Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 75
Filter
1.
Acta Pharmaceutica Sinica B ; (6): 4765-4784, 2023.
Article in English | WPRIM | ID: wpr-1011202

ABSTRACT

Inflammation-driven endothelial dysfunction is the major initiating factor in atherosclerosis, while the underlying mechanism remains elusive. Here, we report that the non-canonical stimulator of interferon genes (STING)-PKR-like ER kinase (PERK) pathway was significantly activated in both human and mice atherosclerotic arteries. Typically, STING activation leads to the activation of interferon regulatory factor 3 (IRF3) and nuclear factor-kappa B (NF-κB)/p65, thereby facilitating IFN signals and inflammation. In contrast, our study reveals the activated non-canonical STING-PERK pathway increases scaffold protein bromodomain protein 4 (BRD4) expression, which encourages the formation of super-enhancers on the proximal promoter regions of the proinflammatory cytokines, thereby enabling the transactivation of these cytokines by integrating activated IRF3 and NF-κB via a condensation process. Endothelium-specific STING and BRD4 deficiency significantly decreased the plaque area and inflammation. Mechanistically, this pathway is triggered by leaked mitochondrial DNA (mtDNA) via mitochondrial permeability transition pore (mPTP), formed by voltage-dependent anion channel 1 (VDAC1) oligomer interaction with oxidized mtDNA upon cholesterol oxidation stimulation. Especially, compared to macrophages, endothelial STING activation plays a more pronounced role in atherosclerosis. We propose a non-canonical STING-PERK pathway-dependent epigenetic paradigm in atherosclerosis that integrates IRF3, NF-κB and BRD4 in inflammatory responses, which provides emerging therapeutic modalities for vascular endothelial dysfunction.

2.
Article in Chinese | WPRIM | ID: wpr-1009155

ABSTRACT

OBJECTIVE@#To investigate the clinical significance and screen the risk factors of redundant nerve roots(RNRs) in patients with lumbar spinal stenosis.@*METHODS@#The clinical data of 196 patients with lumbar spinal stenosis in the department of Spinal Surgery, Yijishan Hospital, Wannan Medical College from April 1, 2015 to November 30, 2020 were retrospectively analyzed. All patients were divided into RNRs positive group and RNRs negative group according to the presence of RNRs. The differences in general clinical data, imaging parameters, visual analogue scale(VAS), Oswestry disability index(ODI), and other indicators between the two groups were compared. The risk factors which are highly correlated with RNRs were screened by binary Logistic regression analysis.@*RESULTS@#There were 59 cases in the RNRs positive group, with an occurrence rate of 29.95% (59/137), and 137 cases in the RNRs negative group. The incidence rate of RNRs in 196 patients with lumbar spinal stenosis was 30.10% (59/196). VAS and ODI scores of patients in the two groups were statistically significant (P<0.05), and clinical symptoms of patients in the RNRs positive group were more severe than those in the RNRs negative group. There were significant differences in age, number of stenosis segments, average area of lumbar dural sac, area of the narrowest segment and the narrowest segment(P<0.05). Binary logistic regression analysis showed that the number of stenosis segments, the average median sagittal diameter of spinal canal, and the average area of dural sac in lumbar intervertebral space were correlated with the generation of RNRs (P<0.05). The regression coefficient of the number of stenosis segments was -1.115, the regression coefficient of the median sagittal diameter of the spinal canal was -1.707, and the regression coefficient of the mean dural sac area of the lumbar intervertebral space was 7.556.@*CONCLUSION@#The clinical symptoms of patients with lumbar spinal stenosis accompanied by RNRs are more severe than those without them. The number of narrow segments, median sagittal diameter of the spinal canal, and the area of the lumbar intervertebral dural sac are the high-risk factors for RNRs, with the area of the lumbar intervertebral dural sac has the highest correlation.


Subject(s)
Humans , Spinal Stenosis/surgery , Constriction, Pathologic , Clinical Relevance , Retrospective Studies , Risk Factors
3.
Article in Chinese | WPRIM | ID: wpr-1008852

ABSTRACT

The fundamental principle of traditional Chinese medicine(TCM) is holism, and it is crucial for TCM to address the key issue of the "holistic view" of Chinese herbal medicine. While the overall regulatory effects of Chinese herbal medicine have been widely recognized, the holistic internal logic of individual ingredients of Chinese herbal medicines require further clarification. In order to comprehensively understand the mechanism of action of Chinese herbal medicine, this paper combined the holistic view of Chinese herbal medicine with differentiation thinking to explore the intrinsic logical relationships within Chinese herbal medicine. Starting from the perspective of the coexistence of multiple components in Chinese herbal medicine, this paper systematically examined the "self-consistent" phenomenon within single Chinese herbal medicine. This phenomenon refers to the consistent or opposing actions of various components in terms of their physical and chemical properties, pharmacokinetic effects, biological effects, flavors and properties, and TCM efficacy. The paper summarized various logical relationships of syndrome differentiation exhibited by the same Chinese herbal medicine, analyzed the underlying reasons, and focused on analyzing external factors affecting the "self-consistent" phenomenon in the efficacy of Chinese herbal medicine, aiming to better elucidate the theoretical basis of the pharmacological effects of Chinese herbal medicine, further enrich the scientific connotation of the holistic view of Chinese herbal medicine, and provide theoretical guidance for the preparation process, compatibility patterns, and formulation design of Chinese herbal medicine.


Subject(s)
Medicine, Chinese Traditional , Drugs, Chinese Herbal/therapeutic use
4.
Article in Chinese | WPRIM | ID: wpr-992728

ABSTRACT

Objective:To evaluate the radiological and clinical outcomes of the aged patients with unstable proximal humeral fracture (UPHF) treated with a locking plate and an intramedullary titanium mesh.Methods:A retrospective study was conducted to analyze the 43 aged patients with UPHF who had been admitted to Department of Orthopedics, Zhongda Hospital Affiliated to Southeast University from January 2017 to July 2019. There were 13 males and 30 females with an age of (71.3±10.3) years (from 60 to 83 years). All patients were treated with a locking plate and an intramedullary titanium mesh to support. The postoperative imaging measurements included changes in humeral head height (HHH) and neck-shaft angle (NSA) (the difference between 3 years after surgery and the second day after surgery, taken as an absolute value); the postoperative clinical measurements included visual analogue scale (VAS), range of shoulder motion, Constant-Murley shoulder functional score (Constant score), American Shoulder and Elbow Surgeons (ASES) score, and incidence of complications.Results:All patients were followed up for (39.2±2.3) months after surgery. The change in HHH at 3 years after surgery was (1.5±1.1) mm, and the change in NSA at 3 years after surgery 3.3°±2.6°. At 3 years after surgery, the VAS score was (2.2±1.3) points, the Constant score (79.2±9.1) points, and the ASES score (78.9±9.2) points; the range of forward extension was 143.2°±20.8°, the range of outward extension 139.3°±23.1°, and the range of outward rotation 55.1°±4.7°. Complications after surgery were found in 6 patients, including humeral head necrosis in 2 cases, ectopic ossification in 1 case, and infection in 3 cases.Conclusion:In the treatment of the aged patients with UPHF, a locking plate combined with an intramedullary titanium mesh can help to restore the medial column support, leading to fine radiological and clinical outcomes.

5.
Chinese Journal of Neurology ; (12): 551-560, 2022.
Article in Chinese | WPRIM | ID: wpr-933824

ABSTRACT

Duchenne muscular dystrophy (DMD) is a serious and progressive hereditary muscle disease. The DMD gene mutation on the X chromosome causes the loss of dystrophin, causing progressive muscle weakness and muscular atrophy. Most patients die for heart and lung failure. Current gene therapy methods are mainly aimed at restoring the expression of dystrophin, including read-through therapy, exon skipping therapy, vector-mediated gene replacement therapy and gene editing therapy. This article reviews the mechanisms of these different treatments and important advances in clinical research, and analyzes the challenges and application prospects of these treatments.

6.
Article in Chinese | WPRIM | ID: wpr-960437

ABSTRACT

Background It has been found that fluoride may cause cell damage by inducing intracellular calcium overload. Store-operated calcium entry (SOCE) plays an important role in maintaining intracellular calcium homeostasis, but the effect of fluoride on renal SOCE is unknown. Objective To explore the renal toxicity and the expression levels of the key proteins of SOCE, stromal interaction molecule 1 (STIM1) and calcium release-activated calcium modulator 1 (ORAI1) in the kidney tissues of mice exposed to fluoride subchronically. Methods Twenty male ICR mice were randomly divided into four groups with five mice in each group, including 0 (control group), 0.3, 3, and 30 mg·L−1 fluoride groups. The mice were given drinking water containing designed fluoride for 12 weeks. Body weight and liver and kidney organ coefficients of the mice were measured after the exposure; histopathological changes of the mouse kidney were observed; 24 h urine was collected at the end of 12 weeks of exposure to determine the levels of urine creatinine (UCr), urine calcium (UCa), albumin (ALB), and β2-microglobulin (β2-MG); the protein expression levels of STIM1 and ORAI1 in the kidney were detected by Western blotting; the fluorescence co-localization of STIM1 and ORAI1 was used to further verify the expression levels of STIM1 and ORAI1. Results After the exposure, there were no differences in body weight as well as liver and kidney organ coefficients among the groups (P > 0.05). Under optical microscope, the renal tubular cell showed degeneration, apical protrusion, shedding, and dilation in the 3 and 30 mg·L−1 fluoride groups. There was no statistical difference in UCr among the mice in each group (P > 0.05). Compared with the control group, the levels of UCa adjusted by UCr in the 3 and 30 mg·L−1 fluoride groups were (0.075±0.014) and (0.081±0.012) mol·mol−1 (represent by UCr per mol), which had a rising trend but showed no statistical difference. No difference was identified in the level of ALB among the groups (P > 0.05). The levels of β2-MG showed difference in different exposure groups, and the level of urine β2-MG in the 30 mg·L−1 fluoride group was (0.077±0.014) g·mol−1, higher than that in the control group (P<0.05). Based on the results of Western blotting, the protein expression levels of STIM1 and ORAI1 showed significant differences among the groups (F=18.411, 6.853; P=0.001, 0.013); compared with the control group, the expression levels of STIM1 protein increased in the 3 and 30 mg·L−1 fluoride groups (P < 0.05), and the protein expression level of ORAI1 in the 30 mg·L−1 fluoride group was increased (P < 0.05). The fluorescence co-localization results of STIM1 and ORAI1 showed that the expressions of STIM1 and ORAI1 were up-regulated in the 3 and 30 mg·L−1 fluoride groups. Conclusion Subchronic exposure to fluoride through drinking water can up-regulate the expression levels of STIM1 and ORAI1 in renal tissues and induce renal injury.

7.
Article in Chinese | WPRIM | ID: wpr-932292

ABSTRACT

Objective:To compare Jack dilator-kyphoplasty (DKP) and balloon-kyphoplasty (BKP) for osteoporotic vertebral compression fracture (OVCF) in postoperative vertebral height loss and adjacent intervertebral disc degeneration.Methods:A total of 94 OVCF patients were treated and fully followed up at Department of Orthopaedic Surgery, The First Hospital Affiliated to Nanjing Medical University from May 2007 to October 2016. Of them, 30 were subjected to DKP and 64 to BKP. In DKP group, there were 18 males and 12 females, with an age of (72.4±9.2) years, a bone density of (-3.99±0.88) SD and a disease course of (0.7±0.4) months; in BKP group, there were 28 males and 36 females, with an age of (71.6±14.3) years, a bone density of (-4.08±0.63) SD and a disease course of (0.6±0.3) months. The 2 groups were compared in terms of change in the height of injured vertebrae, disc height index percentage (DHIP) and Pfirrmann grading of adjacent disc degeneration at preoperation, 2 days and 36 months after operation.Results:The 2 groups were comparable due to insignificant differences in their preoperative general data ( P>0.05). The anterior and middle heights of injured vertebrae and DHIP at postoperative 36 months were significantly lower than those at postoperative 2 days in both groups ( P<0.05). There was no significant difference between the 2 groups in DHIP at 36 months after operation (79.86%±4.48% versus 80.24%±6.85%) ( t=0.277, P=0.782). By the Pfirrmann grading, 36 and 84 patients had intervertebral disc degeneration in DKP and BKP groups respectively. There was no significant difference in the incidence of intervertebral disc degeneration between the 2 groups (60.0% versus 65.6%) (χ 2=0.560, P=0.454). Conclusions:In the OVCF treatment, DKP and BKP may potentially cause height loss of the injured vertebrae and degeneration of adjacent intervertebral disc, but no difference was found in disc degeneration between the 2 modes.

8.
Acta Pharmaceutica Sinica B ; (6): 2280-2299, 2022.
Article in English | WPRIM | ID: wpr-929398

ABSTRACT

Disturbance of macrophage-associated lipid metabolism plays a key role in atherosclerosis. Crosstalk between autophagy deficiency and inflammation response in foam cells (FCs) through epigenetic regulation is still poorly understood. Here, we demonstrate that in macrophages, oxidized low-density lipoprotein (ox-LDL) leads to abnormal crosstalk between autophagy and inflammation, thereby causing aberrant lipid metabolism mediated through a dysfunctional transcription factor EB (TFEB)-P300-bromodomain-containing protein 4 (BRD4) axis. ox-LDL led to macrophage autophagy deficiency along with TFEB cytoplasmic accumulation and increased reactive oxygen species generation. This activated P300 promoted BRD4 binding on the promoter regions of inflammatory genes, consequently contributing to inflammation with atherogenesis. Particularly, ox-LDL activated BRD4-dependent super-enhancer associated with liquid-liquid phase separation (LLPS) on the regulatory regions of inflammatory genes. Curcumin (Cur) prominently restored FCs autophagy by promoting TFEB nuclear translocation, optimizing lipid catabolism, and reducing inflammation. The consequences of P300 and BRD4 on super-enhancer formation and inflammatory response in FCs could be prevented by Cur. Furthermore, the anti-atherogenesis effect of Cur was inhibited by macrophage-specific Brd4 overexpression or Tfeb knock-out in Apoe knock-out mice via bone marrow transplantation. The findings identify a novel TFEB-P300-BRD4 axis and establish a new epigenetic paradigm by which Cur regulates autophagy, inhibits inflammation, and decreases lipid content.

9.
Article in Chinese | WPRIM | ID: wpr-928325

ABSTRACT

OBJECTIVE@#To investigate the relationship between preoperative waiting time and prognosis of elderly patients with hip fracture.@*METHODS@#From January 2014 to December 2018, 333 elderly hip fracture patients undergoing surgery were retrospectively analyzed, including 104 males and 229 females, aged from 60 to 99 years with an average of (77.93±8.49) years, and 183 patients were femoral neck fracture, 150 patients were femoral intertrochanteric fracture. Among them, 269 patients (80.78%) had a clustered preoperative waiting time of 2 to 8 days, and then divided into within 4-day group(91 cases) and over 4-day group(242 cases) according to their preoperative waiting time. The survival situation was followed by telephone, and follow-up time started from fracture admission to the death event, or to the research deadline (December 31, 2019). The Kaplan-Meier method was used for survival analysis, and Cox risk proportion model was used to analyze the independent risk factors of hip fracture in elderly patients.@*RESULTS@#All patients were followed up for 12 to 75 months(means 35 months), 59 patients died and the mortality rate was 17.72%(59/333). Compared with within 4-day group, the mortality rate was higher in over 4-day group[20.66%(50/242) vs. 9.89%(9/91), χ2=5.263, P=0.022]. Multiariable Cox regression analysis showed that preoperative waiting time, age, male and Charlson comorbidity index were independent risk factors for the prognosis of hip fracture in elderly patients (all P<0.05), and every 1-day delay was associated with 5% increase of the risk of death[HR=1.05, 95%CI(1.00-1.10), P=0.045]. Subsequent analyse was stratified according to the Charlson comorbidity index (CCI), and found that over 4-day group had a higher mortality rate in patients with CCI<2, with statistically significant difference(P<0.05).@*CONCLUSION@#For elderly patients with hip fracture, most of hospitals could not complete the hip fracture surgery within 48 hours, we also need to shorten the waiting time before surgery, and thereby improve their prognosis.


Subject(s)
Aged , Female , Humans , Male , Femoral Neck Fractures , Hip Fractures/surgery , Prognosis , Retrospective Studies , Waiting Lists
10.
Article in Chinese | WPRIM | ID: wpr-955806

ABSTRACT

Objective:To investigate the clinicopathological features, immunophenotype and differential diagnosis of clear cell hidradenoma, and to analyze the origin of clear cell hidradenoma and the underlying mechanism.Methods:The clinical data of 23 cases of clear cell hidradenoma who underwent surgical resection in Suzhou Municipal Hospital between December 2017 and July 2021 were retrospectively analyzed. Clinical manifestation, imaging features, pathological features and prognosis of the 23 cases of clear cell hidradenoma were analyzed. Expression levels of epithelial membrane antigen, cytokeratin 20, cytokeratin 7, cytokeratin 14, carcinoembryonic antigen, and gross cystic disease fluid protein 15 were detected by immunohistochemical staining technique using the EnVision system. Periodic acid-Schiff (PAS) staining was performed to visualize glycogen.Results:Among the 23 cases, 8 were male and 14 were female, aged 14-94 years, with a median age of 55 years. The first symptom of clear cell hidradenoma was epidermal bulgels in 18 cases.Contrast ultrasonography showed a subcutaneous cystic solid echo mass with abundant blood flow in the solid part. The tumor histologically consisted of two types of cells: secretory epithelial cells or glandular epithelial cells and clear cells. Twenty cases had tumors with the features of benign clear cell hidradenoma. Two cases had atypical clear cell hidradenoma with atypia and mitosis. One case had malignant clear cell hidradenoma. Tumor cells were positive for epithelial membrane antigen, cytokeratin 7, cytokeratin 14, carcinoembryonic antigen, and gross cystic disease fluid protein 15 and they were Periodic acid-Schiff-positive. Twenty-three patients were followed up for 2-36 months, of which 4 were lost to follow-up and the rest had no recurrence of clear cell hidradenoma.Conclusion:Clear cell hidradenoma is rare and has a good prognosis. Malignant clear cell hidradenoma is rarer and has a poor prognosis. Diagnosis of clear cell hidradenoma is mainly based on comprehensive analysis of pathological features and immunophenotypes. Clear cell hidradenoma should be differentiated from metastatic clear cell carcinoma, spiral adenoma, cortical adenoma, and malignant melanoma.

11.
Chinese Journal of Biotechnology ; (12): 3088-3100, 2021.
Article in Chinese | WPRIM | ID: wpr-921408

ABSTRACT

Photoimmunotherapy (PIT) is an emerging tumor-targeted phototherapy that combines the tumor specificity of monoclonal antibodies with the phototoxicity of light absorbers to rapidly and selectively induce the immunogenic death of target tumor cells. PIT has minimal side effects due to its high specificity. The immunogenic cell death induced by PIT results in rapid maturation of immature dendritic cells proximal to dying tumor cells. Subsequently, the mature dendritic cells present the tumor antigens to CD8+ T cells and induce their activation and proliferation, thus enhancing the antitumor immune response of the host. PIT can also improve the anticancer efficacy by enhancing the penetration of nanomedicines into tumor tissues. In view of the excellent application prospects of PIT, this review summarizes the advances in the immune activation mechanism of PIT, the superenhanced permeability and retention effect, and the new strategies for combinatory therapy, providing references for future research and clinical translation.


Subject(s)
Humans , Antibodies, Monoclonal/therapeutic use , Immunotherapy , Neoplasms/therapy , Photosensitizing Agents , Phototherapy
12.
Article in English | WPRIM | ID: wpr-921386

ABSTRACT

OBJECTIVES@#To observe the effect of type 2 diabetes mellitus (T2DM) on mandibular bone regeneration and the expression of factors related to T helper cell 17 (Th17 cell) and regulatory T cell (Treg cell) in mice.@*METHODS@#Thirty-six 6-week-old C57BL/6J male mice were randomly divided into normal control (NC) and T2DM groups. Fasting blood glucose levels were detected 0 d, 7 d, 14 d, and 28 d after surgery for mandibular defects. Hematoxylin-eosin (HE) staining was used in observing the bone after 7 d, 14 d, and 28 d of the healing process. Immunohistochemical staining was used in observing the expression of alkaline phosphatase (ALP), Runt-related transcription factor 2 (RUNX2), forkhead box protein P3 (Foxp3), retinoic acid related orphan receptor gamma T (RORγt), and protein tyrosine phosphatase non-receptor type 2 (PTPN2) after 7 d, 14 d, and 28 d of healing.@*RESULTS@#HE staining showed that the area with new bones in the T2DM group was significantly smaller than that in the NC group. Immunohistochemical staining showed that the expression of osteogenesis related proteins ALP and RUNX2 were significantly reduced in the T2DM group. In addition, the number of RORγt positive cells increased, whereas the number of Foxp3 positive cells and the expression PTPN2 decreased significantly in the mandibular bone defect in mice with T2DM.@*CONCLUSIONS@#T2DM significantly inhibit mandibular bone regeneration in mice. Decline in PTPN2 expression and the transition of Treg and Th17 may be the underlying molecular mechanisms.


Subject(s)
Animals , Male , Mice , Bone Regeneration , Diabetes Mellitus, Type 2 , Forkhead Transcription Factors , Mice, Inbred C57BL , TCF Transcription Factors , Th17 Cells
13.
Chinese Medical Journal ; (24): 2589-2596, 2021.
Article in English | WPRIM | ID: wpr-921166

ABSTRACT

BACKGROUND@#Finding an optimal treatment strategy for adolescent idiopathic scoliosis (AIS) patients remains challenging because of its intrinsic complexity. For mild to moderate scoliosis patients with lower skeletal growth potential (Risser 3-5), most clinicians agree with observation treatment; however, the curve progression that occurs during puberty, the adolescent period, and even in adulthood, remains a challenging issue for clinicians. The aim of the study is to investigate the efficacy of Schroth exercise in AIS patients with lower skeletal growth potential (Risser 3-5) and moderate scoliosis (Cobb angle 20°-40°).@*METHODS@#From 2015 to 2017, data of 64 patients diagnosed with AIS in Peking University Third Hospital were reviewed. Forty-three patients underwent Schroth exercise were classified as Schroth group, and 21 patients underwent observation were classified as observation group. Outcomes were measured by health-related quality of life (HRQOL) and radiographic parameters. HRQOL was assessed using the visual analog scale (VAS) scores for back, Scoliosis Research Society-22 (SRS-22) patient questionnaire. Radiographic spinopelvic parameters were obtained from anteroposterior and lateral X-rays. The pre-treatment and post-treatment HRQOL and radiographic parameters were tested to validate Schroth exercise efficacy. The inter-rater reliability of the radiographic parameters was tested using the interclass correlation coefficient (ICC). The paired t test was used to examine HRQOL and radiographic parameters. Clinical relevance between C2-C7 sagittal vertical axis (SVA) and thoracic kyphosis was analyzed using Spearman correlation.@*RESULTS@#In Schroth group, VAS back score, SRS-22 pain, and SRS-22 self-image domain were significantly improved from pre-treatment 3.0 ± 0.8, 3.6 ± 0.5, and 3.5 ± 0.7 to post-treatment 1.6 ± 0.6 (t = 5.578, P = 0.013), 4.0 ± 0.3 (t = -3.918, P = 0.001), and 3.7 ± 0.4 (t = -6.468, P < 0.001), respectively. No significant improvements of SRS-22 function domain (t = -2.825, P = 0.088) and mental health domain (t = -3.174, P = 0.061) were observed. The mean Cobb angle decreased from 28.9 ± 5.5° to 26.3 ± 5.2° at the final follow-up, despite no statistical significance was observed (t = 1.853, P = 0.102). The mean C2-C7 SVA value decreased from 21.7 ± 8.4 mm to 17.0 ± 8.0 mm (t = -1.224 P = 0.049) and mean T1 tilt decreased from 4.9 ± 4.2 ° to 3.5 ± 3.1° (t = 2.913, P = 0.011). No significant improvement of radiographic parameters and HRQOL were observed in observation group.@*CONCLUSIONS@#For AIS patients with a Risser 3-5 and a Cobb angle 20°-40°, Schroth exercises improved HRQOL and halted curve progression during the follow-up period. Both cervical spine alignment and shoulder balance were also significantly improved after Schroth exercises. We recommend Schroth exercises for patients with AIS.


Subject(s)
Adolescent , Adult , Humans , Cervical Vertebrae , Kyphosis , Lordosis , Quality of Life , Reproducibility of Results , Retrospective Studies , Scoliosis/therapy , Treatment Outcome
14.
Article in Chinese | WPRIM | ID: wpr-909620

ABSTRACT

Many drug candidates identified from natural products are poorly water-soluble. The surfactants used to disperse the hydrophobic anticancer drugs in water may cause a serious of acute hypersensitivity reactions. Nanotech?nology provides an alternative strategy for delivery of anticancer drugs. Drugs can be encapsulated or attached to the nanomaterials such as lipids, polymers and solid-core nanoparticles. In the present study, porous inorganic nanoparti?cles have been utilized for delivery of water-insoluble anticancer drugs. The synthesized nanoparticles were functional?ized with different organic polymers. The porous nanoparticles were readily internalized by human glioblastoma U-87 MG cells, and didn't display cytotoxicity. The internalized nanoparticles were mainly localized in endosomes/lysosomes in cells. With the hydrophobic curcumin and carfilzomib as model drugs, intracellular delivery of hydrophobic anticancer drugs by the porous inorganic nanoparticles was studied. The porous nanoparticle-based encapsulation of hydrophobic drug provides the aqueous dispersion of the drugs. In endosomes/lysosomes mimicking buffers with a pH of 4.5-5.5, pH-dependent drug release was observed from drug loaded nanoparticles. The intracellular drug content and cytotoxicity were significantly higher for drug loaded nanoparticles than free drug. These results suggested porous inorganic nanoparticles might be a promising intracellular carrier for hydrophobic anticancer drugs.

15.
Article in Chinese | WPRIM | ID: wpr-1008207

ABSTRACT

Aging is the most basic life feature of organisms. It is a phenomenon of dysfunction of cells,tissues and organs under the influence of external environment and internal factors during the growth of organisms. During the process,many cellular signaling pathways and biologically active substances,such as insulin/insulin-like growth factor( IGF)-1 signaling( IIS) pathway,apoptotic signaling pathway,mTOR signaling pathway,AMPK pathway,sirtuin pathway,deacetylases have been found to be closely related to the molecular mechanism of aging. Modern studies have indicated that anti-aging natural compounds can cause great side effects,while delaying aging and even inducing another disease,which is against with the purpose of delaying aging and achieving healthy aging. Therefore,the researches of anti-aging traditional Chinese medicines with fewer side effects are extremely important. Based on the different mechanisms and theories of aging,many traditional Chinese medicines have been discovered to be related to anti-aging. As one of the most important model organisms,Drosophila melanogaster has been widely used in studies of aging process in recent years. In this paper,we reviewed three important signaling pathways related to aging,such as insulin/insulin-like growth factor( IGF)-1 signaling( IIS) pathway,m TOR pathway,AMPK pathway,and screened out anti-aging traditional Chinese medicines based on D. melanogaster in recent years.


Subject(s)
Animals , Aging , Drosophila melanogaster , Insulin , Longevity , Medicine, Chinese Traditional , Signal Transduction
16.
Article in Chinese | WPRIM | ID: wpr-817679

ABSTRACT

@#【Objective】To explore the feasibility and simplicity of intelligent automatic registration ultrasound-CT/ MR fusion imaging based on liver surface in localization of focal liver lesions. 【Methods】 Thirty patients with detected focal liver lesions by contrast- enhanced CT or MR were enrolled for ultrasound- CT/MR fusion imaging using the PercuNav fusion imaging system in PHILPS EPIQ7. Both intelligent automatic registration ultrasound- CT/MR fusion imaging based on liver surface(intelligent method)and the conventional internal plane method(manual method)were used for ultrasound-CT/MR fusion imaging. The success rate of registration,the initial registration error and the times of fine-tuning were compared between these two methods.【Results】In all 30 patients,the success rates of registration were both 96.67%(29/30)using intelligent method and manual method. There was no significant difference between these two methods when compared the initial registration error and the times of fine- tuning (P>0.05). According to the further stratified analysis,in 10 lesions in the left liver,the initial registration error of the manual method was less than that of intelligent method,the difference was statistically significant(P=0.00). Although the times of fine-tuning of the manual method was less than that of intelligent method,there was no statistically significant difference(P=0.09);In 20 lesions in the right liver,the initial registration error and the times of fine-tuning of the intelligent method were superior to those of the manual method. The differences were statistically significant (P<0.05). 【Conclusion】 Intelligent automatic registration ultrasound- CT/MR fusion imaging based on liver surface is a feasible method with high success rate for ultrasound-CT/MR fusion imaging. Compared with the conventional internal plane method,the fusion imaging process is more simple and efficient for the lesions in right liver. It helps to reduce experience dependence of fusion imaging for the operators.

17.
Chinese Medical Journal ; (24): 2827-2834, 2019.
Article in English | WPRIM | ID: wpr-781737

ABSTRACT

BACKGROUND@#Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.@*METHODS@#The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.@*RESULTS@#The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.@*CONCLUSIONS@#The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

18.
Article in Chinese | WPRIM | ID: wpr-805641

ABSTRACT

Objective@#To analyze the clinical features and possible pathogenesis of sudden deafenss and vertigo induced by inner ear hemorrhage.@*Methods@#Clinical data of 30 patients with inner ear hemorrhage, from the first affiliated hospital of Sun Yat-sen university during Jan 2016 to May 2017, were retrospectively analyzed.@*Results@#Vergito and profound deafness were seen in all patients. The duration of vertigo ranged from 24 hours to three days in 11 cases, three to 14 days in the remaining 19 cases. Simultaneous occurrence of vergito and deafenss were seen in 24 patients. Semicircular canal hypofunction and abnormal cervical vestibular evoked myogenic potentials(C-VEMP)/ocular vestibular evoked myogenic potentials(O-VEMP) were detected in all cases. Ten patients had benign paroxysmal positional vertigo(BPPV) simultaneously. Hearing recovered in 20% of the cohort posttreatment. Dizziness and balance disturbance disappeared 1 to 2 months after therapy in 16 cases. Long term (6 months) follow up revealed poor hearing outcome and vestibular rehabilitation.@*Conclusion@#Vestibular vertigo and profound sensorineural hearing loss, with unsatisfactory clinical prognosis, constituted the characters of inner ear hemorrhage-associated sudden deafness.

19.
Chinese Journal of Neurology ; (12): 288-297, 2019.
Article in Chinese | WPRIM | ID: wpr-745926

ABSTRACT

Objective To investigate the risk factors for unruptured intracranial aneurysms (UIA) in patients with acute cerebral infarction and whether the UIA affect early prognosis in patients with acute cerebral infarction.Methods Inpatients with acute cerebral infarction diagnosed at the Affiliated Hospital of Yangzhou University from January 2009 to August 2017 were retrospectively collected.Diagnosis of acute cerebral infarction and UIA was established by emergency magnetic resonance imaging and three dimensional time of flight magnetic resonance angiography screening.All patients with acute cerebral infarction were divided into the group with no intracranial aneurysm (A) and the group with UIA (B).Baseline materials such as demographics and cerebrovascular risk factors were used to analyze the comorbidity and risk factors of acute cerebral infarction and UIA.According to the modified Rankin scale (mRS) scores after 90 days,the patients were divided into a good prognosis group (mRS score ≤2) and a poor prognosis group (mRS score ≥3).The influence of the location,size,number of UIA and different treatments in the acute phase on the early prognosis of the two comorbidities was analyzed,and the relevant risk factors affecting prognosis were screened out.Results Of the 3 917 patients with acute cerebral infarction,3 641 patients met the inclusion criteria,and 237 patients (6.51%) had UIA.The proportion of age,women,smoking and hypertension in group B was significantly higher than that in group A.Multivariate regression analysis showed that women (odds ratio (OR)=1.691,95% confidence interval (CI) 1.249-2.290,P=0.001),age (OR=1.023,95% CI 1.010-1.036,P=0.000),smoking (OR=1.942,95% CI 1.413-2.670,P=0.000),hypertension (OR=1.539,95% CI 1.025-2.309,P=0.037) were significandy correlated with acute cerebral infarction complicated with UIA.There were 2 346 cases (64.43%) in the good prognosis group and 1 295 cases (35.57%) in the poor prognosis group after 90 days of onset.No statistically significant difference was found in the presence of UIA between the two groups (x2=0.002,P=0.967).There was no significant correlation between location,size and number of treatments,treatment patterns,the Trial of Org 10172 in Acute Stroke Treatment classification and patient outcome.Further Logistic regression analysis showed age (OR=1.009,95%CI 1.003-1.016,P=0.003),diabetes (OR=1.235,95% CI 1.076-1.418,P=0.003),history of previous stroke (OR=1.544,95% CI 1.324-1.801,P=0.000) and National Institutes of Healthy Stroke Scale (NIHSS) score at admission (OR=1.037,95% CI 1.020-1.054,P=0.000) were significantly associated with poor outcomes in patients with acute cerebral infarction.Conclusions Female,age,smoking and hypertension were found to be risk factors for comorbidity of acute cerebral infarction and UIA.The location,size,and different treatments of UIA were not found to have a significant effect on early prognosis in patients with acute cerebral infarction;age,diabetes,previous stroke history,and baseline NIHSS score were high risk factors affecting early prognosis in patients with acute cerebral infarction with or without UIA.

20.
Article in English | WPRIM | ID: wpr-812345

ABSTRACT

Postmenopausal women, who have reduced circulating estrogen levels, are more prone to develop obesity and related metabolic diseases than premenopausal women. The absence of safe and effective treatments for postmenopausal obesity has changed the focus to natural products as alternative remedies. Total salvianolic acids (TSA) are the major water-soluble ingredients of Danshen. Salvianolic acid (SA) is the major constituent of the TSA. Salvianolic acids, including TSA and SA, are widely used in traditional Chinese medicine. In the present study, ovariectomized rats and LO2 cells were used to study the effects of salvianolic acids on body weight gain and hepatic steatosis. Salvianolic acids reduced ovariectomy (OVX)-induced body weight gain, attenuated the expressions of hepatic lipogenic genes, such as sterol regulatory element binding protein (SREBP)1, fatty acid synthase (FAS), and stearoyl-CoA desaturase (SCD)1, and decreased the liver triglyceride (TG) and total cholesterol (TC). For the molecular mechanisms, OVX and high glucose-induced phosphorylation of signal transducer and activator of transcription (STAT)-3 was inhibited by salvianolic acids treatment. In LO2 cells, inhibition of STAT-3 by siRNA attenuated the increased expression of SREBP1 and TG induced by high glucose. Salvianolic acids reduced the upregulation of SREBP1 and TG induced by high glucose in LO2 cells. In conclusion, these findings illustrated that salvianolic acids markedly alleviated the lipid metabolism disorders and protected against the postmenopausal obesity. The underlying mechanism was probably associated with the regulation of STAT-3 signaling.


Subject(s)
Animals , Female , Humans , Rats , Alkenes , Drugs, Chinese Herbal , Lipid Metabolism , Liver , Metabolism , Obesity , Drug Therapy , Genetics , Metabolism , Ovariectomy , Polyphenols , Postmenopause , Genetics , Metabolism , STAT3 Transcription Factor , Genetics , Metabolism , Salvia miltiorrhiza , Chemistry , Signal Transduction , Sterol Regulatory Element Binding Protein 1 , Genetics , Metabolism , Triglycerides , Metabolism
SELECTION OF CITATIONS
SEARCH DETAIL