ABSTRACT
With the increasing development of technology and decreasing costs over the years, genetic diagnosis is gradually becoming the ultimate means of diagnosing neurogenetic diseases. Clinicians often face various predicaments in the process of genetic diagnosis due to the high clinical variability and genetic heterogeneity of neurogenetic diseases. This editorial proposes countermeasures to address these predicaments and suggests that specialists in the field of neurogenetic diseases should not only be familiar with the clinical, genetic and causative genes of neurogenetic diseases, and the characteristics of genetic testing techniques, so as to develop the most reasonable genetic testing protocol, but also learn to correctly analyze and interpret genetic test results to avoid missed diagnoses and misdiagnoses.
ABSTRACT
Objective:To summarize the surgical technique and clinical experience of robotic-assisted laparoscopic radical nephrectomy (RN) + venous tumor thrombectomy (VTTE) approach for renal tumor with Mayo grade 0-Ⅲ tumor thrombus, and to discuss its safety and efficacy.Methods:A retrospective analysis of the clinical data of 26 patients with renal tumor associated with Mayo 0-Ⅲ thrombus admitted to Peking University Third Hospital from October 2020 to September 2021. There were 17 male cases and 9 female cases. The mean age was (56.9±13.9) years. The mean body mass index (BMI) was (25.8±3.5) kg/m 2. The renal tumors were located on the left side in 12 cases and on the right side in 14 cases, with a mean tumor diameter of (7.8±2.9) cm. The tumors were graded by Mayo: Mayo 0 in 10 cases, Mayo Ⅰ in 3 cases, Mayo Ⅱ in 11 cases and Mayo Ⅲ in 2 cases. The American Society of Anesthesiology (ASA) graded 23 cases as grade 2 and 3 cases as grade 3. All 26 patients were treated by robotic-assisted laparoscopic approach with RN+ VTTE. Mayo 0 tumor thrombus was treated in the same way as radical nephrectomy. For Mayo Ⅰ tumor thrombus, the lateral wall of the IVC at the inferior vena cava (IVC) where the renal vein joins was clamped to partially block the IVC flow and then the thrombus was removed. For Mayo Ⅱ tumor thrombus, after blocking the flow in the IVC with three blocking bands, the wall of the IVC was dissected and the thrombus was removed. For Mayo Ⅲ tumor thrombus: cut the short hepatic vein, free the liver, expose the posterior IVC and follow the same procedure as for Mayo Ⅱ tumor thrombus. Results:All 26 patients in this group were successfully operated on, 1 of which was converted to open surgery. The median operative time was 148.5 (77.0-399.0) min, and the median intraoperative estimated bleeding volume was 300 (10-2000) ml. Postoperative pathological diagnosis: 18 cases of renal clear cell carcinoma, 2 cases of papillary renal cell carcinoma type Ⅱ, 2 cases of TEF gene fusion-related renal carcinoma, 1 case of unclassified renal cell carcinoma, 1 case of uroepithelial carcinoma and 2 cases of AML. In 2 of the 26 cases, segmental resection of the IVC was performed because the right renal VTT had extensively invaded the wall of the IVC. Due to the residual wall thrombus at the head of the tumour thrombus, 1 case underwent inferior vena cava dissection and the inferior vena cava was cut obliquely to preserve the left renal venous return. 6 patients underwent intraoperative lymph node dissection of the hilum, three of which had pathology suggestive of lymph node metastasis. 1 patient underwent adrenalectomy for tumor invasion of the ipsilateral adrenal gland. The median postoperative hospital stay was 7.2(4.0-22.0)d. According to the modified Clavien classification, there were 18 grade Ⅰ and 8 grade Ⅱ postoperative complications. 26 patients were followed up for 1-11 months, with a median follow-up time of 5.5 months. 3 cases developed distant metastases, including 1 case with tumour-specific death due to multiple metastases in the liver and retroperitoneum at 4 months of follow-up.Conclusions:Robotic-assisted laparoscopic RN+ VTTE is a safe and effective procedure for the treatment of renal tumours with Mayo 0 to Ⅲ tumour thrombus, with the advantages of delicate operation, minimal trauma and low incidence of serious postoperative complications.
ABSTRACT
On the basis of the Guidelines for the diagnosis and treatment of Wilson′s disease 2008, the Chinese guidelines for diagnosis and treatment of Wilson′s disease 2021 has been revised by taking into account the progress of related research in this field both at home and abroad. The original diagnostic criteria and treatment have been supplemented and refined, and the content has been updated until August 2020, mainly involving clinical manifestations, auxiliary examination, diagnosis and differential diagnosis, treatment and prognosis, with the aim of guiding clinicians to standardize the diagnosis and treatment of Chinese patients with Wilson′s disease.
ABSTRACT
Objective:To summarize and analyze the clinical data of Chinese patients with colony-stimulating factor 1 receptor (CSF1R)-related leukoencephalopathy, and clarify the phenotypic and genetic characteristics of Chinese patients.Methods:Medical history of patients with CSF1R-related leukoencephalopathy diagnosed from April 1, 2018 to January 31, 2021 in the department of neurology of 22 hospitals in China was collected, and scores of Mini-Mental State Examination (MMSE), Montreal Cognitive Assessment Scale (MoCA), magnetic resonance severity scale were evaluated. Group comparison was performed between male and female patients.Results:A total of 62 patients were included, and the male-female ratio was 1∶1.95. The age of onset was (40.35±8.42) years. Cognitive impairment (82.3%, 51/62) and motor symptoms (77.4%,48/62) were the most common symptoms. The MMSE and MoCA scores were 18.79±7.16 and 13.96±7.23, respectively, and the scores of two scales in male patients (22.06±5.31 and 18.08±5.60) were significantly higher than those in females (15.53±7.41 , t=2.954, P=0.006; 10.15±6.26, t=3.328 , P=0.003). The most common radiographic feature was bilateral asymmetric white matter changes (100.0%), and the magnetic resonance imaging severity scale score was 27.42±11.40, while the white matter lesion score of females (22.94±8.39) was significantly higher than that of males (17.62±8.74 , t=-2.221, P<0.05). A total of 36 CSF1R gene mutations were found in this study, among which c.2381T>C/p.I794T was the hotspot mutation that carried by 17.9% (10/56) of the probands. Conclusions:The core phenotypic characteristics of CSF1R-related leukoencephalopathy in China are progressive motor and cognitive impairment, with bilateral asymmetrical white matter changes. In addition, there exist gender differences clinically, with severer cognitive impairment and imaging changes in female patients. Thirty-six CSF1R gene mutations were found in this study, and c.2381T>C/p. I794T was the hotspot mutation.
ABSTRACT
Objective To systematically evaluate the relation between prognostic nutrition index (PNI) and prognosis of bladder cancer (BC) patients treated with radical cystectomy (RC). Methods We searched the literatures about the relation between PNI and the prognosis of patients treated with radical cystectomy published from the inception to January 30, 2021 in PubMed, Embase, Web of Science, CNKI, Wanfang, VIP and Chinese Medical Journal Database, and used RevMan5.3 software for Meta analysis. Results We included six literatures which comprise a total of 1273 patients. The results showed that there was a significant correlation between low PNI and OS of BC patients treated with RC (HR=2.0, 95%CI: 1.56-2.56), and there was a significant difference in RFS, PFS and DSS between low PNI and BC patients treated with RC (HR=1.93, 95%CI: 1.51-2.48). In the subgroup analysis, there were statistical differences in PNI and the prognosis of BC patients treated with RC between the Chinese group (HR=2.13, 95%CI: 1.62-2.81) and the Japanese group (HR=1.78, 95%CI: 1.08-2.94), and the PNI cutoff value had a good predictive effect on the prognosis of patients in the range of 46.08-51.30. Conclusion There is a significant relation between the level of PNI and OS of bladder cancer patients treated with radical cystectomy. Low PNI can be used as an effective marker to predict the prognosis of patients.
ABSTRACT
Primary age-related tauopathy (PART) is a type of pathological change characterized by the deposition of tau protein in the brain confined to the entorhinal cortex and hippocampus (Braak stage 0-Ⅳ), with no or little amyloid-β protein (Aβ) deposition (Thal Aβ stage 0-2). In recent years, PART has received lots of attention, but its relationship with Alzheimer's disease (AD) remains controversial. Therefore, strengthening the understanding of PART among clinicians and relevant researchers is of great value in interpretation of the relationship between brain aging and AD as well as other cognitive impairment diseases.
ABSTRACT
Primary age?related tauopathy (PART) is a type of pathological change characterized by the deposition of tau protein in the brain confined to the entorhinal cortex and hippocampus (Braak stage 0-Ⅳ), with no or little amyloid?β protein (Aβ) deposition (Thal Aβ stage 0-2). In recent years, PART has received lots of attention, but its relationship with Alzheimer′s disease (AD) remains controversial. Therefore, strengthening the understanding of PART among clinicians and relevant researchers is of great value in interpretation of the relationship between brain aging and AD as well as other cognitive impairment diseases.
ABSTRACT
<p><b>BACKGROUND</b>Although there were criteria for diagnosis of neuromyelitis optica (NMO) and multiple sclerosis (MS), it is still difficult to differentiate NMO from MS, due to the overlapping clinical manifestations. Therefore it is necessary to characterize clinical features of NMO and MS patients in the mainland of China, to simplify the process of disease diagnosis, and to identify criteria for the differential diagnosis of NMO and MS.</p><p><b>METHODS</b>A total of 138 Chinese Han patients from the mainland of China including 73 NMO, 60 MS and 5 MS-like patients with positive NMO-IgG were included in the study. Clinical records were reviewed retrospectively and the results of clinical examination, laboratory experiments, magnetic resonance imaging (MRI) and evoked potentials (EPs) were compared between NMO and MS patients. In addition, the relationship between the NMO-IgG serologic status and clinical characteristics were analyzed.</p><p><b>RESULTS</b>Compared with MS patients (1.3: 1.0), more female prevalence was observed in NMO patients (4.2: 1.0; P = 0.003). There were also statistically significant differences in visual EPs, oligoclonal bands, brainstem lesions in MRI and longitudinally extensive spinal cord lesions (LESCLs) between NMO and MS patients. Brainstem lesions observed in brain MRI were found in 17.9% of MS patients, over 3.7 times higher than in NMO patients (4.8%, P = 0.024). When stratified NMO patients by NMO-IgG, LESCLs were found in 42.1% of NMO-IgG-negative NMO patients, over 3.5 times higher than in NMO-IgG-positive patients (11.9%, P = 0.008). Statistical difference was also observed in CD4+/CD8+ ratios between NMO-IgG-positive and -negative NMO patients.</p><p><b>CONCLUSIONS</b>Comprehensive analysis of MRI, laboratory and EPs data can facilitate differential diagnosis of MS and NMO. In addition, the combination of LESCLs and brain MRI findings failing to satisfy MRI criteria for MS is highly sensitive and specific for NMO.</p>
Subject(s)
Adult , Female , Humans , Male , Middle Aged , China , Magnetic Resonance Imaging , Multiple Sclerosis , Diagnosis , Neuromyelitis Optica , Diagnosis , Retrospective StudiesABSTRACT
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
ABSTRACT
Objective Cloning-sequencing is a common method to detect the number of trinucleotide repeats.The aim of the present study is to discuss its reliability.Methods One clinically diagnosed SCA1 patient was recruited in the study.The numbers of CAG repeats in ATXN1 gene were estimated via polymerase chain reaction (PCR) and denaturing polyacrylamide gel electrophoresis (DPAGE).To verify accuracy of CAG numbers estimated, the PCR products were electrophoresed on a 2.5% agarose ge] and separated bands were excised for direct sequencing.Also, the longer separated band underwent cloning-sequencing using a TA cloning kit.Results The patient was identified as SCA1 by DPAGE.After direct sequencing, the numbers of CAG repeats were 26 and 47 in the shorter and longer bands, respectively.However, after cloning-sequencing of the longer band, there are 10 different numbers of CAG repeats, including 50, 47, 46, 41,32, 28, 27, 26, 25 and 24.Furthermore, there are other kinds of trinucleotide repeats, such as CCG, CGG, CTG, CAA and TAT scattered among the CAG repeats.Conclusions It is not reliable to identify the number of trinucleotide repeats by cloning-sequencing alone.To improve the reliability, it is better to combine cloning-sequencing with other methods.
ABSTRACT
Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.
ABSTRACT
Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.
ABSTRACT
Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.
ABSTRACT
Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.
ABSTRACT
Objective To study the clinical and genetic features of familial paroxysmal kinesigenic dyskinesias (PKD). Methods The clinical information of PKD patients from 3 Han families was analyzed and the pedigrees were further investigated. Results There were 25 PKD cases in 3 families, including 16 males and 9 females. The onset age ranged from 1 to 10 years. The attacks were provoked by voluntary movements and each attack lasted less than 30 seconds with no loss of consciousness. No neurological signs and abnormal examination were detected during the intermittent period. There were 10 to 50 attacks per day, but the frequency commonly decreased with the increase of age. The attacks can be controlled by carbamazepine. The disease was inherited in an autosomal dominant mode. Males were affected more severely than females. Conclusions The main inheritance mode of familial PKD is autosomal dominant. There may be clinic or genetic heterogeneity.
ABSTRACT
Objective To study and report 7 novel mutations and 5 novel polymorphisms of Wilson disease (WD) geneIn combination with the mutations and polymorphisms previously reported, mutation characteristics of WD gene in Chinese were further analysed. Methods Genomic DNA of 60 normal controls and 84 WD patients from 64 families were extracted from peripheral blood leukocytesThe mutations of WD gene (exon1～21) in these subjects were screened by PCR-single strand conformation polymorphism (SSCP) and further confirmed by sequencing. Results 18 different mutations and 17 polymorphisms have been found, in which 7 mutations and 5 polymorphisms are novel, respectivelyOf them, Arg778Leu and Thr935Met reaching a mutation frequency of 37.7% and 10% of in WD chromosomes may be the hotspots of mutation in Chinese population.Ile1148Thr, previously defined as a possible disease-causing mutation may be a polymorphism which has not yet been detected in normal chromosomes. Conclusion In Chinese, WD seems resulting from a few relatively common and a large number more rare mutations
ABSTRACT
Objective To study the expression of normal and variant ATP7B proteins, in order to further find the mechanism of Wilson disease. Methods Normal ATP7BcDNA/pcDNA3 was made and mutant variants Arg778Leu/pcDNA3, Gln914Ter/pcDNA3 and Thr935Met/pcDNA3 were constructed by using Quik-Change TM Site-directed Mutagenesis Kit in vitro. A good quality rabbit polyclonal antibody against the N-terminal functional domains of ATP7B was produced and purified, being named rabbit anti-human ATP7Bn33-629 polyclonal antibody. Normal and variant expression plasmids constructed above were transfected into Chinese hamster ovary (CHO) cells. After a 36-hour incubation at 37℃, the transfected CHO cells were collected. Expression of normal and variant ATP7B protein were detected and compared by Western blot analysis of cell lysates using ATP7Bn33-629 antibody. Results Expression of ATP7B normal protein in transfected CHO cells was the same as that of ATP7B variant proteins Arg778Leu and Thr935Met.Gln914Ter variant shortened ATP7B protein to 100 kd and increased the level of expression. Conclusion The mechanism under disorder of copper transport caused by the missense mutations should be not related to the level of expression. The increased level of expression caused by Gln914Ter might be associated with the shortened ATP7B protein that needs less time for translation.
ABSTRACT
Objective To develop an operational gene diagnosis method for Chinese Facioscapulohumeral muscular dystrophy (FSHD) patients Methods Genomic DNAwas double digested with restriction enzymes EcoRⅠ/HindⅢ and EcoRI/BlnI,respectively The digested fragments were separated on a 0 6% agarose gel After transferred to a Nytran SuperCharge Membrane, the fragmented DNAs were hybridized with the probe p13E 11 The hybridizing fragments were analyzed by the software ImageMaster Total Lab v1 11 and the size of each band was then given Results Only a 4q35 EcoRI+HindIII/P13E 11 fragment larger than 33 kb was detected in each of the controls Two fragments were detected in each of the 33 FSHD patients, one of which was smaller than 33 kb Although there was also presence of two small alleles in the 3 other FSHD cases, either of them turned out to be 10q26 derived owing to its BlnI sensitivity Interestingly, we found a sporadic patient who carried three 4q35 type fragments and, strikingly, two of them were smaller than 33 kb In the analysis of FSHD family members, a 9 year old boy with no clinical signs was found to share the small fragment with his affected father, indicating that he may be a pre symptomatic patient Conclusion The double digestion associated Southern blotting method we developed can be applied to both the diagnosis of FSHD patients and the prediction of pre symptomatic patients Furthermore, by the gene detection using this method, we first got the evidence of translocation between 4q and 10q in Chinese FSHD patients, which may be helpful to the elucidation of the pathogenesis of FSHD
ABSTRACT
Objective To summarize the clinical characteristics of myotonic dystrophy(DM).Methods The clinical data of 24 DM cases were analyzed retrospectively.Results 83.3%(20/24) of the patients obtained the disease during youth and it progressed slowly.79.2%(19/24) of the patients had positive family history.DM was a multisystem disease characterizing by myotonia,weakness and atrophy involved in multiple muscle groups,especially in distal limbs,neck and face.Extensors were more severe than flexors.Spontaneous myotonic discharges and myogenic damages were shown on electromyogram.Pathological examination of muscle biopsies showed increased number of central nuclei,nuclear chains and predominant atrophic typeⅠfibers in 8 cases,muscle fiber necrosis in 7 cases,fibrous structure disorder in 4 cases,sarcoplasmic masses in 3 cases,and serration of sarolemma in 2 cases.Conclusions The clinical characteristics of DM are weakness,atrophy and myotonia.Electromyogram and muscle biopsy are helpful in diagnosis of this disease.