Impact of nitrogen and phosphorus fertilizers on Cry1Ac protein contents in transgenic cotton / Impacto de fertilizantes de nitrogênio e fósforo nos conteúdos de proteína Cry1Ac em algodão transgênico

Abstract Application of different fertilizers to check the efficiency of expression of Bt (Bacillus thuringiensis) gene in one of the leading commercialized crops (cotton) against Lepidopteran species is of great concern. The expression of Cry protein level can be controlled by the improvement of nutrients levels. Therefore, the myth of response of Cry toxin to different combinations of NP fertilizers was explored in three Bt cotton cultivars. Combinations include three levels of nitrogen and three levels of phosphorus fertilizers. Immunostrips and Cry gene(s) specific primer based PCR (Polymerase Chain Reaction) analysis were used for the presence of Bt gene that unveiled the presence of Cry1Ac gene only. Further, the ELISA (enzyme-linked immunosorbent assay) kit was used to quantify the expression of Cry1Ac protein. Under various NP fertilizers rates, the level of toxin protein exhibited highly significant differences. The highest toxin level mean was found to be 2.3740 and 2.1732 µg/g under the treatment of N150P75 kg ha-1 combination while the lowest toxin level mean was found to be 0.9158 and 0.7641 µg/g at the N50P25 kg ha-1 level at 80 and 120 DAS (Days After Sowing), respectively. It was concluded from the research that the usage of NP fertilizers has a positive relation with the expression of Cry1Ac toxin in Bt cotton. We recommend using the N150P50 kg ha-1 level as the most economical and practicable fertilizer instead of the standard dose N100P50 kg ha-1 to get the desired level of Cry1Ac level for long lasting plant resistance (<1.5). The revised dose of fertilizer may help farmers to avoid the cross-resistance development in contradiction of insect pests.

Resumo A aplicação de diferentes fertilizantes para verificar a eficiência da expressão do gene Bt (Bacillus thuringiensis) em uma das principais culturas comercializadas (algodão) contra espécies de lepidópteros é uma grande preocupação. A expressão do nível de proteína Cry pode ser controlada pela melhoria dos níveis de nutrientes. Portanto, o mito da resposta da toxina Cry a diferentes combinações de fertilizantes NP foi explorado em três cultivares de algodão Bt. As combinações incluem três níveis de nitrogênio e três níveis de fertilizantes de fósforo. A análise de PCR (reação em cadeia da polimerase) específica para o gene (s) Immunostrips e Cry (s) foi usada para a presença do gene Bt que revelou a presença do gene Cry1Ac apenas. Além disso, o kit ELISA (ensaio de imunoabsorção enzimática) foi usado para quantificar a expressão da proteína Cry1Ac. Sob várias taxas de fertilizantes NP, o nível de proteína de toxina exibiu diferenças altamente significativas. A média do nível mais alto de toxina foi de 2,3740 e 2,1732 µg / g sob o tratamento da combinação N150P75 kg ha-1, enquanto a média do nível mais baixo de toxina foi de 0,9158 e 0,7641 µg / g no nível de N50P25 kg ha-1 em 80 e 120 DAS (dias após a semeadura), respectivamente. Concluiu-se com a pesquisa que o uso de fertilizantes NP tem relação positiva com a expressão da toxina Cry1Ac no algodão Bt. Recomendamos o uso do nível de N150P50 kg ha-1 como o fertilizante mais econômico e praticável em vez da dose padrão N100P50 kg ha-1 para obter o nível desejado de nível de Cry1Ac para resistência de planta de longa duração (<1,5). A dose revisada de fertilizante pode ajudar os agricultores a evitar o desenvolvimento de resistência cruzada em contradição com as pragas de insetos.

Behavior and development of Tetranychus ludeni Zacher, 1913 (Acari: Tetranychidae) and physiological stress in genetically modified cotton expressing Cry1F and Cry1Ac proteins / Comportamento e desenvolvimento de Tetranychus ludeni Zacher, 1913 (Acari: Tetranychidae) e estresse fisiológico em algodoeiro geneticamente modificado expressando as proteínas Cry1F e Cry1Ac

Genetically modified plants are one of the tactics used in integrated pest management - IPM. There is great concern about the impact of these plants on non-target organisms. On the other hand, there is little information in the literature on the effects of transgenics (Bacillus thuringiensis) Bt on populations of phytophagous mites, and the physiological responses that this attack promotes on plants. The objective of this work was to evaluate the biology of the T. ludeni mite in Bt cotton, expressing the Cry1F and Cry1Ac proteins. To evaluate the behavior of food and oviposition preference of the T. ludeni with Bt cotton and isohybrid. Verify if the physiological stress caused by T. ludeni's attack is differentiated in Bt cotton. The mites were reared in Bt cotton and isohybrid, in a total of 40 replicates in the completely randomized design and the biological cycle was evaluated. The food preference and oviposition analysis were done with 10 replicates, with choice. The physiological stress was evaluated through chlorophyll fluorescence, under greenhouse conditions. The data of the T. ludeni biology were analyzed by Student's t-test, for food and oviposition preference the chi-square test was performed. Regression models were fitted for the fluorescence parameters. The model identity test was used to evaluate the differences between Bt and isohybrid treatments. Cry1F and Cry1Ac proteins have not affected the biology of T. ludeni. The photosynthetic parameters in Bt cotton plants were less influenced by T. ludeni infestation.

O uso de plantas geneticamente modificadas é uma das táticas utilizadas no manejo integrado de pragas - MIP. Observa-se grande preocupação com o impacto dessas plantas sobre organismos não alvos. Por outro lado, existe pouca informação na literatura sobre efeitos dos transgênicos (Bacillus thuringiensis) Bt em populações de ácaros fitófagos, e as respostas fisiológicas que esse ataque promove nas plantas. Objetivou-se com esse trabalho avaliar a biologia do ácaro T. ludeni em algodoeiro Bt, expressando as proteínas Cry1F e Cry1Ac. Avaliar se há comportamento de preferência alimentar e postura de T. ludeni em relação ao algodoeiro Bt e seu iso-híbrido. E verificar se o estresse fisiológico causado pelo ataque de T. ludeni é diferenciado em algodoeiro Bt. Os ácaros foram criados em algodoeiro Bt e iso-híbrido, em um total de 40 repetições no delineamento inteiramente casualizado, onde foi avaliado o ciclo biológico. A análise de preferência alimentar e de posturas foi feita com 10 repetições, com escolha. O estresse fisiológico foi avaliando através da fluorescência da clorofila, em casa de vegetação. Os dados da biologia de T. ludeni foram analisados pelo teste t Student, para preferência alimentar e postura foi realizado o teste qui-quadrado. Para os parâmetros da fluorescência, foram ajustados modelos de regressão. Para testar as diferenças entre Bt e iso-híbrido foi utilizado o teste de identidade de modelos. As proteínas Cry1F e Cry1Ac não afetaram a biologia de T. ludeni. Os parâmetros fotossintéticos em plantas de algodoeiro Bt foram menos influenciados pela infestação de T. ludeni.

Cepas chilenas de origen clínico de Vibrio cholerae no-O1, no-O139 portan los genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF del sistema de secreción T3SS2 presentes en una isla de patogenicidad / Chilean strains of clinical origin of non-O1, non-O139 Vibrio cholerae carry the genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF from secretion system T3SS2 present in an island of pathogenicity

Resumen Introducción. Los factores de virulencia de las cepas de Vibrio cholerae no-O1, no-O139 no son claramente conocidos. La cepa de origen septicémico NN1 Vibrio cholerae no-O1, no-O139 fue secuenciada previamente mediante la plataforma Illumina, detectándose en su genoma un fragmento de la isla de patogenicidad VPaI-7 de V. parahaemolyticus. Objetivo: detectar los genes de virulencia vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF en cepas chilenas clínicas de V. cholerae no-O1, no-O139. Material y Métodos: Un total de 9 cepas chilenas de origen clínico de Vibrio cholerae no-O1, no-O139 aisladas entre 2006-2012 fueron analizadas mediante ensayos de reacción de polimerasa en cadena (RPC, en inglés PCR) convencional para los genes de secreción tipo III codificados en dicha isla: vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF. Adicionalmente se determinó la presencia de los genes de virulencia hylA y rtxA. Además, se realizaron ensayos de repetitive element palindromic PCR (REP-PCR) y Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). Resultados: la mayoría (6/9) de las cepas chilenas de V. cholerae no-O1, no-O139 contiene todos los genes de secreción tipo III vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF, codificados en una isla de patogenicidad. Además, el total de las cepas (9/9) contiene los genes de virulencia hylA y rtxA. Conclusión: Estos resultados sugieren fuertemente la posibilidad que dichas cepas posean un potencial de virulencia importante en seres humanos.

Backgound: The virulence factors of the Vibrio cholerae non-O1, non-O139 strains are not clearly known. The strain of septicemic origin NN1 Vibrio cholerae non-O1, non-O139 was sequenced previously by the Illumina platform. A fragment of the pathogenicity island VPaI-7 of V. parahaemolyticus was detected in its genome. Aim: To detect the virulence genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF in Chilean strains of V. cholerae non-O1, non-O139. Methods: A total of 9 Chilean strains of clinical origin of Vibrio cholerae non-O1, non-O139 isolated between 2006-2012 were analyzed by conventional PCR assays for type III secretion genes encoded on that island: vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF. Additionally, the presence of the virulence genes hylA and rtxA was determined. In addition, REP-PCR and ERIC-PCR assays were performed. Results: most (6/9) Chilean V. cholerae non-O1, non-O139 strains contain the type III secretion genes vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF, encoded in an island of pathogenicity. In addition, all (9/9) the strains contain the virulence genes hylA and rtxA. Conclusion: These results strongly suggest the possibility that those strains possess an important virulence potential in humans.

Owlet moths (Lepidoptera: Noctuoidea) associated with Bt and non- Bt soybean in the brazilian savanna / Noctuóides (Lepidoptera: Noctuoidea) associados a soja Bt e não-Bt no Cerrado brasileiro

Abstract The use of GMO expressing Bt toxin in soybean production has increased significantly in the last years in Brazil in order to manage the damage caused by lepidopteran pests. In this study, we compared the richness and abundance of owlet moths (Noctuoidea) associated with Bt and non-Bt soybean. We determined the temporal variations as a function of phenology, and correlated the population variations of the most common species with meteorological variables. The research was conducted at the experimental area of Embrapa Cerrados. The collection method used was differentiated being suppressive and absolute. A total of 13 species were collected, of which eight occurred on Bt soybeans. The most representative taxa were Chrysodeixis includens (72.87%), Anticarsia gemmatalis (18.17%) and Spodoptera spp (5.22%). The number of larvae belonging to species targeted by the Bt technology was 10 times lower on Bt than on non-Bt soybeans. Utetheisa ornatrix and Elaphria deltoides were recorded on soybean for the first time, observing larvae of both species in non-Bt soybean and those of U. ornatrix also in Bt soybean. Only A. gemmatalis larvae correlated (p <0.05) negatively with precipitation. This study provided field information on the abundance and species richness of owlet moths on non-Bt soybeans, associated with the effects of Bt soybean. When considering the different levels of infestation between cultivars as a criterion, larvae monitoring is of substantial importance in order to develop the lost control program.

Resumo O uso de OGM que expressam toxina Bt na produção de soja tem aumentado significativamente nos últimos anos no Brasil e são utilizados para conter os danos causados ​​pelos lepidópteros pragas. Neste estudo comparamos a riqueza e a abundância de Noctuoides (Noctuoidea) associados à soja Bt e não-Bt. Determinamos as variações temporais em função da fenologia e correlacionamos às variações populacionais das espécies mais comuns com variáveis ​​meteorológicas. A pesquisa foi conduzida na área experimental da Embrapa Cerrados. O método de coleta utilizado foi diferenciado sendo supressivo e absoluto. Um total de 13 espécies foram coletadas, das quais oito ocorreram em soja Bt. Os taxa mais representativos foram Chrysodeixis includens, Anticarsia gemmatalis e Spodoptera spp. O número de larvas pertencentes às espécies alvo da tecnologia Bt foram 10 vezes menores na soja Bt do que em soja não-Bt . Utetheisa ornatrix e Elaphria deltoides foram registradas na soja pela primeira vez, observando-se larvas de ambas espécies na soja não-Bt e as de U. ornatrix também na soja Bt. Somente as larvas de A. gemmatalis se correlacionaram (p <0,05) negativamente com a precipitação. Este estudo forneceu informações em campo sobre a abundância e riqueza de espécies na soja não- Bt, associada aos efeitos da soja Bt. A importância do monitoramento das lagartas é substancial, a fim de tomar a melhor decisão de controle, considerando-se os diferentes níveis de infestação entre cultivares como critério.

Diversity and distribution of lepidopteran-specific toxin genes in Bacillus thuringiensis strains from Argentina / Diversidad y distribución de genes de toxinas insecticidas Lepidoptera-específicos en cepas de Bacillus thuringiensis de Argentina

A total of 268 Bacillus thuringiensis strains obtained from different sources of Argentina were analyzed to determine the diversity and distribution of the cryl, cry2, cry8, cry9 and vip3A genes encoding for lepidopteran-specific insecticidal proteins. Twin strains were excluded. Ten different profiles were detected among the 80 selected B. thuringiensis strains. Two of these profiles (cry1Aa, cry1Ac, cry1Ia, cry2Aa, cry2Ab and vip3Aa (35/80), and cry1Aa, cry1Ab, cry1Ac, cry1Ia, cry2Aa, cry2Ab and vip3Aa (25/80)) pooled 75% of the strains. The existence of this low diversity is rare, since in most of the studied collections a great diversity of insecticidal toxin gene profiles has been described. In addition, the most frequently detected profile was also most frequently derived from soil (70%), stored product dust (59%) and spider webs (50%). In contrast, the cry1Aa, cry1Ab, cry1Ac, cry1Ia, cry2Aa, cry2Ab and vip3Aa profiles were mainly detected in strains isolated from leaves (40%) and dead insect larvae (50%). Six of the identified insecticidal toxin gene profiles were discovered in strains isolated from stored product dust and leaves indicating higher diversity of profiles in these kinds of sources than in others. Some strains with high insecticidal activity against Epinotia aporema (Lepidoptera) larvae were identified, which is important to explore future microbial strategies for the control of this crop pest in the region.

Se analizaron 268 cepas de Bacillus thuringiensis obtenidas de diferentes fuentes de Argentina con el objeto de determinar la diversidad y distribución de genes cryl, cry2, cry8, cry9 y vip3A, que codifican proteínas insecticidas lepidóptero-específicas. Se excluyeron las cepas gemelas. Se detectaron solo diez perfiles diferentes entre los 80 B. thuringiensis seleccionados. Dos de estos perfiles, el cry1Aa, cry1Ac, crylIa, cry2Aa, cry2Ab y vip3Aa (35/80) y el cry1Aa, cry1Ab, cry1Ac, crylIa, cry2Aa, cry2Ab y vip3Aa (25/80), comprendieron el 75% de las cepas seleccionadas. La existencia de esta baja diversidad es una rareza, ya que en la mayor parte de las colecciones estudiadas se ha descrito una gran diversidad de perfiles de genes de toxinas insecticidas. El perfil detectado con mayor frecuencia se obtuvo principalmente de cepas procedentes de suelo (el 70% de los de esa fuente lo tenían), también fue mayoritario entre los procedentes de polvo de producto almacenado (59%) y en los que procedían de telas de arana (50%). En cambio, el perfil cry1Aa, cry1Ab, cry1Ac, crylIa, cry2Aa, cry2Ab y vip3Aa se detectó principalmente en las cepas aisladas de hojas (40%) y de larvas de insectos muertos (50%). Seis de los perfiles identificados fueron encontrados en cepas aisladas de polvo de producto almacenado y de hojas, lo que indica una mayor diversidad de perfiles en estas fuentes que en otras. Se identificaron algunas cepas con alta actividad insecticida contra larvas de Epinotia aporema (Lepidoptera), hallazgo importante para explorar en el futuro estrategias microbianas para el control de esta plaga en la región.

Expression of cry1Ab gene from a novel Bacillus thuringiensis strain SY49-1 active on pest insects

ABSTRACT In this study, the cry1Ab gene of previously characterized and Lepidoptera-, Diptera-, and Coleoptera-active Bacillus thuringiensis SY49-1 strain was cloned, expressed and individually tested on Ephestia kuehniella (Lepidoptera: Pyralidae) and Plodia interpunctella (Lepidoptera: Pyralidae) larvae. pET-cry1Ab plasmids were constructed by ligating the cry1Ab into pET28a (+) expression vector. Constructed plasmids were transferred to an Escherichia coli BL21 (DE3) strain rendered competent with CaCl2. Isopropyl β-D-1-thiogalactopyranoside was used to induce the expression of cry1Ab in E. coli BL21(DE3), and consequently, ∼130 kDa of Cry1Ab was obtained. Bioassay results indicated that recombinant Cry1Ab at a dose of 1000 µg g-1 caused 40% and 64% mortality on P. interpunctella and E. kuehniella larvae, respectively. However, the mortality rates of Bt SY49-1 strains' spore-crystal mixture at the same dose were observed to be 70% on P. interpunctella and 90% on E. kuehniella larvae. The results indicated that cry1Ab may be considered as a good candidate in transgenic crop production and as an alternative biocontrol agent in controlling stored product moths.

Chloroplast localization of Cry1Ac and Cry2A protein- an alternative way of insect control in cotton

BACKGROUND: Insects have developed resistance against Bt-transgenic plants. A multi-barrier defense system to weaken their resistance development is now necessary. One such approach is to use fusion protein genes to increase resistance in plants by introducing more Bt genes in combination. The locating the target protein at the point of insect attack will be more effective. It will not mean that the non-green parts of the plants are free of toxic proteins, but it will inflict more damage on the insects because they are at maximum activity in the green parts of plants. RESULTS: Successful cloning was achieved by the amplification of Cry2A, Cry1Ac, and a transit peptide. The appropriate polymerase chain reaction amplification and digested products confirmed that Cry1Ac and Cry2A were successfully cloned in the correct orientation. The appearance of a blue color in sections of infiltrated leaves after 72 hours confirmed the successful expression of the construct in the plant expression system. The overall transformation efficiency was calculated to be 0.7%. The amplification of Cry1Ac-Cry2A and Tp2 showed the successful integration of target genes into the genome of cotton plants. A maximum of 0.673 µg/g tissue of Cry1Ac and 0.568 µg/g tissue of Cry2A was observed in transgenic plants. We obtained 100% mortality in the target insect after 72 hours of feeding the 2nd instar larvae with transgenic plants. The appearance of a yellow color in transgenic cross sections, while absent in the control, through phase contrast microscopy indicated chloroplast localization of the target protein. CONCLUSION: Locating the target protein at the point of insect attack increases insect mortality when compared with that of other transgenic plants. The results of this study will also be of great value from a biosafety point of view.

Phylogenetic grouping and pathotypic comparison of urine and fecal Escherichia coli isolates from children with urinary tract infection

The aim of this study was to investigate the phylogenetic background and to assess hlyD (involved in the secretion of haemolysin A) and intll (encoding a class 1 integrase) in Escherichia coli isolates derived from urinary and fecal specimens. A total of 200 E. coli isolates was collected from patients presenting with urinary tract infection (UTI) during September 2009 to September 2010 and screened for hlyD and intll genes by polymerase chain reaction (PCR). Phylogenetic analysis showed that E. coli is composed of four main phylogenetic groups (A, B1, B2 and D) and that uropathogenic E. coli (UPEC) isolates mainly belong to groups B2 (54%) and D (34%) whereas group A (44%) and D (26%) are predominant among commensal E. coli isolates. In this study, hlyD was present in 26% of UPEC and 2% of commensal E. coli isolates. However, hemolytic activity was detected for 42% of UPEC and 6% of commensal E. coli isolates (p < 0.05). intll gene was more frequently expressed in UPEC (24%) in comparison with commensal E. coli isolates (12%). Resistance to aztreonam, co-trimoxazole and cefpodoxime were frequently found among UPEC isolates whereas commensal E. coli isolates were commonly resistant to co-trimoxazole, nalidixic acid and cefotaxime. Concluding, a considerable difference between UPEC and commensal E. coli isolates was observed regarding their phylogenetic groups, presence of class 1 integron and hlyD gene, hemolysin activity and resistance pattern. The detection of class 1 integrons and hlyD gene was higher among UPEC compared with commensal E. coli isolates. These findings may contribute for a better understanding of the factors involved in the pathogenesis of UPEC.

Elucidating the role of ApxI in hemolysis and cellular damage by using a novel apxIA mutant of Actinobacillus pleuropneumoniae serotype 10

Exotoxins produced by Actinobacillus (A.) pleuropneumoniae (Apx) play major roles in the pathogenesis of pleuropneumonia in swine. This study investigated the role of ApxI in hemolysis and cellular damage using a novel apxIA mutant, ApxIA336, which was developed from the parental strain A. pleuropneumoniae serotype 10 that produces only ApxI in vitro. The genotype of ApxIA336 was confirmed by PCR, Southern blotting, and gene sequencing. Exotoxin preparation derived from ApxIA336 was analyzed for its bioactivity towards porcine erythrocytes and alveolar macrophages. Analysis results indicated that ApxIA336 contained a kanamycin-resistant cassette inserted immediately after 1005 bp of the apxIA gene. Phenotype analysis of ApxIA336 revealed no difference in the growth rate as compared to the parental strain. Meanwhile, ApxI production was abolished in the bacterial culture supernatant, i.e. exotoxin preparation. The inability of ApxIA336 to produce ApxI corresponded to the loss of hemolytic and cytotoxic bioactivity in exotoxin preparation, as demonstrated by hemolysis, lactate dehydrogenase release, mitochondrial activity, and apoptosis assays. Additionally, the virulence of ApxIA336 appeared to be attenuated by 15-fold in BALB/c mice. Collectively, ApxI, but not other components in the exotoxin preparation of A. pleuropneumoniae serotype 10, was responsible for the hemolytic and cytotoxic effects on porcine erythrocytes and alveolar macrophages.

Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil

Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL), a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR) for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Histopathological and molecular characterization of encephalitic listeriosis in small ruminants from northern Paraná, Brazil

Listeriosis is a disease primarily of ruminants caused by the Gram-positive bacterium Listeria monocytogenes. Ruminants either demonstrate manifestations of the encephalitic, septicemic, or reproductive form of listeriosis. The pathological and molecular findings with encephalitic listeriosis in a 5.5-month-old, male, mixed-breed goat and a 3-year-old Texel-crossed sheep from northern Paraná, Brazil are described. Clinically, the kid demonstrated circling, lateral protrusion of the tongue, head tilt, and convulsions; the ewe presented ataxia, motor incoordination, and lateral decumbency. Brainstem dysfunctions were diagnosed clinically and listeriosis was suspected. Necropsy performed on both animals did not reveal remarkable gross lesions; significant histopathological alterations were restricted to the brainstem (medulla oblongata; rhombencephalitis) and were characterized as meningoencephalitis that consisted of extensive mononuclear perivascular cuffings, neutrophilic and macrophagic microabscesses, and neuroparenchymal necrosis. PCR assay and direct sequencing, using genomic bacterial DNA derived from the brainstem of both animals, amplified the desired 174 base pairs length amplicon of the listeriolysin O gene of L. monocytogenes. Phylogenetic analyses demonstrated that the strains associated with rhombencephalitis during this study clustered with known strains of L. monocytogenes lineage I from diverse geographical locations and from cattle of the state of Paraná with encephalitic listeriosis. Consequently, these strains should be classified as L. monocytogenes lineage I. These results confirm the active participation of lineage I strains of L. monocytogenes in the etiopathogenesis of the brainstem dysfunctions observed during this study, probably represent the first characterization of small ruminant listeriosis by molecular techniques in Latin America, and suggest that ruminants within the state of Paraná were infected by the strains of the same lineage of L. monocytogenes.

Isolation of Bacillus thuringiensis strains that contain Dipteran-specific cry genes from Ilha Bela (São Paulo, Brazil) soil samples / Isolamento de linhagens de Bacillus thuringiensis contendo genes cry díptero-específicos a partir de amostras de solo oriundas de Ilha Bela-São Paulo, Brasil

The entomophatogenic bacterium Bacillus thuringiensis produces crystal proteins, named Cry proteins which are encoded by the cry genes. This bacterium is used on biological control of important economical pests, as well as in the control of disease´s vectors, such as Aedes aegypti, a mosquito that transmits the dengue viruses. Isolates of this bacterium can be characterized by the content of cry genes and this prediction helps target different insect orders. In this research, we isolated 76 colonies of B. thuringiensis from 30 soil samples that were taken from Ilha Bela (SP, Brazil), a place where simulids are already biologically controlled by B. thuringiensis, to find bacterial isolates that were capable of controlling A. aegypti. The 16S ribosomal subunit genes of the selected isolates were sequenced, and the isolates were molecularly characterized based on their Dipteran-specific cry gene contents. Eight of the 76 isolates (10.52%) contained the cry4Aa, cry4Ba or cry10Aa genes, these isolates were carried out against A. aegypti larvae on bioassay. The presence or absence of specific cry genes was associated with the observed average larval mortalities. From the 76 isolates, seven (9.2%) were potentially able to control A. aegypti larvae. Therefore these are promising isolates for the biological control of A. aegypti larvae.

Bacillus thuringiensis é entomopatogênica, por produzir proteínas cristais, denominadas proteínas Cry, as quais são codificadas pelos genes cry. Essa bactéria atua no controle biológico de insetos-praga de culturas economicamente importantes, bem como no controle de insetos vetores causadores de doenças, como o Aedes aegypti, mosquito transmissor do vírus da dengue. Os isolados dessa bactéria podem ser caracterizados pelo conteúdo de genes cry que possuem e, assim, predizer o alvo de controle dos mesmos às diferentes ordens de insetos. Com o objetivo de encontrar isolados eficientes no controle do vetor A. aegypti, o presente trabalho isolou 76 colônias de B. thuringiensis a partir de 30 amostras de solo oriundas de Ilhabela-SP, município que se caracteriza por realizar controle biológico de simulídeos com essa bactéria. Os 76 isolados foram sequenciados na região da subunidade ribossomal 16S e caracterizados molecularmente quanto ao conteúdo de genes cry díptero-específicos. No total, oito isolados (10,52% do total) apresentaram bandas para os genes cry4Aa, cry4Ba e cry10Aa, sendo os mesmos testados contra larvas de A. aegypti por meio de bioensaios. A presença e/ou ausência dos genes cry foi associada à mortalidade média de larvas. Dentre os isolados estudados, sete (9,2% do total) apresentaram elevado potencial de controle às larvas de A. aegypti, sendo assim considerados como promissores para o manejo do controle biológico de larvas de A. aegypti com a bactéria B. thuringiensis.

Two new Brazilian isolates of Bacillus thuringiensis toxic to Anticarsia gemmatalis (Lepidoptera: Noctuidae) / Dois novos isolados brasileiros de Bacillus thuringiensis tóxicos para Anticarsia gemmatalis (Lepidoptera: Noctuidae)

Bacillus thuringiensis is a bacterium used for biopesticides production and pest-resistant plants due to the synthesis of protein crystals by cry genes, which are effective in controlling several insect orders such as Lepidoptera. This work aimed at the evaluation and characterisation of two new B. thuringiensis isolates active against A. gemmatalis (Hübner 1818) larvae, which is the soybean major pest. The results showed that Bt117-4 isolate amplified fragments corresponding to cry2 and cry9 genes, and synthesised protein fragments equivalent to 130, 90 and 45 kDa. The Bt3146-4 isolate amplified DNA fragments corresponding to cry9 gene and synthesised protein fragments of 70, 58 and 38 kDa. Transmission electron microscopy revealed the presence of protein crystals in both isolates. CL50 with Cry purified proteins from Bt117-4 and Bt3146-4, corresponded to 0.195 and 0.191 µg larvae-1, respectively. The two B. thuringiensis isolates selected in this study were effective to control velvetbean caterpillar at laboratory conditions. Field tests should be carried on to develop new biopesticides formulation as well for cry genes resource for Anticarsia gemmatalis resistant transgenic plants.

Bacillus thuringiensis é uma bactéria utilizada na produção de biopesticidas e de plantas resistentes às pragas por causa da síntese de cristais proteicos pelos genes cry, os quais são eficazes no controle de diversas ordens de insetos, como os lepidópteros. O presente trabalho objetivou a avaliação e a caracterização de dois novos isolados de B. thuringiensis ativos contra lagartas de A. gemmatalis (Hübner 1818), que é a principal praga da cultura da soja. Os resultados obtidos revelaram que o isolado Bt117-4 amplificou fragmentos correspondentes aos genes cry2 e cry9, sendo que os fragmentos proteicos sintetizados foram equivalentes a 130, 90 e 45 kDa. O isolado Bt3146-4 amplificou fragmentos de DNA que correspondem ao gene cry9 e sintetizou fragmentos proteicos de 70, 58, e 38 kDa. Os dados de microscopia eletrônica de transmissão revelam a presença de cristais proteicos em ambos os isolados. A CL50, com proteínas Cry purificadas de Bt117-4 e Bt3146-4, correspondeu a 0,195 e 0,191 µg lagarta-1, respectivamente. Os dois isolados de B. thuringiensis selecionados neste trabalho mostraram-se eficientes no controle da lagarta-da-soja em laboratório, sendo recomendada sua avaliação a campo para posterior aplicação na formulação de biopesticidas ou como fonte de genes cry para a obtenção de plantas geneticamente modificadas resistentes à Anticarsia gemmatalis.

Genes de virulencia y bacteriocinas en cepas de Enterococcus faecalis aisladas desde diferentes muestras clínicas en la Región del Maule, Chile / Virulence genes and bacteriocins in Enterococcus faecalis strains isolated from different clinical samples in Maule Region, Chile

The presence of virulence genes (VG) and bacteriocins from different clinical samples was studied in Enterococcus faecalis isolated from urinary tract infections (UTI), bacteremia and endodontitis and was correlated with haemolysin and gelatinase activity. We evaluated the presence of VG by PCR in 150 strains of E. faecalis including cylA, aggA, efaA, eep, gelE, esp, as-48, bac31, entL50A/B, entA, entP, entB, enlA andentl071. Haemolysin and gelatinase activity was studied. gelE and cylA genes expressed hemolysin and gelatinase, respectively. This activity was observed in some strains of bacteremia, UTI and endodontitis. The highest number of VG was detected in bacteremic strains, being aggA and entA genes the most frequent. efaA, esp, entA, entL50A/B were associated with their clinical origin (p < 0.05). The most common genetic profile was aggA-eep-enlA-entL50A/B. E. faecalis from UTI, bacteremia and endodontitis presented different gene combinations. Some of the genes studied were related to their clinical origin. The results obtained in this study are similar to those reported in other countries.

Desde diferentes muestras clínicas se determinó la presencia de genes codificantes de factores de virulencia (FV) y bacteriocinas en Enterococcus faecalis aislados desde infecciones del tracto urinario (ITU), bacteriemias y endodontitis, correlacionándose con la actividad hemolisina y gelatinasa. En 150 cepas de E. faecalis fue evaluada mediante RPC la presencia de cylA, aggA, efaA, eep, gelE, esp, as-48, bac31, entL50A/B, entA, entP, entB, enlA, y ent1071 determinándose actividad hemolisina y gelatinasa. Los genes cylA y gelE expresaron hemolisina y gelatinasa, respectivamente. Esta actividad fue observada en algunas de las cepas causantes de bacteriemia, ITU y endodontitis. El mayor número de genes estudiados se detectó en cepas bacteriémicas. Los genes aggA y entA, fueron los más frecuentes. Los genes efaA, esp, entL50/AB y entA se asociaron a su origen clínico (p < 0,05). El perfil genético más recurrente fue aggA-eep-enlA-entL50A/B. Enterococcusfaecalis de ITU, bacteriemias y endodontitis presentaron distintas combinaciones génicas. AAlgunos de los genes estudiados se relacionaron con su origen clínico. Los resultados obtenidos son similares a los reportados en otros países.

Characterization of Vibrio Parahaemolyticus isolated from oysters and mussels in São Paulo, Brazil / Caracterização de Vibrio parahaemolyticus isolados de ostras e mexilhões em São Paulo, Brasil

Vibrio parahaemolyticus is a marine bacterium, responsible for gastroenteritis in humans. Most of the clinical isolates produce thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) encoded by tdh and trh genes respectively. In this study, twenty-three V. parahaemolyticus, previously isolated from oysters and mussels were analyzed by PCR using specific primers for the 16S rRNA and virulence genes (tdh, trh and tlh) and for resistance to different classes of antibiotics and PFGE. Nineteen isolates were confirmed by PCR as V. parahaemolyticus. The tlh gene was present in 100 percent of isolates, the tdh gene was identified in two (10.5 percent) isolates, whereas the gene trh was not detected. Each isolate was resistant to at least one of the nine antimicrobials tested. Additionally, all isolates possessed the blaTEM-116 gene. The presence of this gene in V. parahaemolyticus indicates the possibility of spreading this gene in the environment. Atypical strains of V. parahaemolyticus were also detected in this study.

Vibrio parahaemolyticus é uma bactéria marinha, responsável por gastroenterite em humanos. A maioria dos isolados clínicos produzem hemolisina termoestável direta (TDH) e hemolisina TDH-relacionada (TRH) codificadas por genes tdh e trh, respectivamente. Neste estudo, vinte e três V. parahaemolyticus, previamente isolados de ostras e mexilhões foram analisados por PCR utilizando indicadores específicos para o gene 16S rRNA, genes de virulência (tdh, trh e tlh), resistência a diferentes classes de antibióticos, e PFGE. Dezenove isolados foram confirmados por PCR, como V. parahaemolyticus. O gene tlh estava presente em 100 por cento dos isolados, o gene tdh foi identificado em dois (10,5 por cento) dos isolados, enquanto que o gene trh não foi detectado. Cada isolado foi resistente a pelo menos um dos nove antibióticos testados. Além disso, todos os isolados apresentaram resultado positivo para o gene blaTEM-116. A presença deste gene em V. parahaemolyticus indica a possibilidade de propagação desse gene no ambiente. Cepas atípicas de V. parahaemolyticus foram também detectadas neste estudo.

The role of C-terminus carbohydrate-binding domain of Vibrio cholerae haemolysin/cytolysin in the conversion of the pre-pore β-barrel oligomer to a functional diffusion channel.

Background & objectives: Vibrio cholerae cytolysin/hemolysin (VCC) is a 65 kDa pore-forming toxin (PFT) secreted by O1 El Tor and non-O1 strains. The purified toxin, which contains two C-terminus carbohydrate-binding domains in addition to the cytolytic domain at the core, causes lysis of a wide spectrum of eukaryotic cells at picomolar concentrations, apoptogenesis of intestinal and immune cells and accumulation of fluid in rabbit ligated ileal loop. Therefore, it may potentially complement the action of cholera toxin (CT) in diarrheagenic strains that do not produce CT. We showed earlier that β1-galactosyl-terminated glycoconjugates are strong inhibitors of its pore-forming activity, though carbohydrates are not functional receptors of VCC. Here, we investigate how the 15 kDa C-terminus β-prism lectin domain contributed to pore formation in erthrocytes. Methods: VCC was isolated from the culture supernatant of late log phase grown bacteria and purified to homogeneity by chromatography. The 50 kDa truncated variant was generated by restricted proteolysis. Liposome was prepared by sonication of a suspension of phospholipids and calceine release assay was done by spectrofluorometric monitoring of the released dye trapped in liposome. Formation of β-barrel oligomers in erythrocyte stroma was monitored by scanning electron microscopy. Results: Proteolytic truncation of the C-terminus β-prism lectin domain decreased hemolytic activity of the toxin by ~800-fold without causing a significant change in pore-forming activity toward synthetic lipid vesicles devoid of incorporated glycoproteins/glycolipids. Truncation at the C-terminus did not impair membrane-binding or assembly to the oligomeric pore. Interpretation & conclusions: Our data indicated that the C-terminus domain played a critical role in translocation of the pre-pore oligomeric assembly from the cell surface or lipid-water interface to the hydrocarbon core of the membrane bilayer, signaling the formation of functional diffusion channels.

Identification & characterization of Shiga toxin-producing Escherichia coli isolates from patients with diarrhoea in Iran.

Background & objectives: Verotoxigenic Escherichia coli are important serotypes of enterohaemorrhagic E. coli (EHEC) subgroup that cause attaching and effacing lesions in enterocytes by producing verotoxins or shiga-like toxins resulting in haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). The aim of this study was to detect these serotypes specially E. coli O157:H7 in stool samples of patients with diarrhoea and identification of virulence genes (STX1, STX2, Hly and EAE) in Shahrekord-Iran area using PCR technique. Methods: Two hundred diarrhoeal stool samples of patients were collected through 2007-2008. Microbiological and biochemical examinations were done to detect the E. coli. Serological tests carried out to identify the O157 or O157:H7 serotypes. Results: Of the 58 E. coli isolates, 16 (27.6%) were detected as STX1 carrying E. coli, four (6.9%) carrying STX2, eight (13.8%) carrying both STX1 and STX2, and 12 (20.7%) were Hly carrying E. coli, but none of the isolates contained EAE gene. None of the isolates were E. coli O157 or O157:H7 serotypes. Interpretation & conclusions: Our results revealed that verotoxigenic E. coli isolates other than O157 serotype were involved in causing diarrhoea in Shahrekord-Iran.

Transformation of coffee (Coffea Arabica L. cv. Catimor) with the cry1ac gene by biolistic, without the use of markers / Transformação do café (Coffea arabica L. cv. Catimor) com o gene cry1ac por bombardeamento, sem usar marcadores

The transformation of coffee plantlets with the cry1ac gene of Bacillus thuringiensis was achieved by biolistic using either the whole pUBC plasmid or only the ubi-cry1ac-nos genetic cassette. The cry1ac gene was inserted into coffee plants in order to confer resistance to the leaf miner Leucoptera coffeella, an insect responsible for considerable losses in coffee crops. Bearing in mind that the genetic cassettes used for this study lack reporter genes and/or selection marker genes, the parameters for the transformation procedure by biolistic were previously standardised with a plasmid carrying the gus reporter gene. The presence of the cry1ac gene in young plantlet tissues was determined by PCR, Southern blot and reverse transcription-PCR. Our results show that the obtainment of viable coffee plantlets, transformed by bombardment with the cry1ac gene and without selection markers nor reporter genes, is feasible.

A transformação das plântulas de café com o gene cry1ac de Bacillus thuringiensis foi realizada por biobalística, utilizando todo o pUBC plasmídeo ou só o cassete genético UBI-cry1ac-nos. O gene cry1ac foi inserido no cafeeiro a fim de conferir resistência à folha mineiro Leucoptera coffeella, um inseto responsável por perdas consideráveis nas culturas de café. Tendo em conta que ao plasmídeo e ao cassete genético utilizados para este estudo faltam genes repórteres e/ou de seleção, os parâmetros para o processo de transformação por biobalística foram previamente padronizados com um plasmídeo transportando o gene repórter gus. A presença do gene cry1ac em tecidos de jovens plântulas foi determinada por PCR, Southern blot e transcrição reversa-PCR. Nossos resultados mostram que a obtenção de plântulas de café, transformado por bombardeamento com o gene cry1ac sem genes de seleção genética nem repórteres é viável.

Isla de patogenicidad de Vibrio parahaemolyticus en cepas chilenas clínicas y ambientales / Pathogenicity island region of clinical and environmental strains of Vibrio parahaemolyticus, isolated in Chile

Background: Most clinical isolates of Vibrio parahaemolyticus produce a major virulence factor known as the thermostable direct hemolysin (TDH). TDH is encoded by the tdh gene which is located in a genomic pathogenicity island (PAI). Most environmental isolates are described as tdh negative. Aim: To assess if environmental strains lack the full pathogenicity island or if only the tdh gene is deleted. Material and methods: Thirty eight clinical and 66 environmental strains of Vibrio parahaemolyticus were studied. PAI was characterized by polymerase chain reaction (PCR). The presence of tdhA and tdhS genes, was determined by Southern blot. Results: Fifty three environmental strains (80%) lacked a full PAI when compared with clinical strains. In environmental strains, Southern blot and sequence analysis showed that a genetic región of 80 kilobase pairs including genes from VPA1310 to VPA1396 was missing. Conclusions: These results highlight the genetic dynamism of Vibrio parahaemolyticus pathogenecity island región and suggest that new pathogenic strains could appear by horizontal transfer of the island between toxigenic and non-toxigenic strains.