Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

First report of Hibiscus soymovirus in Hibiscus rosa-sinensis in Colombia in mixed infection.

Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.

First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, Colombia.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.

First report of the hibiscus strain of citrus leprosis virus C2 infecting passionfruit (Passiflora edulis).

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Production of mono- and polyclonal antibodies to Citrus leprosis virus C2 and their application in triple antibody sandwich ELISA and immunocapture RT-PCR diagnostic assays.

The newly discovered Citrus leprosis virus cytoplasmic type 2 (CiLV-C2) is one of the causal virus of citrus leprosis disease complex; which leads to substantial loss of citrus production in the states of Meta and Casanare of Colombia. Specific and sensitive detection methods are needed to monitor the dissemination of CiLV-C2 in Colombia, and to prevent introduction of CiLV-C2 to other citrus growing countries. Toward this end, putative coat protein gene (CPG) of CiLV-C2 was amplified from CiLV-C2 infected citrus tissues. The CPG was cloned, expressed and purified a recombinant coat protein of ∼31kDa which used to generate monoclonal antibodies and polyclonal antisera. Four monoclonal antibodies and two polyclonal antisera were selected as being specific following Western blotting. The monoclonal antibody MAb E5 and polyclonal antiserum PAb UF715 were selected testing with an extract of CiLV-C2 infected leaves using triple antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA). In addition, an immunocapture RT-PCR was standardized using MAb E5 for specific and sensitive detection of CiLV-C2. The standardized TAS-ELISA and IC-RT-PCR were able to detect CiLV-C2 in the extracts of symptomatic citrus leprosis tissues up to the dilutions of 1:160 and 1:2580, respectively. Result demonstrated that CiLV-C2 is present in citrus orchards in Meta and Casanare citrus growing areas of Colombia. TAS-ELISA could be used for routine detection of CiLV-C2, epidemiological studies, and for border inspections for quarantine purposes. IC-RT-PCR could be valuable for CiLV-C2 validation and viral genome analysis.

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence.

History and Diversity of Citrus leprosis virus Recorded in Herbarium Specimens.

Leprosis refers to two diseases of citrus that present similar necrotic local lesions, often surrounded by chlorotic haloes on citrus. Two distinct viruses are associated with this disease, one that produces particles primarily in the nucleus of infected plant cells (Citrus leprosis virus nuclear type [CiLV-N]; Dichorhavirus) and another type that produces particles in the cytoplasm of infected plant cells (Citrus leprosis virus cytoplasmic type [CiLV-C]; Cilevirus). Both forms are transmitted by Brevipalpid mites and have bipartite, single-stranded, RNA genomes. CiLV-C and CiLV-N are present in South and Central America and as far north as parts of Mexico. Although leprosis disease was originally described from Florida, it disappeared from there in the 1960s. The United States Department of Agriculture-Agricultural Research Service maintains preserved citrus specimens identified at inspection stations 50 or more years ago with symptoms of citrus leprosis. We isolated RNA from these samples and performed degradome sequencing. We obtained nearly full-length genome sequences of both a typical CiLV-C isolate intercepted from Argentina in 1967 and a distinct CiLV-N isolate obtained in Florida in 1948. The latter is a novel form of CiLV-N, not known to exist anywhere in the world today. We have also documented the previously unreported presence of CiLV-N in Mexico in the mid-20th century.

Role Bending: Complex Relationships Between Viruses, Hosts, and Vectors Related to Citrus Leprosis, an Emerging Disease.

Citrus leprosis complex is an emerging disease in the Americas, associated with two unrelated taxa of viruses distributed in South, Central, and North America. The cytoplasmic viruses are Citrus leprosis virus C (CiLV-C), Citrus leprosis virus C2 (CiLV-C2), and Hibiscus green spot virus 2, and the nuclear viruses are Citrus leprosis virus N (CiLV-N) and Citrus necrotic spot virus. These viruses cause local lesion infections in all known hosts, with no natural systemic host identified to date. All leprosis viruses were believed to be transmitted by one species of mite, Brevipalpus phoenicis. However, mites collected from CiLV-C and CiLV-N infected citrus groves in Mexico were identified as B. yothersi and B. californicus sensu lato, respectively, and only B. yothersi was detected from CiLV-C2 and CiLV-N mixed infections in the Orinoco regions of Colombia. Phylogenetic analysis of the helicase, RNA-dependent RNA polymerase 2 domains and p24 gene amino acid sequences of cytoplasmic leprosis viruses showed a close relationship with recently deposited mosquito-borne negevirus sequences. Here, we present evidence that both cytoplasmic and nuclear viruses seem to replicate in viruliferous Brevipalpus species. The possible replication in the mite vector and the close relationship with mosquito borne negeviruses are consistent with the concept that members of the genus Cilevirus and Higrevirus originated in mites and citrus may play the role of mite virus vector.

Identification and Molecular Characterization of Nuclear Citrus leprosis virus, a Member of the Proposed Dichorhavirus Genus Infecting Multiple Citrus Species in Mexico.

Citrus leprosis is one of the most destructive diseases of Citrus spp. and is associated with two unrelated virus groups that produce particles primarily in either the cytoplasm or nucleus of infected plant cells. Symptoms of leprosis, including chlorotic spots surrounded by yellow haloes on leaves and necrotic spots on twigs and fruit, were observed on leprosis-affected mandarin and navel sweet orange trees in the state of Querétaro, Mexico. Serological and molecular assays showed that the cytoplasmic types of Citrus leprosis virus (CiLV-C) often associated with leprosis symptomatic tissues were absent. However, using transmission electron microscopy, bullet-shaped rhabdovirus-like virions were observed in the nuclei and cytoplasm of the citrus leprosis-infected leaf tissues. An analysis of small RNA populations from symptomatic tissue was carried out to determine the genome sequence of the rhabdovirus-like particles observed in the citrus leprosis samples. The complete genome sequence showed that the nuclear type of CiLV (CiLV-N) present in the samples consisted of two negative-sense RNAs: 6,268-nucleotide (nt)-long RNA1 and 5,847-nt-long RNA2, excluding the poly(A) tails. CiLV-N had a genome organization identical to that of Orchid fleck virus (OFV), with the exception of shorter 5' untranslated regions in RNA1 (53 versus 205 nt) and RNA2 (34 versus 182 nt). Phylogenetic trees constructed with the amino acid sequences of the nucleocapsid (N) and glycoproteins (G) and the RNA polymerase (L protein) showed that CiLV-N clusters with OFV. Furthermore, phylogenetic analyses of N protein established CiLV-N as a member of the proposed genus Dichorhavirus. Reverse-transcription polymerase chain reaction primers for the detection of CiLV-N were designed based on the sequence of the N gene and the assay was optimized and tested to detect the presence of CiLV-N in both diseased and symptom-free plants.

Production of monoclonal antibodies for detection of Citrus leprosis virus C in enzyme-linked immuno-assays and immunocapture reverse transcription-polymerase chain reaction.

Citrus leprosis virus C (CiLV-C) causes damage in citrus production in the South and Central America. Since closely related types of citrus viruses have recently been described monoclonal antibodies (MAbs) are needed for accurate and sensitive diagnosis of CiLV-C. In this study, MAbs to the expressed coat protein of CiLV-C were produced for serological detection of CiLV-C in crude extracts of infected tissues in double antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA), dot blot immunosorbent assays (DBIA) and immuonocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) procedures. Monoclonal antibodies were developed in mice to the purified expressed coat protein of CiLV-C. The published standard protocols of DAS-ELISA, DBIA and IC-RT-PCR were followed for the detection of coat protein p29 of CiLV-C in the crude extracts of CiLV-C infected tissues. Two monoclonal antibodies, designated G10 and C11, were identified from four potential candidates for the specific and sensitive detection of coat protein p29 of CiLV-C in the crude citrus extracts of CiLV-C infected tissues in DAS-ELISA, whereas G10 was also selected based on performance for use in the DBIA and IC-RT-PCR diagnostic assays. Sensitivity analysis comparing the three methods for detection of coat protein p29 of CiLV-C determined that IC-RT-PCR was more sensitive than DAS-ELISA and DBIA. The creation of MAbs to CiLV-C allows for the sensitive and accurate detection of the virus from CiLV-C infected citrus leaf tissues. Successful detection of the virus in three diagnostic assays formats provides flexibility to diagnosticians who can use either ELISA or DBIA for screening large numbers of samples, and IC-RT-PCR for rapid, sensitive confirmation testing.

First Report of Citrus leprosis virus Nuclear Type in Sweet Orange in Colombia.

Colombia is ranked 18th in the world in citrus production and contributed 0.9% of the total world share. Among four important citrus-producing regions of Colombia, the Orinoco region (3 to 6°N, 68 to 74°W) consists of two citrus-producing states, Meta and Casanare. Citrus leprosis is the most important viral disease of citrus in Colombia (1,3). Three types of Citrus leprosis virus (CiLV) infect citrus, producing leprosis-like lesion symptoms. Two of the three CiLV species, Citrus leprosis virus cytoplasmic type (CiLV-C) and cytoplasmic type 2 (CiLV-C2), produce particles only in the cytoplasm (3). The other species, Citrus leprosis virus nuclear type (CiLV-N), produces particles in both the cytoplasm and nucleus (4). CiLV-C is more prevalent and destructive while CiLV-N has been reported only in Brazil, Panama, and Mexico (4). Interestingly, both CiLV-C and -C2 were reported from the same regions of Meta and Casanare States in Colombia in 2004 and 2012 (1,3). CiLV-C lesions are usually rounded (initially 2 to 3 mm in diameter and extending up to 30 mm), have dark-brown or greenish central chlorotic spots, and are surrounded by yellow halos. CiLV-N lesions have been described as smaller in size and form three well-defined regions including a necrotic center with an intermediate orange color halo and an outer chlorotic halo (2). In 2013, 'Valencia' sweet orange (Citrus sinensis L.) leaves with suspected CiLV-N symptoms were collected from 8 plants in Casanare State and shipped under permit to the USDA-APHIS-PPQ-CPHST, Beltsville, MD. Total RNA from symptomatic and healthy sweet orange leaves were extracted using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR primers specific to CiLV-C, CiLV-C2 (3), and CiLV-N nucleocapsid (N) (CiLV-N-NPF: 5'-ATGGCTAACCCAAGTGAGATCGATTA-3'; CiLV-N-NPR: 5'-AGTTGCCTTGAGATCATCACATTGGT-3') and putative matrix protein (M) genes (CiLV-N-MF: 5'-ATGTCTAAACAGATTAATATGTGCACTGTG-3'; CiLV-N-MR: 5'-CTAACCACTGGGTCCCGC-3') were utilized to identify the CiLV associated with the leprosis-affected leaf samples from Casanare. RT-PCR with CiLV-C primers failed to produce any amplicon, but CiLV-N primers successfully amplified the partial N gene (681 bp) and entire M gene (552 nt) amplicons from multiple leaves of all leprosis samples. In addition, a 795-bp amplicon specific to CiLV-C2 also was amplified from the CiLV-N suspected samples. Similar results were obtained when the vector, flat spider mite (Brevipalpus spp.) total RNA was used as template for RT-PCR. For further confirmation, each amplicon was cloned and sequenced. Sequencing of the N and M gene amplicons of CiLV-N (accession nos. KJ195893 and KJ195894) and coat protein gene of CiLV-C2 showed 97 to 99% nucleotide sequence identity with the CiLV-N M2345 isolate sequence (KF209275) from Mexico (4) and CiLV-C2 L147V1 isolate sequence (JX000024) from Colombia (3), respectively. Phylogenetic analyses of these N and M protein gene sequences confirmed a mixed infection of the same plant with two viruses, one from an unassigned new genus Dichorhavirus (CiLV-N) and another from genus Cilevirus (CiLV-C2). This is the first report of CiLV-N in Colombia, and also the first report of an occurrence of CiLV-N in mixed infection with CiLV-C2. All three known species of CiLV occur in the Orinoco region of Colombia. References: (1) M. G. León et al. Plant Dis. 90: 682, 2006. (2) J. P. R. Marques et al. Anais da Academia Brasileira de Ciências 82:501, 2010. (3) A. Roy et al. Phytopathology 103:488, 2013. (4) A. Roy et al. Genome Announc. 1(4): e00519-13, 2013.

Immunodiagnosis of Citrus leprosis virus C using a polyclonal antibody to an expressed putative coat protein.

Citrus leprosis virus C (CiLV-C), a causal agent for citrus leprosis disease, is present in South and Central America and is a threat for introduction into the U.S. citrus industry. A specific, inexpensive and reliable antibody based detection system is needed for the rapid identification of CiLV-C. The CiLV-C is very labile and has not been purified in sufficient amount for antibody production. The p29 gene of CiLV-C genome that codes for the putative coat protein (PCP) was codon optimized for expression in Escherichia coli and synthesized in vitro. The optimized gene was sub-cloned into the bacterial expression vector pDEST17 and transferred into E. coli BL21AI competent cells. The expression of PCP containing N-terminal His-tag was optimized by induction with l-arabinose. Induced cells were disrupted by sonication and expressed PCP was purified by affinity chromatography using Ni-NTA agarose. The purified expressed PCP was then used as an immunogen for injections into rabbits to produce polyclonal antibody (PAb). The PAb specific to the expressed PCP was identified using Western blotting. The antibody was successfully used to detect CiLV-C in the symptomatic CiLV-C infected tissues using double antibody sandwich-enzyme-linked-immunosorbent (DAS-ELISA), indirect ELISA and dot-blot immunoassay (DBIA) formats.

Genome assembly of citrus leprosis virus nuclear type reveals a close association with orchid fleck virus.

The complete genome of citrus leprosis virus nuclear type (CiLV-N) was identified by small RNA sequencing utilizing leprosis-affected citrus samples collected from the state of Querétaro, Mexico. The nucleotide identity and phylogenetic analysis indicate that CiLV-N is very closely related to orchid fleck virus, which typically infects Cymbidium species.

A novel virus of the genus Cilevirus causing symptoms similar to citrus leprosis.

Citrus leprosis in Colombia was previously shown to be caused by cytoplasmic Citrus leprosis virus (CiLV-C). In 2011, enzyme-linked immunosorbent assay and reverse-transcription polymerase chain reaction (RT-PCR)-based diagnostic methods failed to identify CiLV-C from citrus samples with symptoms similar to citrus leprosis; however, virions similar to CiLV-C were observed in the cytoplasm of the symptomatic leaves by transmission electron microscopy. Furthermore, the causal organism was transmitted by the false spider mite, Brevipalpus phoenicis, to healthy citrus seedlings. A library of small RNAs was constructed from symptomatic leaves and used as the template for Illumina high-throughput parallel sequencing. The complete genome sequence and structure of a new bipartite RNA virus was determined. RNA1 (8,717 nucleotides [nt]) contained two open reading frames (ORFs). ORF1 encoded the replication module, consisting of five domains: namely, methyltransferase (MTR), cysteine protease-like, FtsJ-MTR, helicase (Hel), and RNA-dependent RNA polymerase (RdRp); whereas ORF2 encoded the putative coat protein. RNA2 (4,989 nt) contained five ORFs that encode the movement protein (MP) and four hypothetical proteins (p7, p15, p24, and p61). The structure of this virus genome resembled that of CiLV-C except that it contained a long 3' untranslated terminal region and an extra ORF (p7) in RNA2. Both the RNA1 and RNA2 of the new virus had only 58 and 50% nucleotide identities, respectively, with known CiLV-C sequences and, thus, it appears to be a novel virus infecting citrus. Phylogenetic analyses of the MTR, Hel, RdRp, and MP domains also indicated that the new virus was closely related to CiLV-C. We suggest that the virus be called Citrus leprosis virus cytoplasmic type 2 (CiLV-C2) and it should be unambiguously classified as a definitive member of the genus Cilevirus. A pair of CiLV-C2 genome-specific RT-PCR primers was designed and validated to detect its presence in citrus leprosis samples collected from the Casanare and Meta states in Colombia.