCM and Western Medicine. Besides， considering the time-saving process， high stability， good repeatability， and low cost， such method was suitable for the rapid screening of drugs. The second preferred method was intraperitoneal injection of paraquat， which exhibited the advantages of high degree of consistency with clinical characteristics of PF caused by paraquat poisoning， low cost， high success rate， and easy operation， which allowed it to be suitable for exploring the mechanism of paraquat poisoning and developing the antidotes. The existing PF animal models shared a fairly high degree of consistency in symptoms with patients diagnosed as having PF in western medicine. However， the criteria for TCM syndrome differentiation remained unclear， and the animal models failed to reflect TCM pathogenesis. It is necessary to establish more accurate TCM diagnostic criteria that focus on syndrome differentiation and reveal TCM etiology and pathogenesis and carry out more experiments concerning TCM syndromes of PF in the future， so as to better treat PF with integrated TCM and Western Medicine.

Protective effect of low-level laser irradiation on lipopolysaccharide-mediated inflammatory injury of human periodontal ligament fibroblasts / 华西口腔医学杂志

OBJECTIVES@#To study the effect and mechanism of low-level laser irradiation (LLLI) on lipopolysaccharide (LPS)-induced inflammatory injury of human periodontal ligament fibroblasts (hPDLFs).@*METHODS@#hPDLFs were inoculated into well plates and randomly divided into the normal group, LPS group, and LPS+LLLI group. The cells in the normal group were cultured in conventional medium. The hPDLFs in the LPS and LPS+LLLI groups were cultured in RPMI1640 medium containing 1 mg·L@*RESULTS@#Compared with the normal group, the LPS group showed increased apoptosis rate of hPDLFs and intracellular free Ca@*CONCLUSIONS@#LLLI has a protective effect on the inflammatory injury of hPDLFs induced by LPS, and the effect is most obvious when the irradiation intensity is 4 J·cm